BIOLOGY OF REPRODUCTION 58, 769-777 (1998)
Endometrial Responsiveness to Oxytocin during Diestrus and Early Pregnancy in Pigs Is Not Controlled Solely by Changes in Oxytocin Receptor Population Density' Tenneille E. Ludwig, 3 6, Bee-Chun Sun,7 Kevin G. Carnahan, 6 Mehmet Uzumcu, 4 6, Joel V. Yelich,5s 7
Rodney D. Geisert, 7 and Mark A. Mirando 2 6, Department of Animal Sciences and Center for Reproductive Biology, 6 Washington State University, Pullman, Washington 99164-6353 Department of Animal Science,7 Oklahoma State University, Stillwater, Oklahoma 74078 ABSTRACT These studies were performed to test the hypotheses that: 1) endometrial responsiveness to oxytocin (OT) in pig endometrium is associated with changes in OT receptor (OTr) population density resulting from corresponding regulation of OTr gene transcription, 2) endometrial responsiveness to OT is controlled solely through a mechanism involving changes in OTr population density, and 3) OTr population density and endometrial responsiveness to OT differ between diestrus and early pregnancy inpigs. In experiment 1, OTr population density and dissociation constant (K) in cyclic pigs were constant on Days 10-16 but increased (p < 0.05) between Days 10 and 12 of pregnancy before decreasing (p < 0.05) through Day 16. OT induced phosphoinositide (PI) hydrolysis and prostaglandin (PG) F20 secretion in cyclic pigs only on Day 16 (p < 0.05), and during pregnancy only on Day 12 (p < 0.05). Activation of G protein by aluminum fluoride (AIF 4 ) treatment maximally stimulated (p < 0.05) PI hydrolysis and PGF 2,, secretion in cyclic pigs on all days, indicating that downstream from the OTr, the PGF20 secretory pathway was fully functional. During pregnancy, PI hydrolysis and PGF 2, secretion in response to AIF4 decreased (p < 0.01) on Days 14 compared to Days 10 and 12, and AIF4- did not stimulate PGF 2, release on Day 16. In experiment 2, abundance of OTr mRNA in cyclic pigs decreased between Days 0 and 5 before increasing between Days 5 and 12 (p < 0.05), but it was higher (p < 0.05) on Days 10-15 of pregnancy than on equivalent days in cyclic gilts. These results indicate that control of PGF 2, secretion in cyclic pigs appeared to occur primarily at the level of OTr coupling to G protein because changes in OTr number were not associated with increased sensitivity to OT or Gprotein activation by AIF4-. During pregnancy, control was exerted at multiple levels, which included the OTr, G protein, phospholipase C, and subsequent aspects of the secretory pathway. The present study also indicated that endometrium was responsive to OT during luteolysis in cyclic pigs but not during corpus luteum maintenance in pregnant pigs. INTRODUCTION Sensitivity to oxytocin (OT) in a variety of target tissues is widely regarded to be controlled through changes in OT Accepted October 25, 1997. Received August 5, 1997. 'This research was supported by USDA grant 93-37203-9070 to M.A.M. and Oklahoma State Agriculture Experiment Station Targeted Research Initiative Program awarded to R.D.G. 2 Correspondence: Mark A. Mirando, Department of Animal Sciences, P.O. Box 646353, Washington State University, Pullman, WA 991646353. FAX: (509) 335-1074; e-mail:
[email protected] 3 Current address: Department of Animal Health and Biomedical Sciences, 1655 Linden Drive, University of Wisconsin-Madison, Madison, WI 53706-1581. 4Current address: Research Center, MBC-03 King Faisal Specialist Hospital and Research Center, P.O. Box: 3354, Riyadh, 11211, Saudi Arabia. sCurrent address: Animal Science Department, University of Florida, Gainesville, FL 32611. 769
