Efficient Genetic Modification of Cynomolgus ... - Ingenta Connect

0963-6897/10 $90.00 + .00 DOI: 10.3727/096368910X504469 E-ISSN 1555-3892 www.cognizantcommunication.com

Cell Transplantation, Vol. 19, pp. 1181–1193, 2010 Printed in the USA. All rights reserved. Copyright  2010 Cognizant Comm. Corp.

Efficient Genetic Modification of Cynomolgus Monkey Embryonic Stem Cells With Lentiviral Vectors Weiqiang Li,*†1 Chang Liu,*†1 Jie Qin,*† Li Zhang,‡ Rui Chen,*† Jing Chen,*† Xinbing Yu,*† Guifu Wu,§ Bruce T. Lahn,*†‡ Yongshui Fu,¶ and Andy Peng Xiang*†#** *Center for Stem Cell Biology and Tissue Engineering, Sun Yat-sen University, Guangzhou, Guangdong, P.R. China †The Key Laboratory for Stem Cells and Tissue Engineering, Ministry of Education, Guangzhou, P.R. China ‡Department of Human Genetics and Howard Hughes Medical Institute, University of Chicago, Chicago, IL, USA §Division of Cardiology, First Affiliated Hospital, Sun Yat-sen University, Key Laboratory on Assisted Circulation, Ministry of Health, Guangzhou, P.R. China ¶Guangzhou Blood Center, Guangzhou, P.R. China #Department of Biochemistry, Zhongshan Medical School, Sun Yat-sen University, Guangzhou, Guangdong, P.R. China **State Key Laboratory of Ophthalmology, Sun Yat-sen University, Guangzhou, P.R. China

Embryonic stem (ES) cells have the ability to undergo indefinite self-renewal in vitro and give rise during development to derivatives of all three primary germ layers (ectoderm, endoderm, and mesoderm), which make them a highly prized reagent in cell and gene therapy. Efficient introduction of various genes of interest into primate ES cells has proven to be difficult. Here, we demonstrated that the self-inactivating HIV-1-based lentiviral vectors constructed by MultiSite gateway technology are efficient tools for the transduction of cynomolgus monkey (Macaca fasicularis) ES (cmES) cells. After antibiotic selection, all of the transduced cells can stably express the reporter gene (humanized Renilla GFP or dTomato) while maintaining their stem cell properties, including continuous expression of stem cell markers, alkaline phosphatase (AKP), OCT-4, SSEA-4, and TRA-1-60, formation of embryoid bodies in vitro and teratomas in vivo containing derivatives of three embryonic germ layers. This approach will provide a useful tool for both gene function studies and in vivo cell tracking of stem cells. Key words: Primate embryonic stem cells; Lentivirus; Transduction; Green fluorescent protein

INTRODUCTION

highly controversial ethical and legal questions. In addition, because of the differences between rodent and primate embryonic development (13,29), the nonhuman primate-based models will be of great value for testing ES cell delivery, differentiation, safety, toxicity, and efficacy in vivo before the clinical application of human ES cell transplantation can be attempted. Since the cynomolgus monkey (Macaca fasicularis) ES (cmES) cell lines have been established, the similarities shared by the hES cells and the cmES cells have been clearly identified, which include surface marker expression, dependence of feeder cells for self-renewal, and differentiation capacity (37,49), making the cmES cells an ideal substitute for hES cells in the research. Genetic engineering of cmES cells will help to detect

Embryonic stem (ES) cells are derived from the inner cell mass of a blastocyst or earlier stage embryos (7,11, 32,42). They have the ability to undergo long-term selfrenewal in vitro and produce derivative lineages of all three embryonic germ layers in vitro and in vivo, including neurons, astrocytes (ectoderm) (17,24,31), cardiomyocytes, blood cells (mesoderm) (5,45), insulinproducing cells, and liver cells (endoderm) (27,35). Hence, ES cells prove themselves valuable candidate for developmental biology studies and unlimited resources for regenerative medicine. Application of human ES cells as a model for basic and therapeutic applications has been plagued with

Received August 11, 2009; final acceptance April 20, 2010. Online prepub date: May 4, 2010. 1These authors provided equal contribution to this work. Address correspondence to Andy Peng Xiang, Center for Stem Cell Biology and Tissue Engineering, Sun Yat-sen University, 74# Zhongshan Road 2, Guangzhou, Guangdong, 510080, P.R. China. Tel: +86-20-87335822; Fax: +86-20-87335858; E-mail: [email protected] or Yongshui Fu, Guangzhou Blood Center, Luyuan Road 31#, Guangzhou, 510095, P.R. China. Tel: +86-20-83593187; Fax: +86-20- 83575958; E-mail: fuyongshui [email protected]

1181

1182

LI ET AL.

their in vivo differentiation profile and study functions of interested genes. Until now there are different methods for transferring exogenous genes into nonhuman primate ES cells, such as lipofection (43), electroporation (12), and virus-mediated transduction including Sendai virus (20,33), simian immunodeficiency virus (SIV) (2,48), and helper-dependent adenoviral vectors (HDAdVs) (39). The self-inactivating HIV-1-based lentiviral vectors, which have the ability to infect cells at mitotic and postmitotic stages of the cell cycle, are ideal tools for transducing many kinds of cell types (6,52). However, previous studies found that recombinant HIV-1 expressing green fluorescent protein and pseudotyped with the vesicular stomatitis virus G glycoprotein cannot efficiently infect the cells of Old World monkeys (3,15,28), and until now few reports described lentiviral transduction of cmES cells. Here, we demonstrated that cmES cells can be efficiently transduced by HIV-1-based lentiviral vectors constructed through MultiSite gateway technology, while the genetically modified cmES cells retained their stem cell properties, self-renewal, and pluripotency. MATERIALS AND METHODS Cell Culture cmES cells (kindly provided by Dr. Nakatsuji) (37) were maintained in undifferentiated state on irradiated mouse embryonic fibroblasts (MEFs). The culture medium contained 80% Knock-out DMEM (Invitrogen,

