Efficient transduction and long-term retroviral expression of ... - Nature

Gene Therapy (2002) 9, 1551–1560  2002 Nature Publishing Group All rights reserved 0969-7128/02 $25.00 www.nature.com/gt

RESEARCH ARTICLE

Efficient transduction and long-term retroviral expression of the melanoma-associated tumor antigen tyrosinase in CD34+ cord blood-derived dendritic cells A Temme1,2, A Morgenroth1, M Schmitz1, B Weigle1, J Rohayem3, D Lindemann3, M Fu¨ssel1, G Ehninger2 and EP Rieber1 1

Institute of Immunology, Medical Faculty Carl Gustav Carus, Technical University Dresden, Dresden, Germany; 2Department of Internal Medicine I, University Hospital Carl Gustav Carus, Dresden, Germany; and 3Institute of Virology, Medical Faculty Carl Gustav Carus, Technical University Dresden, Dresden, Germany

Differentiation of genetically modified CD34+ hematopoietic stem cells into dendritic cells (DCs) will contribute to the development of immunotherapeutic anticancer protocols. Retroviral vectors that have been used for the transduction of CD34+ cells face the problem of gene silencing when integrated into the genome of repopulating stem cells. We reasoned that a high copy number of retroviral DNA sequences might overcome silencing of transgene expression during expansion and differentiation of progenitor cells into functional DCs. To prove this, we utilized a retroviral vector with bicistronic expression of the melanoma-associated antigen tyrosinase and the enhanced green fluorescent protein (EGFP). Human cord blood CD34+ cells were transduced with vesicular stomatitis virus G-protein (VSV-G) pseudo-

typed Moloney murine leukemia virus (MoMuLV) particles using 100–150 multiplicity of infection. During expansion of transduced cells with immature phenotype, transgene expression was strongly silenced, but upon differentiation into mature DCs, residual transgene expression was retained. Intracellular processing of the provirally expressed tyrosinase was tested in a chromium release assay utilizing a cytotoxic T cell clone specific for a HLA-A∗0201-restricted tyrosinase peptide. We suggest that retroviral transduction of tumor-associated antigens in hematopoietic progenitor cells and subsequent differentiation into DCs is a suitable basis for the development of potent anti-tumor vaccines. Gene Therapy (2002) 9, 1551–1560. doi:10.1038/sj.gt.3301821

Keywords: retroviral expression; CD34+-derived DCs; antigen presentation; immunotherapy

Introduction Recently, significant improvements have been made regarding the development and utilization of retroviral and lentiviral vectors.1–4 In particular, the use of these vectors for the genetic modification of dendritic cells has become of interest, because these cells are widely used for clinical protocols in the immunotherapy of cancer. DCs are the most potent antigen-presenting cell type for the priming of naı¨ve, and the activation of resting T lymphocytes. They can be used to efficiently present peptides which are derived from tumor-associated antigens (TAAs).5–10 Primary activation of tumor-specific cytotoxic T cells has been achieved by loading DCs with recombinant protein, tumor-derived peptides, transfer of mRNA or viral DNA coding for TAAs.11–19 Also vaccination with dendritic cell-derived exosomes and fusion of DCs with carcinoma cells has been shown to elicit an anti-tumor response.20,21 The advantage of viral expression is seen in the activation of a broad spectrum of T cells with differCorrespondence: A Temme, Institute of Immunology, Medical Faculty Carl Gustav Carus, Technical University Dresden, Fetscherstrasse 74, 01307 Dresden, Germany The first two authors contributed equally to this work Received 18 December 2001; accepted 23 May 2002

ent T cell receptor (TCR) specificities against various peptides. Furthermore, the direct modification of dendritic cells or DC progenitors has advantages over transiently RNA-transfected or antigen-pulsed DCs, including stable expression of a transgene and high in vitro expansion potential for multiple reinfusions. The most challenging aspects in the development of a successful immunotherapy utilizing DCs are the gene transfer, long-term expression, efficient processing and presentation of the chosen tumor-associated antigen. In this study, we developed an efficient protocol for the maintainance and expansion of CD34+ umbilical cord blood cells and transduced these cells with VSV-G pseudotyped Moloney murine leukaemia virus. In order to determine the efficacy of transduction and the proviral expression we used a retroviral vector coding for a bicistronic human tyrosinase-EGFP-ZEOR and as a control a vector coding for EGFP-ZEOR. Intracellular processing and presentation of the provirally expressed tyrosinase antigens was confirmed by a cytotoxicity assay utilizing a HLA-A∗0201restricted T cell clone reactive to a tyrosinase-derived peptide. In addition, the transductions with a high multiplicity of infection provided stable expression of the proviral coded proteins until senescence of the CD34+derived DCs.

Retroviral expression of tyrosinase in dendritic cells A Temme et al

1552

Results Efficient transduction of human umbilical cord blood CD34+ cells with VSV-G pseudotyped Moloney murine leukemia particles coding for human tyrosinase and EGFP MoMuLV-derived vectors require cell division for efficient transduction of target cells. Primary umbilical cord blood cells are mostly quiescent and must therefore be expanded for efficient retroviral transduction. After preparation of the cells, they were expanded in a stem cell medium containing appropriate cytokines as described in Materials and methods. In order to estimate the optimal time point for transduction, cell numbers of the cultures were determined every day. The CD34+ cells began to proliferate at days 3 to 5 after isolation and a maximal proliferation of the cells was seen on days 5 to 10. Non-transduced cells and transduced cells from all preparations expanded 107- to 204-fold (164.1 ± 44.7) during a 10-day in vitro culture (Figure 1). Helper free Moloney murine leukemia virus vectors expressing EGFP-ZeoR fusion protein or a bicistronic human tyrosinase-IRES-EGFP-ZeoR were made by cotransfection of 293T cells with packaging plasmids and retroviral vector driven by the cytomegalovirus (CMV) promoter. The transient packaging system provided a retroviral titer ranging from 1.0 to 1.2 × 107 and 0.6 to 3.6 × 107 IU/ml for particles encoding for pcz-CFG5-IEGZ and pcz-CFG5Tyr-IEGZ, respectively. CD34+ cells in the phase of maximal proliferation on days 5 to 6 were transduced with viral supernatants representing a 100 to 150 multiplicity of infection (MOI). This high number of VSV-G pseudotyped particles had no obvious effect on the proliferation rate or on the viability of the CD34+ cells, as determined