receptor (OTr) population density resulting from corresponding regulation of OTr gene transcription [1-3]. The ontogeny of endometrial expression of OTr in sheep and cattle is associated with development of uterine responsiveness to OT, resulting in OT-induced secretion of the uterine luteolysin prostaglandin (PG) F2, [4-6], which is critical for promoting corpus luteum regression in ewes [7, 8] and which leads to further follicular development, estrous behavior, ovulation, and the opportunity for mating and conception to occur. If mating and conception occur, then the initiation of endometrial OTr expression is blocked during early pregnancy [1, 9-12], sensitivity to OT is abrogated [13-15], luteolysis is prevented, and pregnancy is established. In pigs, as in other domestic ungulates, luteolysis is a uterine-dependent event [16-18]; PGF 2 is the uterine luteolysin and is released in a pulsatile pattern from the endometrium during the luteolytic period [19, 20]. Endometrial tissue from pigs also responds to OT stimulation with increased PGF2 release in vivo and in vitro [21-26]. The mechanism for OT-stimulated PGF2 secretion involves Gprotein activation of phospholipase C (PLC), resulting in the release of the intracellular second messengers, inositol 1,4,5-trisphosphate (IP 3), and potentially diacylglycerol [5, 6, 15, 22, 23, 26-30]. The ultimate downstream result of this action is production of PGF 2 , although the mechanism controlling this response in pigs has not been completely established. Endometrial sensitivity to OT is markedly reduced during early pregnancy in sheep [13, 15], cattle [12, 14], and pigs [24, 25]. In pregnant ruminants, this reduced sensitivity is controlled through inhibition of OTr expression [1, 912]. However, it is unknown whether control of endometrial sensitivity to OT in swine occurs at the level of the OTr or via a post-receptor mechanism. Therefore, the objective of these studies was to test the hypotheses that 1) endometrial responsiveness to OT in pig endometrium during Days 1016 of diestrus and early pregnancy is associated with changes in OTr population density resulting from corresponding regulation of OTr gene transcription, 2) endometrial responsiveness to OT is controlled solely through a mechanism involving changes in OTr population density, and 3) OTr population density and endometrial responsiveness to OT differ between diestrous and early pregnant pigs. This period of time was chosen because it encompasses the periods during which the luteolytic mechanism is established (i.e., Days 12-14) and luteolysis is initiated (i.e., Days 14-16) in cyclic gilts, as well as those periods of early pregnancy during which initiation of the luteolytic mechanism is blocked (i.e., Days 10-12) and the onset of luteolysis is prevented (i.e., Days 14-16).
770
LUDWIG ET AL.
MATERIALS AND METHODS Animals Crossbred gilts, 5-6 mo of age, were observed daily for standing estrous behavior in the presence of an intact boar. Onset of estrus, after the occurrence of at least one normal estrous cycle (i.e., 18-24 days), was designated Day 0, and gilts were randomly allotted to cyclic or pregnant reproductive statuses in two experiments performed independently at Washington State University (experiment 1) and Oklahoma State University (experiment 2). Gilts assigned to the pregnant group were bred either by natural service or artificial insemination at onset of estrus and at 12- to 24h intervals to ensure at least two matings. On the assigned day post-estrus, gilts were anesthetized and ovariectomizedhysterectomized as described previously [22, 23, 31]. Pregnancy was confirmed in mated gilts by flushing one uterine horn with 20 ml sterile 0.9% saline and then examining the flushing for the presence of apparently normal conceptuses. Endometrial tissue was collected from the remaining horn within 15 min of hysterectomy as described previously [22, 23, 31]. Experiment Fifty gilts were randomly allotted to 8 treatment groups (n = 5-8/group) in a 2 x 4 factorial arrangement of reproductive status (i.e., cyclic or pregnant) and day post-estrus (i.e., 10, 12, 14, or 16). On Day 10, 12, 14, or 16, a blood sample was collected from each gilt into a heparinized tube and immediately placed on ice for determination of plasma progesterone concentration as subsequently described. Gilts were then anesthetized and ovariectomized-hysterectomized, and endometrial tissue was collected as previously described. Uterine endometrium (5-10 g) was collected, frozen in liquid N 2, and stored at -80 0C for subsequent