Carlsbad, CA, USA), supplemented with 16% knockout serum replacement (Invitrogen), 4% fetal bovine serum (Hyclone, Logan, UT, USA), 0.1 mM β-mercaptoethanol (Sigma, St. Louis, MO, USA), 1% nonessential amino acids (Hyclone), 100 IU/ml penicillin (Hyclone), 100 µg/ml streptomycin (Hyclone), and 4 ng/ml human basic fibroblast growth factor (bFGF) (Chemicon, Temecula, CA, USA). Vector Constructions To generate a pDestpuro vector, we first performed PCR using pBabe-puro vector DNA (AddGene, Inc., Cambridge, MA, USA) as a PCR template to amplify the fragment of puromycin resistance encoding sequence with restriction enzyme sites of PmlI and KpnI. We subsequently used the PCR product of puromycin resistance encoding sequence to replace both the blasticidin resistance encoding sequence and the bacterial EM7 promoter of lentiviral 2k7bsd vector between PmlI and KpnI sites of the vector (kindly provided by Dr. David M. Suter, University of Geneva Medical School, Geneva, Switzerland) (38) in order to generate a pDestpuro destination vector, in which the fragment of attR4 site—ccdBchloramphenicol resistance encoding sequence—attR2 site was still retained. In order to generate entry vectors, EF1α promoter and either hrGFP or dTomato of two different reporter genes were cloned into pDONRTMP4P1R and pDONRTM221 (Invitrogen), respectively, by utilizing the Gateway BP recombination reaction follow-

Table 1. Sequences, Product Size, and Annealing Temperature of Primers Used for PCR Amplification

Sequence (5′–3′)

Length (bp)

Annealing Temperature (°C)

OCT-4

CGTGAAGCTGGAGAAGGAGAAGCTG CAAGGGCCGCAGCTTACACATGTTC

247

55

Nanog

CAAAGGCAAACAACCCACTT CTGGATGTTCTGGGTCTGGT

426

56

Rex1

CTGAAGAAACGGGCAAAGAC GAACATTCAAGGGAGCTTGC

343

55

SOX2

CAACGGCAGCTACAGCA GGAGTGGGAGGAAGAGGT

283

60

Collagen 1

GATGGATTCCAGTTCGAGTATG GTTTGGGTTGCTTGTCTGTTTC

480

58

SOX17

GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT

60

60

Neurofilament

ACCCGACTCAGTTTCACCA TTCTTCACCTTCACCTCCTTC

356

58

β-Actin

GTGGGGCGCCCCAGGCACCA CTCCTTAATGTCACGCACGATTTC

540

62

Gene

LENTIVIRAL MODIFICATION OF MONKEY ES CELLS

1183

Figure 1. Construction of pLV/Final lentivectors, pLV/Final-puro-EF1α-hrGFP and pLV/Final-puro-EF1α-dTomato.

ing the product instructions. The resulting vectors, which we named pUp-EF1α, pDown-hrGFP, and pDown-dTomato, were then recombined into the pDestpuro vector generated above following the protocol for LR recombination reaction using the Gateway LR plus clonase enzyme mix to construct expression lentiviral vectors, designated as pLV/Final-puro-EF1α-hrGFP or pLV/Final-puro-EF1α-dTomato. Lentivirus Production and Transduction of cmES Cells The lentiviral particles were prepared by transient cotransfection of pLV/Final-puro-EF1α-hrGFP or pLV/ Final-puro-EF1α-dTomato with pRSV-REV, pCMVVSVG, and pMDL-G/P-RRE (kindly provided by Professor Hsiang-fu Kung, The Chinese University of Hong Kong, China) into 293FT cells using Lipofectamine 2000. Three days after transfection, viral particles were harvested from the medium, filtered through 0.45-µm pore size polyethersulfone membrane, and concentrated by ultracentrifugation (50,000 × g, for 120 min at 4°C). Titers of the concentrated lentivirus ranged from 5 × 107 to 8 × 107 U/ml. cmES cells were transduced with lentivirus at multiplicity of infection (MOI) of 50 or 100. Undifferentiated cmES cells were washed with PBS and dissociated to single cells by 0.25% TrypLETM Select (Invitrogen) for 3–5 min at 37°C. A selective Rho-associated kinase (ROCK) inhibitor, Y-27632, was added to the culture medium to enhance the survival of dissociated cmES cells before and after trypsinization as described elsewhere (46). Then the dissociated cells were plated onto the fresh MEF feeder layer with lentiviral

particles. Eight hours after infection, the medium was changed to fresh culture medium and cells were incubated at 37°C for a subsequent 16 h. Seven days after transduction, puromycin was added to the culture medium at a concentration of 1–5 µg/ml and maintained for 7 days. Fluorescence-Activated Cell Sorting Analysis We analyzed the transduction rate by fluorescenceactivated cell sorting (FACS) analysis 5 days after infection. Transduced and untransduced cmES cells were mechanically separated from MEFs and then were dissociated to single cells by TrypLETM Select. The isolated cells were resuspended in phosphate-buffered saline (PBS) and analyzed on a FACScan (Becton Dickinson, Franklin Lakes, NJ, USA) using excitation at 500 nm (hrGFP) and 554 nm (dTomato) and fluorescence detection at 506 nm (hrGFP) and 581 nm (dTomato). Untransduced cells served as negative controls. Self-Inactivation of Lentivectors in 293FT Cells 293FT cells (2 × 105) seeded on one well of a sixwell plate were transduced with pLV/Final-puro-EF1αhrGFP (dTomato) concentrated lentivirus for 96 h without changing the medium, when most of the cells expressed green (red) fluorescent protein. The supernatants were then collected and filtered through a 0.45-µm pore size polyethersulfone membrane, and 1 or 2 ml was incubated with newly plated 2 × 105 293FT cells. Experiments were performed in triplicate. After 72 h of incubation, no green (red) fluorescent protein expression

1184

LI ET AL.