Figure 1 Efficient expansion of CD34+ cord blood progenitor cells. Cells were prepared using magnetic activated cell sorting and expanded in stem cell medium (SCF) supplemented with GM-CSF (200 U/ml), TNF-␣ (0.5 ng/ml), flt-3 ligand (20 ng/ml), and stem cell factor (SCF) (20 ng/ml). At day 4 after preparation, cells were fed with medium containing 200 U/ml GM-CSF, 0.5 ng TNF-␣, 50 ng/ml IL-3 and 500 U/ml IL-6. After transduction of cells on day 5 and 6 (asterisks) cells were maintained in SCF containing 200 U/ml GM-CSF and 0.5 ng TNF-␣. Beginning on day 10 cells were differentiated as indicated, into mature DCs by increasing the TNF-␣ concentration to 50 ng/ml (n = 3). Error bars represent s.d. Gene Therapy

by trypan blue exclusion. EGFP marker gene expression was assayed 72 h after transduction. We found an average transduction efficacy of 50% for pcz-CFG5-IEGZ, and of 45% for the pcz-CFG5-Tyr-IEGZ, respectively as determined by FACS analysis of proviral EGFP expression. With our transduction protocol we were able to transduce up to 80% of the CD34+ target cells (Figure 2a). Although the mean fluorescence of transduced cells was low, EGFP expressing cells could clearly be identified (Figure 2b). To estimate the copy number of the provirus in the genomes of the hematopoietic stem cells, we performed transductions of cells at 100 MOI. The proviral copy number of the provirus in the cell culture well, transduced with the pcz-CFG5-Tyr-IEGZ vector, was calculated by using the endogenous tyrosinase allele as calibration standard (two tyrosinase copies per genome) (Figure 3). As expected, we did not detect proviral DNA coding for tyrosinase in the non-transduced cells, but could clearly demonstrate multiple proviral copies in the cells transduced with pcz-CFG5-Tyr-IEGZ. The calculated relative proviral copy number of the CD34+ cells emitting EGFP fluorescence was approximately 10–12 copies per transduced cell. Maturation of CD34+ cells into dendritic cells with stable expression of the proviral proteins From day 10 onwards, the CD34+ cells began to attach in the cell culture and upon stimulation with a higher dose of TNF-␣ (50 ng/ml) the cells lost their immature phenotype as shown by the down-regulation of the CD34 surface marker, and they differentiated into DCs with the characteristic high expression of HLA-DR, CD11c, CD80, CD83, CD86 and CD40, whereas surface marker characteristics for other cell types (CD3, T cells; CD19, B cells, data not shown) were either missing or only slightly expressed. E-cadherin expression which is characteristic for Langerhans cells was not detected in differentiated DCs (Figure 4). In summary, no obvious difference in the expression of DC characteristic surface proteins was

Figure 2 Efficient transduction of CD34+ cord blood cells with a VSV-G pseudotyped vector coding for tyrosinase and EGFP. (a) 105 CD34+ cord blood cells were transduced at day 5 and 6, when the cells showed exponential growth. Representative FACS analysis of CD34+ cells 72 h after transduction with pcz-CFG5-Tyr-IEGZ is shown. Open histogram represents control cells from the same donor, which have been treated identically, except the addition of the retroviral supernatant. (b) EGFP expression in transduced cells 72 h and (c) 14 days post transduction. Bars equals 200 ␮m.


positive cells now remained stable until cells underwent senescence, which was seen 6 to 7 weeks after transduction (data not shown). To further verify, that the expression of the transgenes became stable in differentiated DCs over the in vitro cultivation time, we performed a real-time PCR of a 207 bp region of tyrosinase exon1 (data not shown). We titrated an external standard calibration by using the vector pczCFG5-Tyr-IEGZ. We included non-transduced CD34+ in the experiment and found no endogenous expression of the gene. Proviral tyrosinase transcripts were found at all time-points analyzed in transduced DCs as calculated by second derivative analysis method.22 The expression level of tyrosinase mRNA at day 3 after transduction was set at 100%. The expression level decreased to 1.8% on day 8 post transduction (dpt), but remained stable at all other time-points (15 dpt: 1.8%; 19 dpt: 3.5%; 23 dpt: 3.7%), suggesting stable expression of the transgene in differentiated DCs. Therefore, silencing of the proviral DNA was most prominent during the proliferation phase of nondifferentiated stem cells. However, residual tyrosinase expression was stable in differentiated DCs.

Figure 3 Detection of pcz-CFG5-Tyr-IEGZ provirus in the genome of transduced CD34+ cord blood cells. (a) Schematic illustration of the pczCFG5-Tyr-IEGZ provirus and the genomic localization of tyrosinase exons, showing the restriction enzyme sites, fragment lengths and the probe for Southern hybridization. E, EcoRI; S, SacI. (b) Southern blot. Lane 1, transduced CD34+ cells; lane 2, non-transduced CD34+ cells; lane 3, transduced CD34+ cells; lane 4, 5, 1 × 10⫺9 ␮g and 10⫺10 ␮g vector, respectively, digested with SacI/EcoRI. CD34+ cells were transduced with 100 MOI. Absolute proviral copy number of the cell culture was calculated by dividing the 3.7 kb band intensity by the half of the intensity of the 2.4 kb band (two copies of tyrosinase genes in the genome). The relative copy number (copy number in transduced cells) was calculated by adjusting the absolute proviral copy number to the EGFP-positive cells.

