Parasitol Res DOI 10.1007/s00436-013-3716-5
ORIGINAL PAPER
Efficacy of Leishmania donovani trypanothione reductase, identified as a potent Th1 stimulatory protein, for its immunogenicity and prophylactic potential against experimental visceral leishmaniasis Prashant Khare & Anil Kumar Jaiswal & Chandra Dev Pati Tripathi & Sumit Joshi & Shyam Sundar & Anuradha Dube
Received: 25 July 2013 / Accepted: 21 November 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract In visceral leishmaniasis (VL), Th1-type of immune responses play an important role which correlates with recovery from and resistance to disease resulting in lifelong immunity. Based on this rationale, the soluble leishmanial antigens that elicit cellular responses in peripheral blood mononuclear cells (PBMCs) from cured Leishmania patients were characterized through immunoproteomic approach which led to the identification of trypanothione reductase (TPR) (a cytosolic enzyme explored as a drug target), as one of the potent Th1 stimulatory protein. In this study, the immunogenicity of recombinant Leishmania donovani TPR (rLdTPR) was assessed in PBMCs of cured Leishmania-infected patients/hamsters and further evaluated its prophylactic efficacy against L. donovani challenges in hamsters. Substantial proliferative responses to rLdTPR, as compared to soluble L. donovani antigen, were observed in Leishmania-infected cured patients as well as in hamsters. Moreover, rLdTPR reasonably stimulated PBMCs of cured Leishmania patients to produce IFNγ, IL-12, and TNF-α but not IL-4 or IL-10. On the other hand, the protein downregulated LPS-induced IL-10 as well as soluble L. donovani antigen-induced IL-4 production in PBMCs of Leishmania patients. In case of cured hamsters, rLdTPR generates mixed Th1 and Th2 immune response. Vaccination with rLdTPR along with Bacillus P. Khare : A. K. Jaiswal : C. D. P. Tripathi : S. Joshi : A. Dube (*) Division of Parasitology, Central Drug Research Institute (CDRI), Post Box No. 173, Lucknow 226 001, India e-mail:
[email protected] A. Dube e-mail:
[email protected] S. Sundar Division of Medicine, Institute of Medical Sciences, BHU, Varanasi, India
Calmette–Guerin (BCG) was able to provide considerably good prophylactic efficacy (~60 %) against L. donovani challenge in hamsters. The efficacy was supported by the increased inducible NO synthase mRNA transcript and Th1type cytokines IFNγ, IL-12, and TNF-α and downregulation of IL-4, IL-10, and TGF-β. Since rLdTPR protein is an important target, further attempts towards determination of immunodominant regions for designing fusion peptides may be taken up to optimize its prophylactic efficacy.
Introduction Visceral leishmaniasis (VL), caused by protozoan parasite Leishmania donovani, is associated with impaired cellular responses and a conserved humoral response (Herwaldt 1999; Stanley and Engwerda 2007; Haldar et al. 1983; Wyler et al. 1979; Cillari et al. 1988). The available chemotherapy for VL is not satisfactory and alternate strategies, such as prevention through vaccination, need to be developed for the control of this disease. Induction of a lifelong protection against reinfection in recovered Leishmania patients demonstrates that a protective vaccine can be achieved (Bacellar et al. 1996; Modabber 1990; Hailu et al. 2001; Kubar and Fragaki 2005). T-helper and T-cytotoxic cells are the main weapons for cell-mediated immune (CMI) response and the T-helper cells play an important role through the production of IL-2 and IFNγ cytokines. These two cytokines constrain the effector functions of macrophages and trigger a Th1 immune response (Peruhype-Magalhaes et al. 2005). Hence, modalities to immunopotentiate the Th1 arm of the immune response could be explored as vaccine candidates. Based on this idea, recently, several potential protective antigens from L. donovani promastigotes were identified
Parasitol Res
through immunoproteomics that induced a Th1 response in the peripheral blood mononuclear cells (PBMCs) of cured/ endemic Leishmania patients (Gupta et al. 2007; Kumari et al. 2008a). Interestingly, trypanothione reductase (TPR), the enzyme responsible for maintaining trypanothione in its reduced form and is thought to be central to the redox defence systems of trypanosomatids, was identified through proteomics for the first time as one of the Th1 stimulatory protein from soluble Leishmania lysate (Gupta et al. 2007). TPR is known to play a crucial role in regulating the intracellular thiol redox balance and in the defence against chemical and oxidative stress (Krauth-Siegel and Comini 2008). Voluminous reports are available for this enzyme used as a drug target but none for its immunogenic potential. In the present study, we generated recombinant L. donovani TPR (rLdTPR) and evaluated for its immunogenicity and protective potential in golden hamsters (Mesocricetus auratus ) as this experimental model shows similar clinicopathological features to progressive human VL, including increased visceral burden, progressive cachexia, hepatosplenomegaly, pancytopenia, hypergammaglobulinemia, and ultimately death (Melby et al. 2001); (Singh et al. 2007).