Figure 2. cmES cells were analyzed for hrGFP (a, c) and dTomato (b, d) expression 5 days after transduction (a, b) and 7 days (c, d) after puromycin selection under fluorescent microscope and by FACS. Untransduced cmES cells served as negative control. Scale bars: 100 µm.


1185

Figure 3. Immunofluorescence analysis of transduced cmES cells. Pluripotent ES cell markers of hrGFP (a–d) and dTomato cmES cells (e–h), including AKP (a, e), OCT-4 (b, f), SSEA-4 (c, g), and TRA-1-60 (d, h) were detected. MEFs were used as negative controls. Scale bars: 100 µm.

1186

LI ET AL.

logically after hematoxylin and eosin staining. All experimental procedures involving animals were approved by the Animal Ethics Committee of Sun Yat-sen University. Immunocytochemistry, Immunohistochemistry, and Alkaline Phosphatase Activity Assay

Figure 4. RT-PCR analysis of undifferentiated cmES cells. Expression of markers associated with undifferentiated transduced cmES cells, including OCT-4, Nanog, Rex1, and SOX2 in hrGFP and dTomato cmES cells at passage 35. β-Actin was used as a housekeeping gene control.

could be detected in 293FT cells incubated in either supernatant, demonstrating that pLV/Final-puro-EF1αhrGFP (dTomato)-transduced 293FT cells do not release infectious lentiviral particles into the medium. In Vitro Differentiation of Transduced cmES Cells For neural differentiation, transduced cmES cells of 80% confluency were dissociated as described above. The resulting cell clumps were cultured in a petri dish to form embryoid bodies (EBs) for 7 days using culture medium containing 20% serum replacement without bFGF, then EBs were plated on the 2% gelatin-coated six-well plate for 14 days using neural progenitor medium (NPM) (51) containing 20 ng/ml bFGF and 20 ng/ ml epidermal growth factor (EGF) (Chemicon). For mesodermal differentiation, dissociated transduced cmES cell clumps were cultured in a petri dish to form EBs for 7 days using culture medium containing 20% fetal bovine serum without bFGF, then EBs were plated on a 2% gelatin-coated six-well plate for 14 days using the same medium. For endodermal differentiation, when the cmES cells reached 80% confluency, ES medium was changed to RPMI-1640 medium (Invitrogen) containing 100 ng/ml human activin A (R&D Systems, Minneapolis, MN, USA) and lasted for 5 days. Teratoma Formation of Transduced cmES Cells About 1–2 × 107 morphologically undifferentiated fluorescent cmES cells were collected and injected subcutaneously into inguinal groove of 6-week-old nude mice. After 12 weeks, tumors were taken out, fixed in 4% paraformaldehyde, dissected, and examined histo-

For immunocytochemistry assessment, undifferentiated and differentiated transduced cmES cells were fixed in 4% paraformaldehyde for 20 min and washed twice with PBS. Nonspecific antibody binding was blocked with goat serum and 1% bovine serum albumin (BSA, Sigma) and then incubated with primary antibodies against SSEA-4 (1:200; DSHB, Iowa City, IA, USA), TRA-1-60 (1:200; DSHB), OCT-4 (1:100; Santa Cruz, CA, USA), SOX17 (1:100; R&D Systems), desmin (1: 200; Neomarker, Westinghouse Drive, Fremont, CA, USA), and nestin (1:100; Abcam, Cambridge, UK) overnight at 4°C. Secondary antibody was added at room temperature for 1–2 h in the dark: goat Cy3-conjugated anti-mouse (1:400; Jackson, West Grove, PA, USA), goat R-phycoerythrin-conjugated and fluorescein isothiocyanate-conjugated anti-mouse (1:400; Southernbiotech, Birmingham, AL, USA). Nucleus was counterstained with Hoechst33342 (Sigma). MEFs were used as negative controls. For immunohistochemistry assessment, formalinfixed and paraffin-embedded teratoma samples were deparaffinized, rehydrated, and then incubated with fresh 3% hydrogen peroxide (H2O2) in methanol for 10 min. After rinsing with PBS, antigen retrieval was carried out by microwave treatment in 0.01 M sodium citrate buffer (pH 6.0) at 100°C for 15 min. Next, nonspecific binding was blocked with normal goat serum for 15 min at room temperature, followed by incubation with anti-βIIItubulin antibody (1:100; R&D Systems), anti-collagen II antibody (1:200, Chemicon), and anti-AFP antibody (1: 100; R&D Systems) overnight at 4°C. After rinsing with PBS, slides were incubated for 10 min at room temperature with biotin-conjugated secondary antibodies, followed by incubation with streptavidin-conjugated peroxidase working solution for 10 min. Subsequently, sections were stained for 15–30 min with 3-amino-9ethylcarbazole (AEC), counterstained with Mayer’s hematoxylin. Negative controls were prepared by substituting PBS for primary antibody. The activity of alkaline phosphatase was performed by histochemical staining. Transduced cmES cells were fixed in 4% paraformaldehyde at room temperature for 15 min and washed twice with PBS, and then stained with the alkaline phosphatase substrate BCIP/NBT (Sigma) for 20–30 min. The cells were observed for color reaction by light microscopy.