found between EGFP-negative and EGFP-positive CD34+derived DCs in the same culture. In addition, we did not find obvious differences in the expression of surface markers when comparing transduced cells with mock transduced DCs (data not shown). A decline in the percentage of cells positive for EGFP expression was observed among proliferating cells (Figure 5a). The mean fluorescence intensity of EGFP+ cells, relative to the non-transduced (EGFP⫺) cells, remained stable over time (Figure 5b). Both developed a higher autofluorescence upon differentiation into DCs. As seen in Figure 5b, the EGFP mean fluorescence intensity of the bicistronic expressed tyrosinase-IRES-EGFP-ZEOR on day 3 after transduction was about 160 mean fluorescence intensity with a signalto-noise ratio (mean of fluorescence intensity of EGFP+ cells divided by the mean of fluorescence intensity of EGFP⫺ cells) between 10 to 12. This signal-to-noise ratio was stable throughout the whole cell cultivation. The low mean fluorescence data obtained with the retroviral vector is probably due to diminished fluorescence activity caused by the EGFP-ZeoR fusion product, because cells transduced with a retroviral vector coding for EGFP showed an increased (40-fold) mean fluorescence when compared with pcz-CFG5-Tyr-IEGZ-transduced cells (data not shown). Furthermore, we found that upon differentiation into the DC-phenotype beginning with day 10, cell proliferation stopped, yet the percentage of EGFP-

1553

Expression of ectopic tyrosinase protein in transduced CD34+ derived dendritic cells To confirm the expression of the tyrosinase protein in transduced CD34+-derived DCs, we used our newly developed 9A1 monoclonal antibody. We validated the feasibility of our antibody by staining pt67 cell lines permanently expressing pcz-CFG5-IEGZ (pt67-IEGZ) and pcz-CFG5-Tyr-IEGZ (pt67-Tyr-IEGZ), respectively. As seen in Figure 6a–d, the antibody specifically detected tyrosinase in the pt67 cells engineered to express bicistronic tyrosinase-EGFP-ZeoR, but failed to detect tyrosinase in the pt67-IEGZ cells (Figure 6e–h). Furthermore, the antibody was tested on slices of histopathologically confirmed melanoma biopsies. The tyrosinase-positive melanoma cells (Figure 6i, red staining, arrows) were detected by the use of the 9A1 mAb. CD34+-derived DCs transduced with pcz-CFG5-TyrIEGZ were tested for proviral tyrosinase transcripts 24 days post transduction in a RT-PCR using specific primers for proviral tyrosinase (Figure 6j). Cytospins of these cells were stained with the monoclonal antibody 9A1. The transduced cells were clearly positive (Figure 6k), in contrast the non-transduced cells lacked expression of the tyrosinase protein (Figure 6l). CD34+-derived dendritic cells express and present proviral tyrosinase leading to activation of specific cytotoxic T cells To assay whether CD34+-derived DCs are capable of expressing, processing and presenting the tyrosinase coded by the provirus, we determined their capacity to induce the cytotoxic activity of the tyrosinase peptidespecific T cell clone TyrF8.23 This clone specifically recognizes the peptide YMDGTMSQV which is bound by HLA-A∗0201 molecules.23 As shown in Figure 7, CD34+derived DCs from two donors with proviral expression of tyrosinase were efficiently lysed by the tyrosinase peptide-specific T cell clone, suggesting that the provirally expressed tyrosinase was intracellularly processed and presented through MHC I molecules. In contrast, CD34+derived DCs transduced with the control vector pczCFG5-IEGZ and differentiated into DCs were not lysed. Gene Therapy


1554

Figure 4 Cell surface analysis of DC markers and costimulatory molecules in transduced DCs. Gating on EGFP-positive and EGFP-negative cells was performed to compare the phenotypes of transduced and non-transduced cells. Non-transduced (EGFP⫺) and transduced CD34+-derived dendritic cells (EGFP+) expressed high levels of characteristic DC markers. Representative flow cytometric analysis of transduced DCs at 24 days after transduction. Each histogram shows the mouse monoclonal isotype control.

It is noteworthy, that we did not find any difference in TyrF8-mediated cytotoxicity when unloaded DCs were compared with pcz-CFG5-IEGZ transduced CD34+derived DCs. We conclude that the transduction procedure did not influence the viability of the cells nor the outcome of the cytotoxicity assay.

Discussion The in vitro genetic manipulation of DCs for the expression of tumor-associated antigens is a contribution to the development of immunotherapeutic approaches to treat cancer. Recent reports have shown the expansion and differentiation of CD34+ progenitor cells into mature DCs.1–4,24–26 Here, we describe an optimized expansion and transduction protocol for CD34+ cord blood cells utilizing VSV-G pseudotyped retroviral particles. It allows the rapid expansion of cord blood derived CD34+ progenitor cells by an average factor of 160 (Figure 1). Exponentially growing cells were efficiently transduced with a gene for the tumor-associated antigen tyrosinase and the reporter gene EGFP-ZEOR, utilizing a transduction protocol without the use of methylcellulose or fibronectin fragments.3,4 A common problem observed with Gene Therapy

MoMuLV vectors has been the silencing of transgene expression over time. A previous report described a complete silencing of MoMuLV proviral sequences in a mouse model within 6 weeks.27 Silencing of proviral sequences could be due to de novo methylation of proviral sequences and altered histone acetylation status over time.28,29 Another report described a methylase-independent mechanism of proviral silencing through MoMuLV and immunodeficiency virus type 1 (HIV-1) cis-acting sequences.30 Facing this problem we decided to transduce the CD34+ progenitor cells with titers ranging from 100 to 150 MOI, which resulted in a high tyrosinase mRNA and concomitant EGFP expression in the first 3 days after transduction. Nevertheless, we revealed a strong silencing of transgenes in the cells during the expansion phase of the progenitor cells. We observed that the mean of fluorescence intensity of EGFP-positive cells remained stable, whereas the percentage of EGFP-positive cells in the culture was decreased. We suggest that this observed effect could be due to decreased proliferation of cells transduced with the VSV-G pseudotyped retroviral particle compared with non-transduced cells. It also might be that a strong retroviral silencing or dilution of unintegrated proviral copies appeared during the