quantification of OTr characteristics. Additional endometrial tissue was placed in ice-cold Krebs-Ringer bicarbonate buffer (KRB) for subsequent determination of PGF 2. secretion and PI hydrolysis [6, 22, 23]. Experiment 2 Endometrium was obtained from 30 gilts on Days 0, 5, 10, 12, 15, and 18 of the estrous cycle and Days 10, 12, 15, and 18 of pregnancy (n = 3/reproductive status x day group). The uterine horns were placed on ice immediately after removal at hysterectomy. Strips of endometrium (5 cm) were collected, immersed in ice-cold Hanks' balanced salt solution (Sigma, St. Louis, MO) at pH 7.4, blotted on sterile surgical sponges, frozen in liquid nitrogen, and stored at -80 0 C until processed for extraction of RNA. Determination of OTr Binding Characteristics Characteristics of endometrial OTr in experiment 1 were determined by radioligand binding as previously described [6, 22, 32]. After processing and homogenization of endometrium in the presence of 1 mM EDTA to dissociate and remove bound ligand from the OTr, membrane suspensions were stored at -80°C until assayed for OTr. On the day of assay, suspensions of membrane preparations were thawed and diluted to a protein concentration [33] of 1.0 mg/ml, and 150 ,ul of each sample were quantified for OTr binding characteristics by Scatchard analysis using 0.125 to 4 pmol [ 3 H]OT (s.a. 37 Ci/mmol; New England Nuclear, Boston, MA). Nonspecific binding was estimated in the presence of
a 200-fold excess of radioinert OT Receptor-bound [3 H]OT was separated from unbound [ 3H]OT by precipitation with 2 ml 20% polyethylene glycol in 25 mM Tris-HCl, 10 mM MnC1 2, 0.01% NaN3 , and 0.1% BSA (4°C, pH 7.4) folg and 4°C; lowed by centrifugation for 20 min at 2000 and then receptor-bound [3 H]OT was quantified by liquid scintillation spectrometry. Specific binding of [ 3 H]OT was analyzed by Scatchard analysis using Ligand [34], and density of OTr was expressed as fmol/mg protein. Intra- and interassay coefficients of variation (CV) were 10.9% and 20.4%, respectively, for receptor density and 18.7% and 28.7%, respectively, for dissociation constant (Kd). Determination of PI Hydrolysis Hydrolysis of PI from endometrial explants was determined as previously described [22, 23]. Briefly, endometrial tissue from each gilt was dissected into pieces weighing 510 mg, and 100 + 5 mg of tissue was placed into each of 6 vials. Ten microcuries of [3 H]inositol (s.a. 18.8 Ci/mmol; Amersham, Arlington Heights, IL) was added to each vial, and vials were incubated at 390C for 2.67 h before initiation of treatments. Treatments of 0 nM OT (i.e., control), 100 nM OT (500 IU/mg; Sigma), and 200 ,uM aluminum fluoride (AIF 4 ; a known activator of phospholipase C-associated G protein) were added to duplicate vials for 20 min. These concentrations of OT and A1F4 - were previously shown to be the minimum concentrations that would stimulate both PI hydrolysis and PGF 2 secretion [23]. Incorporation of [ 3 H]inositol into inositol phosphates was determined as previously described [22, 23]. Determination of PGF,, 2 Release Secretion of PGF 2, from endometrial explants was determined as previously described [22, 23]. Endometrium from each gilt was cut into 200 + 5-mg pieces and placed into each of 6 incubation vials with 2 ml ice-cold KRB. Vials were incubated in a shaking water bath at 39°C under an atmosphere of 95% 02:5% CO 2 for 3 h, during which KRB was replaced with fresh KRB at 30-min intervals. Explants were treated in duplicate with 0 nM OT, 100 nM OT, and 200 ,uM AlF 4-. The KRB, collected during the final two (pre- and posttreatment) 30-min incubation periods, was stored at -20°C until RIA of PGF 2. RIA of PGF2, Concentrations of PGF 2, in 25 txl KRB were quantified using [5,3,8,9,11,12,14,15- 3H(N)]PGF 2. (s.a. 195 Ci/mmol; New England Nuclear), antiserum to PGF2 . (1:24,150 final dilution), and Lutalyse (Upjohn Co., Kalamazoo, MI) for PGF 2. standards as previously described [6, 22]. Separation of free and antibody-bound PGF 2. was achieved by incubation with 0.5% Norit A charcoal (JT Baker, Phillipsburg, NJ) (w:v) and 0.05% dextran (w:v) for 4 min at 40C. Assay sensitivity was 2.5 pg/tube. Results were expressed as total PGF because of high cross-reactivity of the antisera with PGFI, [35]. PGF values were adjusted for mass of tissue incubated. Intra- and interassay coefficients of variation were 12.5% and 11.7%, respectively. RIA of Plasma Progesterone Blood samples collected on Days 10, 12, 14, or 16 were centrifuged for 10 minutes at 1800 x g and 4C, and the plasma was stored at -20°C until RIA of plasma progesterone. Concentrations of progesterone in 25 IL1 plasma