1187

Figure 5. In vitro differentiation assays of transduced cmES cells. hrGFP (a) and dTomato cmES cells formed EBs in vitro (e). Immunofluorescence analysis revealed that these transduced cells differentiated into cells belong to three germ layers, including nestin (b, f), desmin (c, g), and SOX17 (d, h), while maintaining expression of hrGFP and dTomato. MEFs were used as negative controls. Scale bars: 100 µm.

1188

LI ET AL.

vector, and the reporter gene, hrGFP or dTomato, was subsequently cloned into the recombination site (attL1 and attL2) of the pDONRTM221 vector, respectively. The generated entry vectors, pUp-EF1α, pDown-hrGFP, and pDown-dTomato (Fig. 1), were then recombined into pDestpuro destination vector to generate two expression clones, pLV/Final-puro-EF1α-hrGFP and pLV/Finalpuro-EF1α-dTomato (Fig. 1).

Figure 6. Expression of pluripotent marker and three germ layer markers in differentiated transduced cmES cells, including OCT-4, neurofilament (NF), collagen 1, and SOX17.

Reverse Transcription-PCR Total RNA was extracted from undifferentiated and differentiated transduced cmES cells, or from control MEF cells with Trizol reagent (Invitrogen). For eliminating any contaminating genomic DNA, the total RNA was subjected to DNase I (Fermentas, MD, USA) according to the directions of the manufacturer. Reverse transcription was carried out using murine leukemia virus reverse transcriptase (Fermentas) and oligo-dT primers (Fermentas) according to the manufacturer’s instruction. Then the samples were subjected to amplification with human-specific primers. β-Actin was used as positive control. The PCR products were analyzed by 1.2% agarose gel electrophoresis and visualized by ethidium bromide staining. The detailed information of primers is listed in Table 1. RESULTS Construction of pLV/Final Lentivectors The self-inactivating lentiviral vector, 2k7bsd, contains a double recombination cassette (attR4 and attR2 Gateway cassette), which allows the recombination of a promoter and a gene of interest from two separate entry vectors. This vector also contains a blasticidin resistance under the control of a ubiquitous promoter, SV40. Compared with other conventional selection drugs, G418 and hygromycin, the antibiotic puromycin is considered to be more effective in the selection of ES cells with shorter selection time and higher germline differentiating potency (47). We then replaced the blasticidin resistance with a puromycin resistance as described above. This new destination vector was referred to as pDestpuro (Fig. 1). The EF1α promoter was cloned into the recombination site (attL4 and attR1) of the pDONRTMP4-P1R

Constitutive Expression of hrGFP or dTomato in cmES Cells cmES cells were transduced by simply being exposed to lentivirus on MEF feeder layers. Five days after transduction, the percentage of hrGFP (Fig. 2a) or dTomato (Fig. 2b) positive cmES cells was analyzed by microscopic observation and FACS analysis. We found that the transduction efficiency was MOI dependent: 30– 40% with MOI of 50 and 70–85% with MOI of 100. Transduced cells were then subsequently selected by puromycin (1–5 µg/ml) for 7 days. Fluorescence was observed in all of the infected cmES cells after selection (Fig. 2c, d) and the expression levels were well maintained over 6 months in culture in the absence of the antibiotic. These results suggested that integration of the pLV/Final vectors in undifferentiated cmES cells was stable in vitro and the transduced cmES cells can be maintained as a purified population for a prolonged period after puromycin selection. Characteristics of Lentivirus-Transduced cmES Cells The stem cell properties of transduced cmES cells, self-renewal and pluripotency, were assessed by immunocytochemistry, RT-PCR, immunohistochemistry, and histological analysis. hrGFP or dTomato expressed cmES cells maintained the characteristics of the parental cmES cells. The cell morphology was typical of cmES cells (Fig. 3) and they exhibited a high level of alkaline phosphatase activity (Fig. 3a, e), as well as continuing to express the markers of pluripotency, including OCT4 (Fig. 3b, f), SSEA-4 (Fig. 3c, g), TRA-1-60 (Fig. 3d, h), Nanog, SOX2, and Rex-1 (Fig. 4). Fluorescence microscopy observations (Fig. 5) showed that hrGFP and dTomato expression were well maintained in EBs too (Fig. 5a, e). Immunocytochemistry analysis showed that infected cmES cells gave rise to cells expressing ectoderm (nestin), endoderm (SOX17), and mesoderm (desmin) markers (Fig. 5b–d, f–h) in vitro, while sustaining transgene expression. RT-PCR detection demonstrated that these differentiated cmES cells expressed neurofilament (NF), collagen I and SOX17, while OCT-4 expression was downregulated (Fig. 6). Transduced cmES cells also formed teratomas (Fig. 7) 12 weeks after implantation (Fig. 7a, i). Most of the cells inside tumors were hrGFP


Figure 7. In vivo differentiation of transduced cmES cells. Transduced cmES cells formed fluorescent teratomas (a, i) 12 weeks later after implantation. Most of the cells inside tumors were hrGFP or dTomato positive (b, j). Histological analysis of teratomas derived from hrGFP cmES (c–h) and dTomato cmES (k–p) revealed that both of them contained derivatives of three germ layers, including ectoderm-derived neural-lineage cells (c) and squamous epithelium (k), mesoderm-derived chondrocytes (d) and muscle cells (l), as well as endoderm-derived glandular epithelium (e) and respiratory tract epithelium (m). Immunohistochemistry analysis also revealed that βIII-tubulin (ectoderm marker) (Fig. 7f, n), collagen II (mesoderm marker) (Fig. 7g, o), and AFP (endoderm marker) (Fig. 7h, p) were all expressed in hrGFP or dTomato cmES cell-derived teratomas. Scale bars: 100 µm.