Figure 5 EGFP expression and mean of fluorescence intensity of EGFP in transduced DC. Decrease of EGFP signals occurred in proliferating CD34+ cells, but was stopped when cells differentiated into DCs. (a) Percentage of EGFP expressing CD34+-derived DCs transduced with pczCFG5-Tyr-IEGZ and pcz-CFG5-IEGZ, respectively, scored by flow cytometric analysis of EGFP expression (n = 3, each). (b) Mean fluorescence intensity (MFI) in transduced cells scored by FACS analysis (n = 3, each). The EGFP⫺ (Tyr-IEGZ AF) and EGFP+ (Tyr-IEGZ) mean of DCs was analyzed beginning with day 3 after transduction. The initial setting for FACS analysis at day 3 was used for all time-points. Due to the long cultivation and differentiation into DCs, the cells developed autofluorescence (AF). Error bars represent s.d.

massive expansion of progenitor cells. The latter suggestion is supported by the fact that transduction with 100 MOI did not result in the same number of integrated provirus. Nevertheless, a high proviral copy number of approximately 10–12 was detected 12 days after transduction in the genome of the CD34+ cells. Interestingly, we found that upon differentiation into dendritic cells, the expression level of EGFP and the percentage of EGFPpositive cells remained stable. There was a striking difference between the decrease of EGFP signals and the impairment of tyrosinase mRNA expression during proliferation of transduced progenitor cells. Whereas EGFP signals, monitored by FACS analysis, were decreased approximately two-fold, tyrosinase mRNA expression, was decreased 30-fold, as measured by real-time PCR. Both proteins are expressed from a bicistronic mRNA, therefore expression of these proteins was genetically

coupled. We suggest that high levels of stable EGFP protein caused this discrepancy. Recently, it has been shown that the extended half-life of EGFP protein can mask an inhibition of proviral transcriptional expression in DCs.31 However, tyrosinase protein expression could be detected 24 days after transduction using our 9A1 monoclonal antibody, suggesting that the diminished mRNA copy number is efficiently translated in tyrosinase protein. Furthermore, the tyrosinase expression in differentiated DCs was capable of inducing a cytotoxic response of the tyrosinase-peptide specific T-cell clone TyrF8.23 We conclude that the silencing of provirus sequences occurs during expansion of hematopoietic progenitor cells and that this might be overridden by the high copy number of proviral sequences and the subsequent differentiation in dendritic cells. Multiple proviral integrations in the genome of the host bear the risk of activating protooncogenes and therefore the risk of transformation. Recently, such a transformation has been described in a mouse system by introducing the clinically used dLNGFR marker gene into mouse hematopoietic stem cells.32 Here, the integration of a provirus in the murine gene Evi1 led to acute myeloid leukemia. However, the effect observed in this study was probably due to a cooperative effect of overexpressed Evi1 and the remaining biological activity of the dLNGFR marker gene, because activation of Evi1 alone was not sufficient to induce AML in mice.32 Furthermore, a recent report showed that transduction of mouse hematopoietic stem cells with highly concentrated HIV vectors led to a stable expression of a therapeutic globin gene in transplanted mice without the development of hematopoietic malignancies.33 In the human system, the transduction of human progenitor cells with VSV-G pseudotyped HIV vectors at 60 to 300 MOI also did not result in hematopoietic disorders in transplanted NOD/SCID mice.34 In line with the latter reports, our experiments showed that the high MOI used for the transduction of human CD34+ cells did not lead to transformed cells or a decrease in cell viability. Nevertheless in the future, non-silenced vectors must be created to minimize the negative positional effects, which may arise from multiple integrations in the genome of the host cell. Further analysis revealed that transduced CD34+ cells which were differentiated into dendritic cells could efficiently process and present the tumor-associated antigen tyrosinase resulting in activation of a tyrosinase peptide-specific T cell clone (Figure 7). Thus vaccination with CD34+-derived dendritic cells genetically engineered to express tumor-associated antigens may be a useful tool in eliciting a therapeutic T cell response against tumors. In summary, we have provided evidence that a high MOI for transduction of CD34+ progenitor cells and subsequent differentiation into functional dendritic cells can lead to a long-term expression of the transgene. The use of the bicistronic vector described in this report will allow further dominant selection of cells expressing the transgenes which can be implemented in an in vitro expansion and selection protocol for clinical applications.

1555

Materials and methods Preparation and cultivation of human CD34+ umbilical cord blood cells Cord blood preparations were obtained from the stem cell laboratory, Department of Internal Medicine I, MediGene Therapy


1556

Figure 6 Immunohistological detection of expressed tyrosinase protein in a tyrosinase-positive cell line and transduced CD34+-derived DCs. (a–c) Staining of tyrosinase protein in a pt67-Tyr-IEGZ cell line stably expressing tyrosinase and EGFP-ZeoR detected by confocal laser scan microscopy. (d) The same cell line was used to validate immunstaining using monoclonal 9A1 antibody and secondary peroxidase coupled anti mouse IgG. (e–g) Tyrosinase protein expression is absent from pt67-IEGZ cells only expressing EGFP-ZeoR. (h) Also immunohistological staining of fixed cell negative for tyrosinase expression revealed no signals. (i) Detection of tyrosinase in histopathologically confirmed melanoma by the use of the 9A1 antibody. Tyrosinase-positive cells were stained red by the CHROMGEN reagent (areas of melanoma cells are indicated by arrows). Counterstaining was performed with Mayer⬘s hemalaun. (j) Proviral mRNA of pcz-CFG5-Tyr-IEGZ was detected 24 days after transduction by RT-PCR with specific primers for a 550-bp fragment of the tyrosinase cDNA spanning exon 2 to exon 5. HeLa cell line transfected with pcz-CFG5-Tyr-IEGZ served as a control, also non-transduced cells of the same donor were included in the PCR analysis. (k) Parallel detection of tyrosinase protein in the same CD34+-derived dendritic cells. (l) Nontransduced DCs from the same donor are negative for proviral tyrosinase expression.