ENDOMETRIAL RESPONSIVENESS TO OXYTOCIN IN PIGS were quantified by RIA after solvent extraction using [la,2oa,(n)- 3 H]progesterone (s.a. 48 Ci/mmol; Amersham), antiserum to progesterone (1:420 000 final dilution), and crystalline progesterone (Sigma) for standards as previously described [24]. Plasma was extracted with 2 ml benzene: hexane (1:2 v:v) with an average extraction efficiency of 98.4 + 2.2%. Separation of free and antibody-bound progesterone was achieved by incubation with 0.5% Norit A charcoal and 0.05% dextran (w:v) in 30 mM PBS (pH 7.4) containing 0.1% gelatin and 0.01% NaN 3 (w:v) for 15 min at 4°C. Assay sensitivity was 10 pg/tube, and the intra- and interassay CV were 7.2% and 17.7%, respectively. Isolation and Quantification of OTr mRNA Total RNA was isolated from 1 g endometrium by the guanidinium thiocyanate-phenol-chloroform extraction method [36]. Each sample of RNA was treated with DNase I (Gibco BRL, Grand Island, NY), and purity of RNA was determined spectrophotometrically from the ratio of absorbance at 260 nm to that at 280 nm. Total RNA was reversetranscribed to cDNA in a DNA thermal cycler (Model 480; Perkin Elmer Cetus, Norwalk, CT). Reactions were carried out in 20 Il of 200 units Moloney murine leukemia virus RT-RNase H- (M-MLV-RT; Promega Corp., Madison, WI), 1.0 tLg of oligo(dT) 15 primer (Promega Corp.), 0.5 mM each of deoxy (d)ATP, deoxycytidine triphosphate (dCTP), dGTP, deoxythymidine triphosphate (dTTP), 50 mM TrisHC1 (pH 8.3), 75 mM KCI, 3 mM MgCl 2, 10 mM dithiothreitol, 20 units RNasin (Promega Corp.), and 1.0 ,g (10 p1) total RNA. Sample preparations were incubated at 22°C for 15 min, and then at 42°C for 42 min. The reaction was terminated by heating at 95°C for 5 min and rapidly cooling to 4C. The cDNA sample was further diluted with 20 L.1 of sterile double-distilled H 2 0 and stored at 4°C. The cDNA primers for OTr were developed from porcine cDNA sequence [37]. The 5'-upstream and 3'-downstream primers for OTr were 5'GACCTTCATCATTGTGCTGGCCT3' and 5'AACACTAGGCTTGGAGCCCAT3', respectively. Primers for 3-actin and glyceraldehyde-3-phosphate dehydrogenase were prepared as previously described [38] and used to account for differences in loading of RNA and specificity of potential changes in OTr mRNA among samples, respectively. All polymerase chain reactions (PCRs) 1 were carried out in a DNA thermal cycler in 2 5 -L volumes covered with 25 til mineral oil. Optimal conditions for amplification of gene markers in the presence of pooled porcine endometrial cDNA were described previously [38]. Conditions for PCR of OTr included 1.5 mM MgC12, 200 jiM deoxynucleoside triphosphates (dNTPs), 0.3 iM primer, and 0.5 il cDNA. Samples were loaded directly from ice into a 95C-heat block to minimize the time required to reach denaturation temperature. The first cycle used denaturation at 950 C for 2 min, annealing at 650C for 1 min, and extension at 72C for 2 min, followed by 34 cycles of denaturation at 95°C for 2 min, annealing at 65C for 1 min, and extension at 720C for 1 min. Additionally, differing amounts of cDNA and/or numbers of PCR cycles were used on preliminary samples of pig endometrium to ensure that synthesis remained in the exponential phase of the PCR essential to evaluate differential gene transcription. Porcine genomic DNA was amplified with the PCR conditions as previously described [39] to determine whether the primers amplified a product of similar size for both genomic DNA and cDNA. Primers to OTr in this study yielded a genomic product that was larger than PCR products amplified from