1189

1190

or dTomato positive (Fig. 7b, j). Histological analysis of teratomas derived from hrGFP cmES (Fig. 7c–h) and dTomato cmES (Fig. 7k–p) revealed that both of them contained derivatives of three germ layers, including ectoderm-derived neural lineage cells (Fig. 7c) and squamous epithelium (Fig. 7k), mesoderm-derived chondrocytes (Fig. 7d), and muscle cells (Fig. 7l), as well as endoderm-derived glandular epithelium (Fig. 7e) and respiratory tract epithelium (Fig. 7m). Immunohistochemistry analysis also revealed that βIII-tubulin (ectoderm marker) (Fig. 7f, n), collagen II (mesoderm marker) (Fig. 7g, o), and AFP (endoderm marker) (Fig. 7h, p) were all expressed in hrGFP or dTomato cmES cell-derived teratomas. DISCUSSION In this report, we transduced cmES cells with HIV1-based lentiviral vectors efficiently. After antibiotic selection, the cmES cells with constitutive expression of the reporter gene, hrGFP or dTomato, were obtained. In long-term in vitro culture, the transduced cells maintained the distinct characteristics of cmES cells, including continuous expression of stem cell markers such as AKP, OCT-4, Nanog, Rex-1, SOX2, SSEA-4, and TRA1-60, formation of embryoid bodies in vitro, and teratomas in vivo containing derivatives of three embryonic germ cells. Efficient genetic modification of primate ES cells has proven to be difficult. Lipid-mediated transfection that using DNA–liposome complex highly depends on the cell cycle and is more effective in mitotic cells (26). As a result, lipofection usually gets poor results in primate ES cells (10). Conventional electroporation is largely independent of cell cycle and can efficiently transfect murine ES cells (41), and a modified electroporation protocol successfully induced homologous recombination in human embryonic stem cells (53). Nucleofection is a new technique developed from conventional electroporation, which transports DNA into the nucleus directly and was proved to transduce different cell lines with relatively high efficiency, such as primary neurons (8) and human ES cells (16). However, these methods require large quantities of cells and linearized plasmid DNA to achieve sufficient efficiency, and, moreover, the electric pulse and cell dissociation tend to induce primate ES cells to undergo massive cell death (1,10,12). It has been reported that the Sendai virus (SeV) vector efficiently introduced the green fluorescent protein (GFP) gene into cmES cells and this GFP gene was stably expressed for 1 year (20,33). This kind of nonintegrating transgene, however, will be diluted out of the cells with repeated division in long-term culture. Utilizing helper-dependent adenoviral vectors (HDAdVs) also can achieve highly efficient transient gene expression in primate ES cells,

LI ET AL.

but the chromosomal integration frequencies were relatively low (⬃2.7 × 10−5/cell) (39). Simian immunodeficiency virus (SIV)-based lentiviral vectors had been used to transduce cmES cells efficiently (2). However, a purified fluorescent cmES cells were not achieved and the properties of infected cells were not described in that study. HIV-1 based lentiviral transduction represents a powerful gene delivery system for gene- and cell-based therapy because of their high efficiency in transfecting cells at both mitotic and postmitotic stages of the cell cycle in vitro or in vivo (6), and integration of exogenous genes into host cell genome with little immunogenicity (22). Several studies have demonstrated that HIV-1 based lentiviral vectors achieved high performance in genetic modification of mouse and human ES cells without transgene silencing during differentiation in vitro and in vivo (14,25,30). As for the biosafety consideration, the lentiviral constructs we used here are selfinactivating lentiviral systems by extensive deletion of viral elements (9,52). The vectors constructed by MultiSite gateway technology have two advantages over traditional lentiviral vectors. One is easy insertion of promoters, genes of interest, and reporter genes, which may help us to construct vectors containing reporter genes under the control of tissue-specific promoter to monitor ES cell differentiation. The other is the possibility to select transduced cells through different antibiotics for obtaining highly purified transduced population (38). Usually, the transgenic expression rate of lentiviral transduction was about 20–80% (21), which is not so optimum. Thus, an efficient selection method is essential for obtaining a pure population of tranduced cells. Mechanical isolation of hrGFP- or dTomato-expressing cells under fluorescent microscope offers a strategy, but it is laborious (19). For the FACS method, transduced cmES cells have to be dissociated, which will result in a low cell survival rate. Antibiotics selection can achieve a highly purified transduced cell population in 7 days without laborious work or cell dissociation. Therefore, for cmES cells, the antibiotic selection offers a preferable choice. In the pLV/Final lentivectors we used here, the selection marker was under the control of a ubiquitous promoter (SV40) and independent from the promoter of the gene of interest, which can ensure us a highly purified population of transduced cmES cells. Additionally, hrGFP and dTomato were selected as reporter genes in our plasmids. hrGFP was isolated from a marine organism and has been fully humanized using codons preferred in highly expressed human genes. Compared with the Aequorea GFP (EGFP), the hrGFP shares high observed levels of fluorescence and, additionally, displays much more consistency in vitro and in vivo (40,50).