cal Faculty Dresden, Technical University Dresden, with informed consent of the blood donors. Briefly, HLAA∗0201 PBMCs were separated by Ficoll–Hyaque (Biochrom AG, Berlin, Germany) density centrifugation and CD34-positive cells were isolated by immunomagnetic cell purification using the direct CD34-Progenitor kit (Miltenyi Biotech, Bergisch Gladbach, Germany) according to the instructions of the supplier. About 5 × 105 to 2 × 106 CD34-positive cells could be isolated from 100 ml to 200 ml of cord blood samples. FACS analysis using an anti-human CD34 phycoerythrin-coupled antibody (Clone 5B1, Miltenyi Biotech) revealed that 95–99% of the cells showed surface expression of the CD34 molecule. Cells were expanded in RPMI1640 medium (GIBCO BRL, Eggenstein, Germany) supplemented with 2 mM L-glutamine, 1% nonessential amino acids (Biochrom AG), 100 U/ml penicillin, 100 ␮g/ml streptomycin (both from Gibco BRL), 5 × 10⫺5 M 2-mercaptoethanol and 10% heat-inactivated fetal calf serum (Gibco Gene Therapy

BRL) which is referred to as stem cell medium (SCM). Before use the medium was supplemented with granulocyte macrophage colony-stimulating factor (GM-CSF, 200 U/ml), tumor necrosis factor-alpha (TNF-␣, 0.5 ng/ml), fms-like tyrosine kinase 3-ligand (flt-3-L, 20 ng/ml), and stem cell factor (SCF, 20 ng/ml) (all cytokines were provided by Strathmann Biotech, Hannover, Germany). The proliferation of the CD34+-derived cells was monitored every day concomitantly adding fresh SCM supplemented with cytokines to obtain 5 × 105 cells/ml during the whole expansion phase. At day 5 to 7 the cells exhibited strong proliferation and were used for transduction with retroviral vectors. Generation of anti-tyrosinase monoclonal antibody and staining of tyrosinase expressing CD34+ cells The cDNA of human tyrosinase was kindly provided by Dr T Wolfel (Medical Department III, Johannes-Gutenberg-University Mainz, Mainz, Germany) and the cDNA


slices of melanoma biopsies. Detection of tyrosinase on paraffin-embedded histopathologically confirmed melanoma biopsies was performed with the 9A1 antibody (1:120) and secondary staining with alkaline phosphatase coupled secondary goat anti-mouse antibody, using the DAKO ChemMate Detection Kit (DAKO, Hamburg, Germany) according to the instructions of the supplier. For the detection of tyrosinase in DCs, PFA-fixed cytospins of transduced and non-transduced CD34+-derived DCs were washed three times with PBS/0.1% BSA and incubated with the 9A1 antibody (1:80 diluted) for 1 h in a humidified chamber. After washing with PBS/0.1% BSA, the cells were incubated for 1 h with peroxidase conjugated anti-mouse IgG (stock solution, diluted 1:80, as recommended by the supplier, DAKO, Hamburg, Germany). Cytospins were washed three times in PBS/0.1% BSA, and incubated for 10 min with H2O2 and 3-amino-9-ethyl-carbazole (Sigma, Dreieich, Germany). The enzymatic reaction was stopped with doubledistilled water, and the cells were counterstained with Mayer⬘s hemalaun before being examined by microscopy.

Figure 7 The proviral expressed melanoma-associated antigen tyrosinase is processed and presented by CD34+-derived DCs. The ability of CD34+derived DCs to present an intracellularly produced tryosinase-derived peptide 7 days and 8 days post transduction (dpt) with pcz-CFG5-Tyr-IEGZ, the control vector pcz-CFG5-IEGZ or loading with the HLA∗0201 binding tyrosinase protein-derived petide YMDGTMSQV was analyzed in a 4-h standard 51Cr-release assay. The CTLs recognizing processed tyrosinase were only specific for the tyrosinase-peptide YMDGTMSQV. They were used as effector cells and were added at different effector to target (E:T) ratios. Two representative experiments with CD34+-derived cells from different donors are shown.

coding for a 28 kDa intramelanosomal domain (aa 285– 475), containing the peptide sequence YMDGTMSQV, was modified by PCR using the primers TyrN2 (5’-CACGGATCCCATCAGTCTTTATGCAATGGA) and TyrC1 (5’-AACTGCAGGTGATGGTGATGGTGATGCC AGATCCGACTCGCTTGTT) resulting in additional 5⬘BamHI and 3⬘-PstI restriction sites, respectively. The PCR product was ligated into pGEM-T (Promega, Mannheim, Germany) and the sequence of the human tyrosinase was verified by sequencing using the pUC M13 reverse and forward primer. The BamHI/PstI fragment containing the human tyrosinase was excised and ligated into the expression vector pQE30 (Qiagen, Hilden, Germany) using the the appropriate BamHI and PstI sites of the vector enabling expression with N-terminal 6xHis-tag. The recombinant tyrosinase fragment was overexpressed in E. coli M15[pREP4] (Qiagen), purified from cell lysates by affinity chromatography on Ni-NTA-agarose column and refolded by dialysis against buffer RFB (100 mM H3BO3, 10 mM Tris, pH 7.4). Refolded tyrosinase was used to immunize BALB/c mice (1 × 100 ␮g and 3 × 50 mg). Hybridomas were generated by the fusion of spleen cells with X-63AG8 myeloma cells according to standard procedures. Hybridomas were screened for reactivity with recombinant tyrosinase fragment by ELISA and Western blotting. One of the tyrosinase mAb (9A1) recognizing recombinant human tyrosinase as well as intracellular tyrosinase, was used for the detection of tyrosinase in transduced cells and on