771
endometrial cDNA, which indicated that the primers spanned an intron during amplification of genomic DNA but not during amplification of the cDNA that was reversetranscribed from endometrial RNA. Therefore, the single product generated from endometrial cDNA was not affected by genomic DNA contamination. The identity of OTr amplified product was verified by restriction enzyme digest. The PCR product yielded the expected fragments for the OTr after digestion with the restriction enzymes Pvu II (i.e., 136 and 616 basepairs [bp]) and Bst YI (i.e., 538, 153, and 61 bp). Identity of amplified products for -actin and glyceraldehyde-3-phosphate dehydrogenase were verified by restriction enzyme digest or direct sequencing, respectively, as previously described [38]. Amplified PCR products were visualized in 3% agarose gels stained with 0.5 mg/ml ethidium bromide and photographed. For each gel, amplified PCR products from a group of 10 gilts (i.e., one from each reproductive statusby-day group) were run and photographed together. Intensity and area of the amplified signals in the photographs were analyzed by scanning densitometry with a PDI-model DNA 35 scanner (PDI, Huntington Station, NY) and processed with Quantity One software (PDI). Statistical Analyses Data were subjected to least-squares ANOVA or analysis of covariance using the General Linear Models (GLM) procedure of the Personal Computer Statistical Analysis System [39]. For OTr characteristics and progesterone concentration in experiment 1, ANOVA were performed for a completely randomized design with a 2 x 4 factorial arrangement of reproductive status and day. For PI hydrolysis and PGF secretion in experiment 1, data were log-transformed to alleviate statistical problems associated with heterogeneity of variance among reproductive status x day groups. For PI hydrolysis, ANOVA was performed for a split-plot design with a 2 x 4 factorial arrangement of reproductive status and day. Gilt was nested within reproductive status x day group, and three levels of sub-plot treatment (i.e., control, OT, and AlF4 -) were cross-classified with reproductive status and day. For PGF secretion, analysis of covariance was performed for a split-plot design with a 2 x 4 factorial arrangement of reproductive status and day. Gilt was nested within reproductive status x day group, the three levels of sub-plot treatment were crossclassified with reproductive status and day, and PGF secretion during the 30-min posttreatment incubation period was the response variable. Secretion of PGF during the 30-min incubation period immediately before treatment was used as the covariate because PGF secretion is highly variable among endometrial explants within pigs. For abundance of mRNA for OTr and glyceraldehyde-3-phosphate dehydrogenase in experiment 2, analyses of covariance were performed for a completely randomized design, with abundance of j3-actin mRNA as the covariate and a 2 x 6 incomplete factorial arrangement of reproductive status and day (i.e., no pregnant gilts on Days 0 or 5). When significant 2- and 3-way interactions were detected, preplanned comparisons were performed using the PDIFF statement of the GLM procedure. All tests of hypotheses were performed using the appropriate error terms according to the expectation of the mean squares [40]. Least-squares means and the appropriate standard errors were generated from the ANOVA or analysis of covariance using the Least Squares Means statement of the GLM procedure.
772
LUDWIG ET AL. 40
I
35
0
30
ao r. 0
25
4) cv
20
Inr I
250
200
e .
r_ Cu P S 15 Q, Q
150 100
10
5
0
0
10
16
14
12
Days Post-Estrus
0
FIG. 1. Mean ( SE) concentrations of plasma progesterone during diestrus and early pregnancy in pigs in experiment 1. Concentrations of progesterone in plasma of cyclic gilts were similar on Days 10 through 14 but decreased (p < 0.05) between Days 14 and 16. Progesterone concentrations in pregnant gilts were similar on all days and were higher (p < 0.05) than in cyclic gilts only on Day 16.