dTomato is one of the “fruit” proteins and is derived from an intermediate termed dimer2 that was generated during the breakup of the tetrameric DsRed protein (4). It has been proved that dTomato has greater photostability than DsRed and monomeric RFP through the comparison of the time for their fluorescence to bleach to 50% initial emission intensity (34). Previous studies demonstrated that HIV-1 replication encounters a block before reverse transcription in Old World monkeys, and identified TRIM5α, a component of cytoplasmic body, as the blocking factor (36). Nevertheless, according to our results, we got 50–85% transduction rate in cmES cells by HIV-1-based lentivirus. In addition, other reports (18,23,44) also demonstrated that HIV-1-based lentivirus can efficiently transduce cynomolgus monkey or rhesus monkey neural stem cells and mesenchymal stem cells. It remains elusive whether the blocking system is not yet developed in cynomolgus monkey stem cells and that these cells are more susceptible to HIV-1 infection than somatic cells (peripheral blood mononuclear cells, etc.). After antibiotic selection, a homogeneous population of fluorescent cmES cells was obtained. We have not yet observed obvious gene silencing during stem cell proliferation and differentiation in vitro. However, we did observe that some of the transduced cmES cells lost transgene expression during in vivo differentiation. To establish cmES cell clones that are homogeneous for their transgene integration and stably express the transgenes in both undifferentiated and differentiated states in vitro and in vivo might be beneficial. In conclusion, HIV-1-based lentiviral vector constructed by MultiSite gateway technology provides a safe and effective tool for genetic modification of cmES cells without affecting their stem cell properties. Although HIV-1-based lentivirus is one of genome-integrating viruses that could cause insertional mutagenesis and unpredictable genetic dysfunction and might not be suitable for clinical applications, this approach still have widespread use, such as stem cell differentiation, toxicity, drug screening, and cell tracing. ACKNOWLEDGMENTS: We thank Dr. Yongsheng Zong (Pathological Department, The First Affiliated Hospital of Sun Yat-sen University) for technical assistance. This work was supported by the National Basic Research Program of China (2008CB517406), National Natural Science Foundation of China (30671023, 30770896), and the Key Scientific and Technological Projects of Guangdong Province (2007A032100003).

REFERENCES 1. Amit, M.; Carpenter, M. K.; Inokuma, M. S.; Chiu, C. P.; Harris, C. P.; Waknitz, M. A.; Itskovitz-Eldor, J.; Thomson, J. A. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev. Biol. 227(2):271–278; 2000.

1191

2. Asano, T.; Hanazono, Y.; Ueda, Y.; Muramatsu, S.; Kume, A.; Suemori, H.; Suzuki, Y.; Kondo, Y.; Harii, K.; Hasegawa, M.; Nakatsuji, N.; Ozawa, K. Highly efficient gene transfer into primate embryonic stem cells with a simian lentivirus vector. Mol. Ther. 6(2):162–168; 2002. 3. Besnier, C.; Takeuchi, Y.; Towers, G. Restriction of lentivirus in monkeys. Proc. Natl. Acad. Sci. USA 99(18): 11920–11925; 2002. 4. Campbell, R. E.; Tour, O.; Palmer, A. E.; Steinbach, P. A.; Baird, G. S.; Zacharias, D. A.; Tsien, R. Y. A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99(12):7877–7882; 2002. 5. Chadwick, K.; Wang, L.; Li, L.; Menendez, P.; Murdoch, B.; Rouleau, A.; Bhatia, M. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood 102(3):906–915; 2003. 6. Chang, L. J.; Gay, E. E. The molecular genetics of lentiviral vectors—current and future perspectives. Curr. Gene Ther. 1(3):237–251; 2001. 7. Chung, Y.; Klimanskaya, I.; Becker, S.; Marh, J.; Lu, S. J.; Johnson, J.; Meisner, L.; Lanza, R. Embryonic and extraembryonic stem cell lines derived from single mouse blastomeres. Nature 439(7073):216–219; 2006. 8. Dityateva, G.; Hammond, M.; Thiel, C.; Ruonala, M. O.; Delling, M.; Siebenkotten, G.; Nix, M.; Dityatev, A. Rapid and efficient electroporation-based gene transfer into primary dissociated neurons. J. Neurosci. Methods 130(1):65–73; 2003. 9. Dull, T.; Zufferey, R.; Kelly, M.; Mandel, R. J.; Nguyen, M.; Trono, D.; Naldini, L. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 72(11):8463–8471; 1998. 10. Eiges, R.; Schuldiner, M.; Drukker, M.; Yanuka, O.; Itskovitz-Eldor, J.; Benvenisty, N. Establishment of human embryonic stem cell-transfected clones carrying a marker for undifferentiated cells. Curr. Biol. 11(7):514– 518; 2001. 11. Evans, M. J.; Kaufman, M. H. Establishment in culture of pluripotential cells from mouse embryos. Nature 292(5819): 154–156; 1981. 12. Furuya, M.; Yasuchika, K.; Mizutani, K.; Yoshimura, Y.; Nakatsuji, N.; Suemori, H. Electroporation of cynomolgus monkey embryonic stem cells. Genesis 37(4):180–187; 2003. 13. Ginis, I.; Luo, Y.; Miura, T.; Thies, S.; Brandenberger, R.; Gerecht-Nir, S.; Amit, M.; Hoke, A.; Carpenter, M. K.; Itskovitz-Eldor, J.; Rao, M. S. Differences between human and mouse embryonic stem cells. Dev. Biol. 269(2):360– 380; 2004. 14. Gropp, M.; Itsykson, P.; Singer, O.; Ben-Hur, T.; Reinhartz, E.; Galun, E.; Reubinoff, B. E. Stable genetic modification of human embryonic stem cells by lentiviral vectors. Mol. Ther. 7(2):281–287; 2003. 15. Hofmann, W.; Schubert, D.; LaBonte, J.; Munson, L.; Gibson, S.; Scammell, J.; Ferrigno, P.; Sodroski, J. Species-specific, postentry barriers to primate immunodeficiency virus infection. J. Virol. 73(12):10020–10028; 1999. 16. Hohenstein, K. A.; Pyle, A. D.; Chern, J. Y.; Lock, L. F.; Donovan, P. J. Nucleofection mediates high-efficiency stable gene knockdown and transgene expression in human embryonic stem cells. Stem Cells 26(6):1436– 1443; 2008. 17. Kato, T.; Heike, T.; Okawa, K.; Haruyama, M.; Shiraishi, K.; Yoshimoto, M.; Nagato, M.; Shibata, M.; Kumada, T.; Yamanaka, Y.; Hattori, H.; Nakahata, T. A neurosphere-