1557

Retroviral vectors and generation of VSV-G pseudotyped particles The full length cDNA of the human tyrosinase in QE30 (Qiagen) was excised with EcoRI and HindIII and subcloned into the corresponding restriction sites of pBKCMV (Stratagene, Amsterdam, The Netherlands) to obtain an additional 3⬘-SmaI restrictions site. The full length tyrosinase cDNA was excised by EcoRI/SmaI digestion and the 1.6 kb restriction fragment was ligated into the EcoRI/SwaI restriction sites of the Moloney murine leukaemia virus derived vector pcz-CFG5-IEGZ. (This vector originally described as pEGZ/MCS has been renamed by Dirk Lindemann (Institute of Virology, Medical Faculty Carl Gustav Carus, Technical University Dresden, Dresden, Germany) as pcz-CFG5-IEGZ.35,36) resulting in the vector pcz-CFG5-Tyr-IEGZ. The tyrosinase sequence and the vector insert boundaries were verified by sequencing using both strands using the ALFexpress Auto Read sequencing kit (Amersham Pharmacia Biotech) with cyanine-labeled forward primer CFG2/5-5.1 5⬘-GACCACCCCCACCGCCCTC and reverse primer CFG2/5-3.1 5⬘-GCCAAACCTACAGGTGGGG. To validate the bicistronic expression of tyrosinase and EGFPZeoR we generated pt67 cells (Clontech, Heidelberg, Germany) permanently expressing pcz-CFG5-Tyr-IEGZ (pT67-Tyr-IEGZ) and pcz-CFG5-IEGZ (pT67-IEGZ), respectively. These cell lines were used to analyze the expression of the transgenes by confocal laser scan microscopy (Leica TCS-NT, Heidelberg, Germany). Tyrosinase protein was detected with the monoclonal antibody 9A1 and a secondary goat anti-mouse IgG phycoerythrin-coupled antibody (1:120 diluted stock solution, DAKO). Recombinant retroviral particles were generated by using the three vector packaging system as described. Briefly, 293T cells were transiently cotransfected with an expression construct for gag-pol (pHIT60), the MoMuLVbased retroviral vectors and the vesicular stomatitis virus G-protein (pcz-VSV-Gwt, described previously.35–38 The transfected 293T cells were cultured in stem cell medium without cytokines until virus supernatants were harvested 48 to 72 h after transfection. Twenty-four hours Gene Therapy


1558

after transfection, fresh medium containing 10 mM sodium butyrate was added to enhance expression of the retroviral vector. Virus supernatants were pooled and filtered (0.45 ␮m pore size filter), polybrene (Sigma) was added to a final concentration of 8 ␮g/ml, and the supernatants were either used immediately or stored at ⫺80°C. The retroviral titer (infectious units, IU) was determined by plating 105 HeLa target cells in 30-mm wells and transducing with diluted 1:10 to 1:107 viral supernatants. To detect replication competent viruses supernatants from the transduced HeLa, cells were used to infect proliferating HeLa cells. No replication competent viruses were detected in any of the vector preparations. Transduction of primary human cord blood CD34+ cells The day before transduction 1 × 105 CD34+ progenitor cells per well in a 24-well plate were fed with fresh stem cell medium containing recombinant human cytokines (200 U/ml GM-CSF, 0.5 ng/ml TNF-␣, 50 ng/ml IL-3 and 500 U/ml IL-6, all cytokines were from Strathmann Biotech, Hannover, Germany). The next day, cells were incubated with supernatants containing VSV-G pseudotyped pcz-CFG-5-IEGZ or pcz-CFG5-Tyr-IEGZ retroviral particles supplemented with cytokines and centrifuged at 2400 g, 30°C for 2 h. The cells were transduced with retroviral titers ranging from 100 to 150 MOIs. Seventy-two hours after transduction, cells expressing the EGFP reporter were determined by FACS analysis. After 16 h in culture, the transduction step was repeated and cells were cultivated in stem cell medium containing 200 U/ml GM-CSF and 0.5 ng/ml TNF-␣. The cell viability thereafter was greater than 97% as determined with trypan blue exclusion. The cells differentiated into dendritic cells by increasing the concentration of TNF-␣ to 50 ng/ml. One day before the tyrosinase-specific CTL assay, the non-transduced and transduced cells were incubated with CD40L (Strathmann Biotech) and LPS (E. coli 026:B6, Sigma) to enhance antigen presentation as described.39 Southern blot and hybridization To analyze the proviral copy number, transductions of CD34+ cells were performed at 100 MOI. After determination of the transduction efficacies by FACS-assisted quantification of EGFP-positive cells, the genomic DNA was prepared 12 days after transduction from non-transduced and pcz-CFG5-Tyr-IEGZ-tranduced cord blood CD34+ cells from the same donor using the QIAampBlood Mini kit (Qiagen). 10 ␮g of DNA was digested overnight with SacI/EcoRI, releasing an internal proviral 3.7 kb fragment containing the complete tyrosinase coding region and a genomic 2.3 kb fragment containing tyrosinase exon 1, representing two copies of the gene. As a positive control we included 1 × 10⫺9 and 1 × 10⫺10 ␮g pcz-CFG5-Tyr-IEGZ vector digested with EcoRI/SacI. The digests were subjected to a 0.6% agarose gel electrophoresis. Denaturated DNA was blotted on to Hybond N filters and hybridized with a ␣-32P-dCTP (Amersham Pharmacia Biotech, Freiburg, Germany) random primed labbeled DNA probe complemetary to 501 bp of tyrosinase exon 1 according to a standard protocol.40 After washing with 0.5 SSC/0.1 SDS at 58°C, the filter was placed into a phospo-imager cassette. After 3 and 10 days’ exposure, quantification of absolute proviral copy number was performed by densitometric analysis of bands representing proviral DNA compared with the

