ORIGINAL ARTICLE DOI: 10.3904/kjim.2009.24.1.48
EGFR and KRAS Mutations in Patients With Adenocarcinoma of the Lung Tae Won Jang1, Chul Ho Oak1, Hee Kyung Chang2, Soon Jung Suo3 and Mann Hong Jung1
Departments of 1Internal Medicine and 2Pathology, Kosin University College of Medicine, Busan; 3ISU ABXIS, Seoul, Korea
Background/Aims: Mutations of the epidermal growth factor receptor (EGFR) and Kirsten rat sarcoma viral oncogene (KRAS) are important in the pathogenesis of lung cancer, and recent reports have revealed racial and geographical differences in mutation expression. Methods: This study was conducted to investigate the prevalence of EGFR and KRAS mutations and their correlation with clinical variables in Korean patients with adenocarcinoma of the lung. Formalin-fixed adenocarcinoma specimens from 104 randomly selected patients diagnosed at Kosin University Gospel Hospital from October 1996 to January 2005 were used for the study. Results: We found a high prevalence of EGFR mutations and a low prevalence of KRAS mutations. EGFR mutations were present in 24% (25 of 104) of the samples: one mutation in exon 18, 13 in exon 19, one in exon 20, and 10 in exon 21. The presence of an EGFR mutation was not associated with gender, smoking history, histological grade, age, bronchioalveolar components, or cancer stage in patients with adenocarcinoma of the lung. Conclusions: Mutations of KRAS were present in 9.6% (9 of 94) of the samples: eight in codon 12 and one in codon 13. EGFR mutations were never found in tumors with KRAS mutations, suggesting a mutually exclusive relationship. (Korean J Intern Med 2009;24:48-54) Keywords: Adenocarcinoma; EGFR; KRAS; Lung cancer; Mutation
INTRODUCTION The human genome encodes approximately 518 kinases, including 90 tyrosine kinases (TK) and 43 tyrosine-like kinases [1]. Phosphorylated tyrosine serves as a binding site for several signal transducers that initiate multiple signaling pathways, resulting in cell proliferation, migration, metastasis, resistance to apoptosis, and angiogenesis [2]. Epidermal growth factor receptor (EGFR) appears to play a central role in tumorigenesis, and targeting this receptor may provide a unique approach for treating EGFR-expressing cancers [3]. This concept led to the development and regulatory approval of
small-molecule EGFR TK inhibitors (TKIs) such as gefitinib and erlotinib; however, clinical trials have revealed significant variability in the response to TKIs. Good clinical responses have been observed most frequently in women, nonsmokers, patients with adenocarcinomas, and patients of East Asian origin [4,5]. Activating mutations of EGFR have been reported in a subset of patients with pulmonary adenocarcinomas, and tumors with EGFR mutations are highly sensitive to gefitinib [6,7]. Furthermore, the incidence of EGFR mutations is higher in East Asians compared with Caucasian patients and in those with adenocarcinoma [7]. Therefore, we investigated the presence of EGFR
Received: August 8, 2008 Accepted: September 16, 2008 Correspondence to Tae Won Jang, MD, PhD Department of Internal Medicine, Kosin University College of Medicine, 34 Amnam-dong, Seo-gu, Busan 602-702, Korea Tel: 82-51-990-6637, Fax: 82-51-248-5686, E-mail:
[email protected] *This study was supported by a grant from Kosin University College of Medicine (2008).
Jang TW, et al. EGFR & KRAS mutations in adenocarcinoma of the lung 49
mutations in randomly selected Korean patients with adenocarcinoma of the lung, to determine the correlation between clinical features and the presence of Kirsten rat sarcoma viral oncogene (KRAS) mutations.
METHODS Patients Primary tumor samples from patients with adenocarcinoma of the lung were obtained from 104 randomly selected patients with lung cancer who were diagnosed at Kosin University Gospel Hospital, Busan, Korea from October 1996 to January 2005. Clinical information, including gender, age at diagnosis, and smoking history, were obtained by a retrospective review of the medical history recorded in the patients’ charts. We excluded patients with metastatic adenocarcinoma and those who were treated with gefitinib, because treatment with TKIs alters the prognosis of adenocarcinoma in East Asian patients. The stage of the disease was the postoperative pathological stage in patients who had undergone surgery and the pretreated stage for nonsurgically treated patients.
Mutational analysis (DNA sequencing) DNA was extracted from five paraffin-embedded sections of 10-µM thickness representing a portion of each tumor block, using a QIAamp DNA Mini kit (Qiagen, Hilden, Germany). EGFR exons were amplified from the DNA (100 ng) by polymerase chain reaction (PCR) in a 20-µL solution containing 2 µL of 10×buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl2, 0.3 µM of each EGFR primer pair (exon 18, F: 5’-tccaaa tgagctggcaagtg, R: 5’-tcccaaacactcagtgaaacaaa; exon 19, F: 5’atgtggcaccatctcacaattgcc, R: 5’-ccacacagcaaagcagaaactcac; exon 20, F:5’-cattcatgcgtcttcacctg, R: 5’-catatccccatggcaaactc; exon 21, F: 5’-gctcagagcctggcatgaa, R: 5’-cat cctcccctgcatgtgt), 250 µmol/L of deoxynucleotide triphosphates, and 2.5 units of DNA polymerase (Roche). Amplifications were performed using a 5-min initial denaturation at 94˚C followed by 30 cycles of 1 min at 94˚C, 1 min at 57˚C, and 1 min at 72˚C , with a final 10-min extension at 72˚C . KRAS was similarly amplified from the DNA, except that a primer pair for KRAS codons 12 and 13 was used (F: 5’ttatgtgtgacatgttctaat and R: 5’-agaatggtcctgcaccagtaa) and the amplification conditions were a 5-min initial denaturation at 94˚C ; 30 cycles of 1 min at 94˚C , and 1
min at 55˚C , 1 min at 72˚C ; and a final 10-min extension at 72˚C. All PCR products were purified from a 2% agarose gel, using a QIAgen gel extraction kit (Qiagen), and used as templates for DNA sequencing with both forward and reverse sequence-specific primers. For sequencing, each purified PCR product (20 ng) was used in a 20-µL sequencing reaction solution containing 8 µL of BigDye Terminator v3.1 (Applied Biosystems, Foster City, CA) and 0.1 µmol/L of the appropriate PCR primers. Sequencing was performed with 25 cycles of 10 s at 96˚C , 5 s at 50˚C, and 4 min at 60˚C, using an ABI PRISM 3100 DNA Analyzer (Applied Biosystems). The data were analyzed using Sequencer 3.1.1. software (Applied Biosystems), to compare the sequence variations.
Statistical analysis The statistical analyses of categorical variables were performed using Pearson’s χ2 test or Fisher’s exact test, as appropriate. The median duration for overall patient survival was calculated using the Kaplan-Meier method. Comparisons between groups were made using the logrank test. Multivariate analysis was carried out using the stepwise Cox regression model. Two-sided p values