1192

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29. 30.

derived factor, cystatin C, supports differentiation of ES cells into neural stem cells. Proc. Natl. Acad. Sci. USA 103(15):6019–6024; 2006. Ke, H.; Wang, P.; Yu, W.; Liu, X.; Liu, C.; Yang, F.; Mao, F. F.; Zhang, L.; Zhang, X.; Lahn, B. T.; Xiang, A. P. Derivation, characterization and gene modification of cynomolgus monkey mesenchymal stem cells. Differentiation 77(3):256–262; 2009. Kim, S.; Kim, G. J.; Miyoshi, H.; Moon, S. H.; Ahn, S. E.; Lee, J. H.; Lee, H. J.; Cha, K. Y.; Chung, H. M. Efficiency of the elongation factor-1alpha promoter in mammalian embryonic stem cells using lentiviral gene delivery systems. Stem Cells Dev. 16(4):537–545; 2007. Kishi, Y.; Inoue, M.; Tanaka, Y.; Shibata, H.; Masuda, S.; Ikeda, T.; Hasegawa, M.; Hanazono, Y. Knockout serum replacement (KSR) has a suppressive effect on Sendai virus-mediated transduction of cynomolgus ES cells. Cloning Stem Cells 10(3):307–312; 2008. Kobayashi, N.; Rivas-Carrillo, J. D.; Soto-Gutierrez, A.; Fukazawa, T.; Chen, Y.; Navarro-Alvarez, N.; Tanaka, N. Gene delivery to embryonic stem cells. Birth Defects Res. C Embryo Today 75(1):10–18; 2005. Kordower, J. H.; Emborg, M. E.; Bloch, J.; Ma, S. Y.; Chu, Y.; Leventhal, L.; McBride, J.; Chen, E. Y.; Palfi, S.; Roitberg, B. Z.; Brown, W. D.; Holden, J. E.; Pyzalski, R.; Taylor, M. D.; Carvey, P.; Ling, Z.; Trono, D.; Hantraye, P.; De´glon, N.; Aebischer, P. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson’s disease. Science 290(5492): 767–773; 2000. Lee, C. I.; Kohn, D. B.; Ekert, J. E.; Tarantal, A. F. Morphological analysis and lentiviral transduction of fetal monkey bone marrow-derived mesenchymal stem cells. Mol. Ther. 9(1):112–123; 2004. Lopez-Gonzalez, R.; Kunckles, P.; Velasco, I. Transient recovery in a rat model of familial amyotrophic lateral sclerosis after transplantation of motor neurons derived from mouse embryonic stem cells. Cell Transplant. 18(10–11):1171–1181; 2009. Ma, Y.; Ramezani, A.; Lewis, R.; Hawley, R. G.; Thomson, J. A. High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells 21(1):111–117; 2003. Mortimer, I.; Tam, P.; MacLachlan, I.; Graham, R. W.; Saravolac, E. G.; Joshi, P. B. Cationic lipid-mediated transfection of cells in culture requires mitotic activity. Gene Ther. 6(3):403–411; 1999. Naujok, O.; Francini, F.; Picton, S.; Jorns, A.; Bailey, C. J.; Lenzen, S. A new experimental protocol for preferential differentiation of mouse embryonic stem cells into insulin-producing cells. Cell Transplant. 17(10–11):1231– 1242; 2008. Owens, C. M.; Yang, P. C.; Gottlinger, H.; Sodroski, J. Human and simian immunodeficiency virus capsid proteins are major viral determinants of early, postentry replication blocks in simian cells. J. Virol. 77(1):726–731; 2003. Pera, M. F.; Trounson, A. O. Human embryonic stem cells: Prospects for development. Development 131(22): 5515–5525; 2004. Pfeifer, A.; Ikawa, M.; Dayn, Y.; Verma, I. M. Transgenesis by lentiviral vectors: Lack of gene silencing in mammalian embryonic stem cells and preimplantation embryos. Proc. Natl. Acad. Sci. USA 99(4):2140–2145; 2002.

LI ET AL.