Materials and methods
and reverse-GAATTC GAGGTTGCTGCTCAGCTTTTCG ACGCGCTTGCC primers (Bam HI and Eco RI sites underlined), L. donovani genomic DNA as template, and Taq DNA polymerase (TaKaRa) in a thermocycler (BioRad). The conditions used in 1 cycle were: 96 °C for 4 min, 30 cycles of 94 °C for 1 min, 55 °C for 1.30 min, 72 °C for 2 min, and finally 1 cycle of 72 °C for 10 min. Amplified product was cloned in pTZ57R/T (T/A) cloning vector (Fermentas) and sequenced from Delhi University (New Delhi). The LdTPR gene sequence was submitted to the NCBI genebank (http://www.ncbi.nlm.nih.gov/nuccore/ JN007485, accession no. JN007485). LdTPR gene was subcloned at the BamHI and EcoRI sites in bacterial expression vector pET28a (Novagen) in frame with C-terminal hexahistidine tag and overexpressed in Escherichia coli C41 strain. The transformed cells were grown in Luria-Bertani medium and induced at OD600 with 1.0 mM isopropyl-β-D -thiogalactopyranoside for 5 h at 37 °C. The overexpressed rLdTPR was purified as denatured protein by affinity chromatography using Ni2+ chelating resin in presence of 6 M urea. The eluted fractions were analyzed by 12 % sodium dodecyl sulphatepolyacrylamide gel electrophoresis and the protein content was estimated by Bradford method using bovine serum albumin as standard. The presence of endotoxin was tested by QCL-1000H Chromogenic LAL kit (Lonza).
Animals and parasites Laboratory-bred male hamsters (45–50 g) from the institute's animal house facility were used as experimental host. Their usage was approved by the institute's animal ethical committee (protocol number 24/05/Para/IAEC dated 15.09.2005). The L. donovani strain (2001), procured from a patient at Kala-azar Medical Research Centre, Institute of Medical Sciences, BHU, Varanasi, was maintained in vitro as well as in animals through serial amastigote passages as described elsewhere (Garg et al. 2005; Dube et al. 2005).
Production of polyclonal antibodies against the recombinant Leishmania donovani trypanothione reductase and Western blot analysis The antibodies was raised in rabbit by immunization with 100 μg of purified rLdTPR in Freund's complete adjuvant, followed by two booster doses of 50 μg rLdTPR in incomplete Freund's adjuvant at 2-week intervals and blood was collected 8 days later for serum. Western blot analysis of rLdTPR and SLD was done as per protocol of Towbin et al. (1979).
Soluble L. donovani promastigote antigen Soluble L. donovani promastigote antigen (SLD) was prepared as per protocol of Gupta et al. (2007). Briefly, log phase promastigotes (109) (3- to 4-day-old culture) were repeatedly washed in phosphate-buffered saline (PBS) and subjected to ultrasonication and centrifugation at 40,000×g for 30 min. The protein content of the supernatant was estimated (Lowry et al. 1951) and stored at −70 °C. Cloning, expression, and purification of recombinant Leishmania donovani trypanothione reductase LdTPR gene was PCR amplified using forward-GGAT CC ATGTCCCGCGCGTACGACCTCGTGGTGCTTGG
Patients and isolation of peripheral blood mononuclear cells The study groups for human samples were as follows: 1. Eight cured patients (two males and six females, age range 2–32 years) from hyperendemic areas of Bihar who had recovered from VL 2 months to 1 year after receiving complete course of amphotericin B. Diagnosis was established by demonstration of parasites in splenic aspirates which was negative at the time of study. 2. Six endemic household contacts (two males and four females, age range 5–45 years) who neither showed clinical symptoms nor received any treatment for VL.