5
12 10 Days Post-Estrus
15
18
FIG. 3. Mean (+ SE) abundance of mRNA for OTr in cyclic and pregnant gilts as determined from densitometric scans of ethidium bromide-stained gels following reverse transcription-PCR in experiment 2. Abundance of OTr mRNA decreased between Days 0 and 5 before increasing between Days 5 and 12 (p < 0.05). The quantity of OTr mRNA did not fluctuate significantly on Days 10-18 of pregnancy but was higher (p < 0.05) on Days 10-15 than on equivalent days in cyclic gilts.
RESULTS 0
nn
=
250
1
r
In experiment 1, concentration of progesterone in plasma (Fig. 1) was influenced by the interaction of reproductive status and day (p < 0.05). Progesterone concentrations in cyclic gilts were similar on Days 10 through 14 but decreased (p < 0.05) between Days 14 and 16. Progesterone concentrations in pregnant gilts were similar on all days and were higher (p < 0.05) than in cyclic gilts only on Day 16.
o 200 .
150
X a. 100 0 f
50
Endometrial OTr Binding Characteristics and mRNA
a-
t') v
16 14 12 0
10
0.
8 h
0
Concentration of Plasma Progesterone
6 4 2
'II 10
14 12 Days Post-Estrus
16
FIG. 2. Mean (+ SE) binding characteristics of endometrial OTr during diestrus and early pregnancy in pigs in experiment 1. In pigs, OTr population density (A) remained constant between Days 10 and 16 postestrus. In contrast, OTr density initially increased (p < 0.05) between Days 10 and 12 of pregnancy before decreasing (p < 0.01) through Day 16. OTr density in pregnant gilts tended to be higher (p < 0.07) on Day 12 and lower (p < 0.09) on Day 16 than on equivalent days in cyclic gilts. The Kd of endometrial OTr (B) did not differ between Days 10 and 12 of cyclic gilts but declined (p < 0.05) between Days 12 and 16. In pregnant gilts, OTr Kd increased (p < 0.01) from Days 10 to 12, decreased (p < 0.01) between Days 12 and 14, and then remained stable through Day 16. The Kd of OTr was also higher (p < 0.05) on Day 12 of pregnancy than on any other day of pregnancy or diestrus. Receptor Kd was similar for pregnant and cyclic gilts on Days 10, 14, and 16.
In experiment 1, OTr population density (Fig. 2A) was influenced by the interaction of reproductive status and day (p < 0.05). In endometrium of cyclic pigs, OTr density remained constant between Days 10 and 16 post-estrus. In contrast, OTr density initially increased (p < 0.05) between Days 10 and 12 of pregnancy before decreasing (p < 0.01) through Day 16 (Fig. 2A). Density of OTr in pregnant gilts tended to be higher (p < 0.07) on Day 12 and lower (p < 0.09) on Day 16 than on equivalent days in cyclic gilts. The Kd of endometrial OTr did not differ between Days 10 and 12 of cyclic gilts, but OTr Kd decreased (p < 0.05) between Days 12 and 16 (Fig. 2B). In pregnant gilts, OTr Kd increased (p < 0.01) from Days 10 to 12, decreased (p < 0.01) between Days 12 and 14, and then remained stable through Day 16. The Kd of OTr was also higher (p < 0.05) on Day 12 of pregnancy than on any other day of pregnancy or diestrus. Receptor Kd was similar for pregnant and cyclic gilts on Days 10, 14, and 16. In experiment 2, abundance of OTr mRNA (Fig. 3) was influenced by interaction of reproductive status x day (p < 0.01). In cyclic gilts, quantity of OTr mRNA decreased between Days 0 and 5 before increasing between Days 10 and 12 (p < 0.05). The quantity of OTr mRNA did not fluctuate significantly on Days 10-18 of pregnancy but was higher (p < 0.05) on Days 10-15 than on equivalent days in cyclic gilts. In contrast, abundance of mRNA for glyceraldehyde-3-phosphate dehydrogenase was not influenced
ENDOMETRIAL RESPONSIVENESS TO OXYTOCIN IN PIGS
FIG. 4. Mean ( SE) PI hydrolysis in endometrium during diestrus and early pregnancy in pigs as indicated by incorporation of [H]inositol into total IP in experiment 1. Across all days and both reproductive statuses, AIF 4 stimulated PI hydrolysis (p < 0.01). In cyclic gilts (A), AIF4 stimulated PI hydrolysis similarly on Days 10, 12, 14, and 16. Treatment with OT increased (p < 0.01) PI hydrolysis only on Day 16, and this increase was similar to that detected for AIF 4 on Day 16. Basal PI hydrolysis increased (p < 0.05) in cyclic gilts between Day 12 and Day 16. In pregnant gilts (B), AIF4 stimulated (p < 0.01) endometrial PI hydrolysis, but this effect was greater (p < 0.01) on Days 10 and 12 than on Days 14 and 16. Endometrial PI hydrolysis was increased (p < 0.05) by OT treatment only on Day 12. Basal PI hydrolysis decreased (p < 0.05) between Days 12 and 16. Both basal and OT-induced PI hydrolysis were lower (p < 0.01) for pregnant than for cyclic gilts on Day 16. OT-induced PI hydrolysis was higher (p < 0.05) in pregnant gilts on Day 12, whereas basal PI hydrolysis was similar for pregnant and cyclic gilts on Days 10, 12, and 14. Endometrial PI hydrolysis stimulated by AIF4 was similar for pregnant and cyclic gilts on Days 14 and 16.