Gene Therapy

genomic tyrosinase gene using the Phospho Image Scanner PhosphoImager SI (Molecular Dynamics, Amersham Pharmacia Biotech) and the ImageQuant v5.1 program. Relative proviral copy number (proviral copy number in EGFP-positive cells) was calculated by adjusting the absolute proviral copy number to the EGFP-positive cells. RNA isolation and RT-PCR Total RNA was prepared from non-transduced and transduced CD34+-derived DCs 24 days after transduction using the TriPure isolation reagent-kit (Roche, Mannheim, Germany) as recommended by the supplier. RNA also was prepared from HeLa cells transfected with the vector pcz-CFG5-Tyr-IEGZ to serve as a positive control. The reverse transcription and generation of cDNA was accomplished with the Advantage RT-for PCR-kit (Clontech, Heidelberg, Germany) according to the supplier’s instructions. The tyrosinase coded by the retrovirus was detected as a 550 bp fragment, using a primer that was complementary to sequences in exon 2 and exon 5, respectively, of the tyrosinase gene published by Brichard et al7 (oligonucleotide sequences: TyrN1: 5⬘-CACCATCAGTCTTTATGCAATGGA and TyrC1: 5⬘-AACCA GATCCGACTCGCTTGTT). The PCR was performed in a final volume of 25 ␮l (2.5 mM MgCl2, 1 × PCR buffer, 0.4 mM dGTP, dATP, dCTP, dTTP, 10 ␮M of each of the two DNA primers, 1 U Taq DNA polymerase (Amersham, Pharmacia Biotech). PCR samples were first denatured at 95°C for 5 min, followed by 35 cycles (95°C 1 min; 60°C 1 min; 72°C 2 min) and a final extension at 72°C for 5 min in a thermal cycler (UNO II, Biometra, Goettingen, Germany). Real-time PCR To analyze the expression of tyrosinase in transduced CD34+ cells and derived dendritic cells over time, total RNA from pcz-CFG5-Tyr-IEGZ-transduced cells was isolated at day 3, 8, 15 and 25 post transduction and its concentration was determined photometrically. First-strand cDNA was synthesized with the Advantage RT for PCR kit (Clontech) using 1 ␮g of total RNA (DNase-treated) and oligo dT-primers according to the supplier’s instructions. For standard calibration, the vector pcz-CFG5-TyrIEGZ was used at serial 10-fold dilutions representing 1 to 107 molecules/ml pcz-CFG5-Tyr-IEGZ in the PCR capillary (Roche). The primers RealTYR-forward (5⬘GGCTGTTTTGTACTGCCTGC) and RealTYR-reverse (5⬘GTGAAGGGAAATTGAGGCCC) were synthesized according to the published tyrosinase sequence.8 They were used to amplify a 207 bp region of tyrosinase exon 1. All real-time PCR reactions were performed in a 20 ␮l reaction mixture containing 0.1 ␮g reverse-transcribed RNA, 5 pmol of each primer and LightCycler-DNA Master SYBR Green I (Roche) in the Light Cycler Instrument (Roche). Quantification of the tyrosinase transcript, isolated at different time-points after transduction, was performed with the second derivative maximum method using an external standard curve.22 The fluorescence threshold calculation and the real-time quantitations were performed using the LightCycler Software 3 (Roche). Chromium release assay The ability of CD34+-derived DCs to present an intracellular-produced tryosinase-derived peptide after trans-


duction with pcz-CFG5-Tyr-IEGZ or with the control vector pcz-CFG5-IEGZ was analyzed in a 4-h standard 51Crrelease assay. Briefly, HLA-A∗0201-positive CD34+derived DCs were pulsed with 50 ␮g/ml of the tyrosinase-derived peptide YMDGTMSQV for 4 h at 37°C and then were extensively washed. These cells as well as the DCs, transduced with pcz-CFG5-Tyr-IEGZ, or with the control vector pcz-CFG5-IEGZ were labeled for 1 h at 37°C with 100 ␮Ci 51Cr (sodium chromate; NEN, Zaventem, Belgium). Chromium-labeled target cells were washed three times and plated in round-bottomed 96well plates at 5 × 103 cells/well. As effector cells, the cytotoxic T cell clone TyrF8 was used. It specifically recognizes the tyrosinase-derived peptide YMDGTMSQV bound to HLA-A∗0201.23 The cytotoxic T cells were added at different E:T ratios. After 4 h of incubation, 100 ␮l of supernatant was collected from each well and the released 51Cr was determined in a beta-plate counter (Wallac, Freiburg, Germany). Maximal and spontaneous release were measured by treating labeled cells with 2% Triton X-100 (FERAK, Berlin, Germany) or medium alone, respectively. The specific cytotoxicity was calculated according to the formula: percent specific lysis = 100 × [(c.p.m. experimental release ⫺ c.p.m. spontaneous release)/(cpm maximal release ⫺ c.p.m. spontaneous release)].

Acknowledgements This work was supported by a grant of the Ministry of Environment and Agriculture (Az. 56-8811.61/71), the State of Saxony, Germany, to AT and EPR. We thank S Heinicke and B Utess for excellent technical assistance. We are grateful to Dr PI Schrier, Department of Clinical Oncology, Leiden, and to Prof Dr CJ Melief, Department of Immunohematology and Blood Transfusion, Tumor Immunology Laboratory, Leiden, The Netherlands, for providing the tyrosinase specific T cell clone TyrF8.