Parasitol Res
3. Six infected patients (three males and three females, age range 5–49 years) showing clinical symptoms of Kalaazar. 4. Six normal healthy donors (four males and two females, age range 25–30 years) from nonendemic areas, without any history of leishmaniasis, served as negative control. The study was approved by the ethics committee of the Kala-azar Medical Research Centre, Muzaffarpur (Protocol # EC-KAMRC/Vaccine/VL/2007-01). Heparinized venous blood (10 ml each) was collected from all study subjects and PBMCs were isolated from blood by Ficoll Hypaque density gradient centrifugation (Histopaque 1077, Sigma-Aldrich, USA) as described by Garg et al. (2005). A final suspension of 1×106 cells/ml was made in complete RPMI medium (cRPMI) after determining cell viability by trypan blue staining method. Treatment of L. donovani-infected hamsters and isolation of mononuclear cells (lymph node cells) Approximately 30 hamsters infected with 107 L. donovani amastigotes intracardially (i.c.) and harboring >20–25 amastigotes/100 macrophage cell nuclei, when assessed 30 days postinfection (p.i.) for parasitic burden by splenic biopsy (Kushawaha et al. 2012), were treated with Miltefosine (Zentaris, Germany) at 40 mg/kg bodyweight daily for 5 days. The complete cure was reassessed on day 30 post-treatment (p.t.) by splenic biopsy. Mononuclear cells were separated from lymph nodes of cured, infected, and normal hamsters on necropsy following the protocol of Garg et al. (2005) and a suspension of 106 cells/ml was made in cRPMI. Assessment of prophylactic efficacy of recombinant Leishmania donovani trypanothione reductase in golden hamsters to Leishmania challenge For immunization studies, hamsters (12–15 per group) were divided into four groups, wherein animals belonging to groups 1–3 served as controls and those of group 4 were immunized intradermally (i.d). on the back with rLdTPR (50 μg/50 μl per animal) together with an equal volume of Bacillus Calmette– Guerin (BCG) (100 μl per animal) in emulsified form (vaccinated group). The animals of group 1were unvaccinated and unchallenged (normal control), and those of group 2 were unvaccinated but challenged (infected control). Hamsters of group 3 were vaccinated with BCG only. Fifteen days later, a booster dose of half of the amount of rLdTPR+BCG was given i.d. to all the hamsters of group 4 and only BCG to the animals of group 3. Groups 2–4 were challenged i.c. with 107 stationary phase promastigotes of L. donovani 21 days later. The weight of body, spleen, and liver of hamsters of all of the experimental groups were assessed, on necropsy, at
different time intervals. The parasite burden was assessed in spleen, liver, and bone marrow of vaccinated groups on days 0, 45, 60, 90, and 120 postchallenge (p.c.). At these time points, peritoneal exudates cells, inguinal lymph nodes, and blood were also collected to obtain cells and sera for evaluation of cellular and antibody responses. The criterion for prophylactic efficacy was the assessment of parasite load as the number of amastigotes per 1,000 cell nuclei in each organ in comparison to the unvaccinated controls and the percentage inhibition was assessed in comparison to the unvaccinated control (Garg et al. 2006). Immunological assays Delayed type hypersensitivity Delayed type hypersensitivity (DTH) was performed by injecting 50 μg/50 μl of SLD in PBS i.d. into one footpad and PBS alone into the other one of each of the vaccinated and unvaccinated controls. The response was evaluated 48 h later by measuring the difference in footpad swelling between the two groups with and without SLD for each animal (Bhowmick et al. 2007). Lymphocyte proliferation assay Lymphocyte proliferation assay (LTT) was carried out as per protocol described by Garg et al. (2005). Lymphocytes suspension (1×106 cells/ml) of cured/exposed patients as well as normal, infected (day 30 p.i.), cured hamsters and vaccinated hamsters was cultured in 96-well flat bottom tissue culture plates (Nunc, Denmark). Estimation of nitric oxide activity in macrophages of hamsters Isolated mononuclear cells from all the three study groups of hamsters viz. normal, infected (day 30 p.i.), and cured were suspended in culture medium and plated at 105 cells/well and stimulated for 3 days in case of mitogen (LPS, 10 μg/ml) and 5 days in case of antigens (rLdTPR, SLD) at 10 μg/ml. The presence of nitric oxide (NO) was assessed using Griess reagent (Sigma-Aldrich, USA) in the culture supernatants of naive hamster peritoneal macrophages (Garg et al. 2005; Ding et al. 1988). Similar protocol for measuring NO production was used in rLdTPR vaccination study. Assessment of cytokine levels: IFNγ/IL-12/IL-10 in PBMCs of cured/endemic patients Culture of PBMCs (1×106 cells/ml) from human patients was set up in 96-well culture plates and rLdTPR, as well as SLD, was added in triplicate wells at a concentration of 10 μg/ml.
Parasitol Res
The levels of IFNγ,IL-12 and IL-10 were estimated by enzyme-linked immunosorbent assay (ELISA) kit (OptEIA set, Pharmingen) after 5 days of incubation with antigen using supernatants. The results were expressed as picograms of cytokine per milliliter, based on the standard curves of the respective cytokine provided in the kit. Quantification of mRNA cytokines and inducible nitric oxide synthase in hamsters by real time-PCR Real-time (RT)-PCR was performed to assess the expression of mRNAs for various cytokines and inducible nitric oxide synthase (iNOS) in splenic cells as described by Kushawaha et al 2012. Primers were designed using Beacon Designer software (Bio-Rad) on the basis of cytokines and iNOS mRNA sequences available on PubMed (Melby et al. 1998a) (Table 1). Measurement of antibody response in hamsters The level of IgG antibody and its isotypes in sera samples of hamsters of different experimental groups was measured as per protocol described by Samant et al. (2009). Statistical analysis Results were expressed as mean±S.D. In each experiment, 12–15 animals were used in each group. Three sets of experiments were performed and the results were analyzed by oneway ANOVA test using Prism GraphPad software program. The upper level of significance was chosen as P