by reproductive status, day, or the interaction of reproductive status day (data not shown). Endometrial PI Hydrolysis In experiment 1, PI hydrolysis was not influenced by main effects of reproductive status or day, but it was influenced by the effects of treatment (p < 0.01), day x treatment (p < 0.05), and reproductive status day treatment (p < 0.05). Treatment with A1F4 - stimulated (p < 0.01) PI hydrolysis across all days and both reproductive statuses, as indicated by increased incorporation of [3 H]inositol into total inositol phosphates (Fig. 4, A and B). In cyclic gilts, A1F4 - stimulated PI hydrolysis to the same levels on Days 10, 12, 14, and 16 (Fig. 4A). Treatment with OT increased (p < 0.01) PI hydrolysis only on Day 16, and this increase was similar to that detected for AF 4 - on Day 16. Basal PI hydrolysis increased (p < 0.05) in cyclic gilts between Day 12 and 16.
773
FIG. 5. Mean (+ SE) endometrial PGF secretion during diestrus and early pregnancy in pigs in experiment 1. In cyclic gilts (A), treatment with AIF4 increased (p < 0.01) endometrial PGF secretion similarly on Days 10 through 16 post-estrus. Treatment with OT increased (p < 0.05) PGF secretion only on Day 16, and the increase was similar to that caused by AIF4-. Basal levels of PGF secretion tended to decrease (p < 0.09) between Days 10 and 12, and then increased (p < 0.01) between Days 12 and 16. Basal PGF secretion was also increased on Day 16 over that on Day 10. In pregnant gilts (B), AIF4 increased (p < 0.01) PGF secretion on Days 10, 12, and 14, but not on Day 16. Increased PGF secretion in response to AIF 4- treatment tended to be lower (p = 0.06) on Day 10 than Day 12. Basal PGF did not differ between reproductive statuses on any day. Response to OT treatment was greater (p < 0.05) for pregnant than cyclic gilts on Day 12.
In pregnant gilts, AIF4 - stimulated (p < 0.01) endometrial PI hydrolysis, but this effect was greater (p < 0.01) on Days 10 and 12 than on Days 14 and 16 (Fig. 4B). Endometrial PI hydrolysis was increased (p < 0.05) by OT treatment only on Day 12. Basal PI hydrolysis decreased (p < 0.05) between Days 12 and 16. Comparison of pregnant and cyclic gilts showed that both basal and OT-induced PI hydrolysis were lower (p < 0.01) for pregnant than for cyclic gilts on Day 16. OTinduced PI hydrolysis was higher (p < 0.05) in pregnant gilts on Day 12, whereas basal PI hydrolysis was similar for pregnant and cyclic gilts on Days 10, 12, and 14. Endometrial PI hydrolysis stimulated by AIF4 - was similar for pregnant and cyclic gilts on Days 14 and 16. Endometrial PGF,, 2 Secretion In experiment 1, PGF secretion was not influenced by the main effect of reproductive status but was influenced by the effects of day (p < 0.05), treatment (p < 0.01), day x treatment (p < 0.01), and reproductive status x day x treatment (p < 0.01). Treatment with AIF 4 - increased (p