References 1 Movassagh M et al. High level of retrovirus-mediated gene transfer into dendritic cells derived from cord blood and mobilized peripheral blood CD34+ cells. Hum Gene Ther 1999; 10: 175–187. 2 Movassagh M et al. High-level gene transfer to cord blood progenitors using gibbon ape leukemia virus pseudotype retroviral vectors and an improved clinically applicable protocol. Hum Gene Ther 1998; 9: 225–234. 3 Evans JT et al. Pre-clinical evaluation of an in vitro selection protocol for the enrichment of transduced CD34+ cell-derived human dendritic cells. Gene Therapy 2001; 8: 1427–1435. 4 Evans JT, Cravens P, Lipsky EP, Garcia JV. Differentiation and expansion of lentivirus vector-marked dendritic cells derived from human CD34+ cells. Hum Gene Ther 2000; 11: 2483–2492. 5 Benchimol S et al. Carcinoembryonic antigen, a human tumor marker, functions as an intercellular adhesion molecule. Cell 1989; 57: 327–334. 6 Chen D, Shou C. Molecular cloning of a tumor-associated antigen recognized by monoclonal antibody 3H11. Biochem Biophys Res Commun 2001; 280: 99–103. 7 Brichard V et al. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1993; 178: 489–495. 8 Bakker AB et al. Melanocyte lineage-specific antigen gp100 is recognized by melanoma-derived tumor-infiltrating lymphocytes. J Exp Med 1994; 179: 1005–1009.

9 Coulie PG et al. A new gene coding for a differentiation antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1994; 180: 35–42. 10 Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 1997; 3: 917–921. 11 Inaba K, Metlay JP, Crowley MT, Steinman RM. Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J Exp Med 1990; 172: 631–640. 12 Porgador A, Gilboa E. Bone marrow-generated dendritic cells pulsed with a class I-restricted peptide are potent inducers of cytotoxic T lymphocytes. J Exp Med 1995; 182: 255–260. 13 Schmitz M et al. Generation of survivin-specific CD8+ T effector cells by dendritic cells pulsed with protein or selected peptides. Cancer Res 2000; 60: 4845–4849. 14 Boczkowski D, Nair SK, Snyder D, Gilboa E. Dendritic cells pulsed with RNA are potent antigen-presenting cells in vitro and in vivo. J Exp Med 1996; 184: 465–472. 15 Gong J et al. Induction of antigen-specific antitumor immunity with adenovirus-transduced dendritic cells. Gene Therapy 1997; 10: 1023–1028. 16 Meyer zum Bu¨ schenfelde C et al. Generation of tumor-reactive CTL against the tumor-associated antigen HER2 using retrovirally transduced dendritic cells derived from CD34+ hematopoetic progenitor cells. J Immunol 2000; 165: 4133–4140. 17 Reeves ME et al. Retroviral transduction of human dendritic cells with a tumor-associated antigen gene. Cancer Res 1996; 56: 5672–5677. 18 Drexler I et al. Modified vaccinia virus Ankara for delivery of human tyrosinase as melanoma-associated antigen: induction of tyrosinase- and melanoma-specific human leukocyte antigen A∗0201-restricted cytotoxic T cells in vitro and in vivo. Cancer Res 1999; 59: 4955–4963. 19 Butterfield LH et al. Generation of melanoma-specific cytotoxic T lymphocytes by dendritic cells transduced with a MART-1 adenovirus. J Immunol 1998; 161: 5607–5613. 20 Zitvogel L et al. Eradication of established murine tumors using a novel cell-free vaccine: dendritic cell-derived exosomes. Nat Med 1998; 5: 594–600. 21 Gong J, Chen D, Kashiwaba M, Kufe D. Induction of antitumor activity by immunization with fusions of dendritic and carcinoma cells. Nat Med 1997; 5: 558–561. 22 Rasmussen R. Quantification on the LightCycler. In: Meurer S, Wittwer C, Nakagawara K (eds). Rapid Cycle Real-Time PCR: Methods and Application. Springer: Berlin, 2001, pp 21–34. 23 Visseren MJ et al. CTL specific for the tyrosinase autoantigen can be induced from healthy donor blood to lyse melanoma cells. J Immunol 1995; 154: 3991–3998. 24 Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GMCSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature 1992; 360: 258–261. 25 Caux C et al. CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF + TNF alpha. J Exp Med 1996; 184: 695–706. 26 Strunk D et al. Generation of human dendritic cells/Langerhans cells from circulating CD34+ hematopoietic progenitor cells. Blood 1996; 87: 1292–1302. 27 Klug CA, Cheshier S, Weissman IL. Inactivation of a GFP retrovirus occurs at multiple levels in long-term repopulating stem cells and their differentiated progeny. Blood 2000; 96: 894–901. 28 Cherry SR et al. Retroviral expression in embryonic stem cells and hematopoietic stem cells. Mol Cell Biol 2000; 20: 7419–7426. 29 Lorincz MC, Schubeler D, Groudine M. Methylation-mediated proviral silencing is associated with MeCP2 recruitment and localized histone H3 deacetylation. Mol Cell Biol 2001; 21: 7913–7922. 30 Pannell D et al. Retrovirus vector silencing is de novo methylase independent and marked by a repressive histone code. EMBO J 2000; 19: 5884–5894. 31 Lindemann C et al. Down-regulation of retroviral transgene

1559

Gene Therapy


1560 32 33 34

35

36

Gene Therapy

expression during differentiation of progenitor-derived dendritic cells. Exp Hematol 2002; 30: 150–157. Li Z et al. Murine leukemia induced by retroviral gene marking. Science 2002; 296: 497. Pawliuk R et al. Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 2001; 294: 2368–2371. Miyoshi H et al. Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors. Science 1999; 283: 682–686. Berberich-Siebelt S et al. C/EBPß enhances IL-4 but impairs IL2 and IFN-g induction in T cells. Eur J Immunol 2000; 30: 2576–2585. Dinev D et al. Extracellular signal regulated kinase 5 (ERK5) is required for the differentiation of muscle cells. EMBO Rep 2001; 9: 829–934.

37 Soneoka Y et al. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 1995; 23: 628–633. 38 DuBridge RB et al. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol 1987; 7: 379–387. 39 Lapointe R et al. Human dendritic cells require multiple activation signals for the efficient generation of tumor antigen-specific T lymphocytes. Eur J Immunol 2000; 11: 3291–3298. 40 Feinberg AP, Vogelstein B. A technique for radiolabelling DNA restriction endonuclease fragments to high specifc activity. Anal Biochem 1979; 132: 6–13.