31. Reubinoff, B. E.; Itsykson, P.; Turetsky, T.; Pera, M. F.; Reinhartz, E.; Itzik, A.; Ben-Hur, T. Neural progenitors from human embryonic stem cells. Nat. Biotechnol. 19(12):1134–1140; 2001. 32. Reubinoff, B. E.; Pera, M. F.; Fong, C. Y.; Trounson, A.; Bongso, A. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nat. Biotechnol. 18(4):399–404; 2000. 33. Sasaki, K.; Inoue, M.; Shibata, H.; Ueda, Y.; Muramatsu, S. I.; Okada, T.; Hasegawa, M.; Ozawa, K.; Hanazono, Y. Efficient and stable Sendai virus-mediated gene transfer into primate embryonic stem cells with pluripotency preserved. Gene Ther. 12(3):203–210; 2005. 34. Shaner, N. C.; Campbell, R. E.; Steinbach, P. A.; Giepmans, B. N.; Palmer, A. E.; Tsien, R. Y. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22(12):1567–1572; 2004. 35. Sharma, A. D.; Cantz, T.; Vogel, A.; Schambach, A.; Haridass, D.; Iken, M.; Bleidissel, M.; Manns, M. P.; Scholer, H. R.; Ott, M. Murine embryonic stem cellderived hepatic progenitor cells engraft in recipient livers with limited capacity of liver tissue formation. Cell Transplant. 17(3):313–323; 2008. 36. Stremlau, M.; Owens, C. M.; Perron, M. J.; Kiessling, M.; Autissier, P.; Sodroski, J. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 427(6977):848–853; 2004. 37. Suemori, H.; Tada, T.; Torii, R.; Hosoi, Y.; Kobayashi, K.; Imahie, H.; Kondo, Y.; Iritani, A.; Nakatsuji, N. Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn. 222(2):273–279; 2001. 38. Suter, D. M.; Cartier, L.; Bettiol, E.; Tirefort, D.; Jaconi, M. E.; Dubois-Dauphin, M.; Krause, K. H. Rapid generation of stable transgenic embryonic stem cell lines using modular lentivectors. Stem Cells 24(3):615–623; 2006. 39. Suzuki, K.; Mitsui, K.; Aizawa, E.; Hasegawa, K.; Kawase, E.; Yamagishi, T.; Shimizu, Y.; Suemori, H.; Nakatsuji, N.; Mitani, K. Highly efficient transient gene expression and gene targeting in primate embryonic stem cells with helper-dependent adenoviral vectors. Proc. Natl. Acad. Sci. USA 105(37):13781–13786; 2008. 40. Swenson, E. S.; Price, J. G.; Brazelton, T.; Krause, D. S. Limitations of green fluorescent protein as a cell lineage marker. Stem Cells 25(10):2593–2600; 2007. 41. Templeton, N. S.; Roberts, D. D.; Safer, B. Efficient gene targeting in mouse embryonic stem cells. Gene Ther. 4(7): 700–709; 1997. 42. Thomson, J. A.; Itskovitz-Eldor, J.; Shapiro, S. S.; Waknitz, M. A.; Swiergiel, J. J.; Marshall, V. S.; Jones, J. M. Embryonic stem cell lines derived from human blastocysts. Science 282(5391):1145–1147; 1998. 43. Ueda, S.; Yoshikawa, M.; Ouji, Y.; Saito, K.; Moriya, K.; Nishiofuku, M.; Hayashi, N.; Ishizaka, S.; Shimada, K.; Konishi, N.; Fukui, H. Cynomolgus monkey embryonic stem cell lines express green fluorescent protein. J. Biosci. Bioeng. 102(1):14–20; 2006. 44. Wang, P.; Liu, X. M.; Ma, B. F.; Jia, L.; Wang, D.; Zhang, X. M.; Yu, X. B.; Lahn, B. T.; Xiang, A. P. Isolation, characterization and gene modification of fetal neural stem/progenitor cells from cynomolgus monkey. Neuroreport 19(4):419–424; 2008. 45. Wang, Y.; Yates, F.; Naveiras, O.; Ernst, P.; Daley, G. Q. Embryonic stem cell-derived hematopoietic stem


46.

47.

48.

49.

cells. Proc. Natl. Acad. Sci. USA 102(52):19081–19086; 2005. Watanabe, K.; Ueno, M.; Kamiya, D.; Nishiyama, A.; Matsumura, M.; Wataya, T.; Takahashi, J. B.; Nishikawa, S.; Muguruma, K.; Sasai, Y. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat. Biotechnol. 25(6):681–686; 2007. Watanabe, S.; Kai, N.; Yasuda, M.; Kohmura, N.; Sanbo, M.; Mishina, M.; Yagi, T. Stable production of mutant mice from double gene converted ES cells with puromycin and neomycin. Biochem. Biophys. Res. Commun. 213(1):130–137; 1995. Wianny, F.; Bernat, A.; Huissoud, C.; Marcy, G.; Markossian, S.; Cortay, V.; Giroud, P.; Leviel, V.; Kennedy, H.; Savatier, P.; Dehay, C. Derivation and cloning of a novel rhesus embryonic stem cell line stably expressing taugreen fluorescent protein. Stem Cells 26(6):1444–1453; 2008. Wolf, D. P.; Kuo, H. C.; Pau, K. Y.; Lester, L. Progress

1193

50.

51.

52.

53.

with nonhuman primate embryonic stem cells. Biol. Reprod. 71(6):1766–1771; 2004. Xiang, A. P.; Mao, F. F.; Li, W. Q.; Park, D.; Ma, B. F.; Wang, T.; Vallender, T. W.; Vallender, E. J.; Zhang, L.; Lee, J.; Waters, J. A.; Zhang, X. M.; Yu, X. B.; Li, S. N.; Lahn, B. T. Extensive contribution of embryonic stem cells to the development of an evolutionarily divergent host. Hum. Mol. Genet. 17(1):27–37; 2008. Zhang, S. C.; Wernig, M.; Duncan, I. D.; Brustle, O.; Thomson, J. A. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat. Biotechnol. 19(12):1129–1133; 2001. Zufferey, R.; Dull, T.; Mandel, R. J.; Bukovsky, A.; Quiroz, D.; Naldini, L.; Trono, D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 72(12):9873–9880; 1998. Zwaka, T. P.; Thomson, J. A. Homologous recombination in human embryonic stem cells. Nat. Biotechnol. 21(3): 319–321; 2003.