From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only.
2004 104: 2107-2115 Prepublished online June 22, 2004; doi:10.1182/blood-2003-10-3559
Function and survival of dendritic cells depend on endothelin-1 and endothelin receptor autocrine loops Georgi Guruli, Beth R. Pflug, Stefana Pecher, Valeria Makarenkova, Michael R. Shurin and Joel B. Nelson
Updated information and services can be found at: http://bloodjournal.hematologylibrary.org/content/104/7/2107.full.html Articles on similar topics can be found in the following Blood collections Hemostasis, Thrombosis, and Vascular Biology (2497 articles) Immunobiology (5022 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. IMMUNOBIOLOGY
Function and survival of dendritic cells depend on endothelin-1 and endothelin receptor autocrine loops Georgi Guruli, Beth R. Pflug, Stefana Pecher, Valeria Makarenkova, Michael R. Shurin, and Joel B. Nelson
The biologic effects of endothelin-1 (ET-1) are not limited to its potent vasoconstricting activity. The endothelin receptors, ETA and ETB, have differential tissue and functional distributions. Here we showed that dendritic cells (DCs), the major antigenpresenting cells in the adaptive limb of the immune system, produce large amounts of ET-1 and significantly increase the expression of endothelin re-
ceptors upon maturation. Selective blockade of the ETA receptor significantly reduced expression of the mature DC marker CD83, decreased the production of the immunostimulatory cytokine interleukin-12, down-regulated DC ability to stimulate T cells, and promoted DC apoptosis. Selective ETB receptor blockade, on the other hand, resulted in increased expression of CD83 and improved DC
survival. Therefore, ET-1/ETA/ETB autocrine/paracrine loops on DCs appear to be essential for the normal maturation and function of human DCs, presenting a unique target for immunomodulatory therapies. (Blood. 2004;104:2107-2115)
© 2004 by The American Society of Hematology
Introduction Endothelin-1 (ET-1), the most potent vasoconstrictor known, was first described in 1988.1 The endothelin family also includes endothelin-2, endothelin-3, and the sarafotoxins. The endothelins are widely distributed in tissues, produced by endothelial cells and many epithelial cell types.2-5 Under normal conditions, ET-1 apparently maintains vascular tone and exerts its action in a variety of tissues and organs.4-9 Recently, through other investigations of endothelin’s pleiotropic actions, ET-1 has emerged as an important peptide in a host of biologic functions, including development, cellular proliferation, apoptosis, and cancer.10-12 Endothelin-1 sequence is highly conservative among all mammalian species and most high vertebrates, emphasizing its central role in fundamental biologic processes. There are 2 endothelin receptors, endothelin receptor A (ETA) and endothelin receptor B (ETB), that have been identified in different mammalian tissues. They are 63% identical in amino acid sequence, but are encoded by distinct genes located in the chromosomes 4 (ETA) and 13 (ETB).13-15 Endothelin receptors are distributed in a variety of cells and tissues in different proportions, suggesting potentially opposite regulatory functions. Endothelin receptor expression is up-regulated by ischemia,16 cyclosporin,17 and interleukin-1 (IL-1).18 Production of endothelin or endothelin receptor knock-out mice allowed the evaluation of the role and biologic significance of different members of the endothelin family. ET-1 or ETA receptor– deficient mice had abnormalities of craniofacial tissue derived from the first pharyngeal arch. Changes were incompatible with life, and mice died of respiratory failure at birth.19 On the other hand, it appears that the ETB receptor is essential in the development of neural crest–derived cell lineages, and its deficiency produces pigmentary disorders and aganglionic megacolon, resembling human Hirschsprung disease.20-22 Because of obvious ET-1 involve-
ment in the vasoconstriction, a number of endothelin receptor antagonists have been developed to block ET-1 interaction with its receptors, both to study the specific results of ET-1 actions and for possible therapeutic use.12,23-25 One fundamental biologic process to which ET-1 has not yet been definitely linked is the development of immune responses and particularly an immune function mediated by the most effective antigen-presenting cells, dendritic cells (DCs). First described in 1973,26 these cells present as immature DCs in nonlymphoid tissue with the capacity to recognize, take up, and process antigen. After acquiring antigen, they migrate to lymph nodes and, as mature DCs, present the antigen to T cells, stimulating their proliferation and differentiation. Thus, as antigen-presenting cells, DCs play a crucial role in the development of specific immune responses,27-29 and DC stimulation or suppression can effectively alter immune reactions. ET-1 is produced by many cell types, including macrophages,30 another type of antigen-presenting cell. ET-1 affects macrophage function, promoting tumor necrosis factor ␣ (TNF-␣) production through its action on the ETA receptor,31 thus demonstrating proinflammatory function. However, there are currently no data on the relationship between ET-1 and DCs. Since ET-1 has almost ubiquitous presence in both lymphoid and nonlymphoid tissues, it is reasonable to hypothesize that it may affect DC function. The aim of this study was to examine if the endothelin axis (including ET-1 and both endothelin receptors) influences DC function, and through them, the immune response. We have demonstrated that DCs produce large amounts of ET-1 upon maturation, with concomitant up-regulation of both endothelin receptors. Functional studies showed that the modification of the endothelin axis has a profound effect on the development, function, and survival of
From the Departments of Urology, Pathology, and Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA.
Reprints: Georgi Guruli, UMDNJ-NJMS, Division of Urology, 185 S Orange Ave, MSB G-528, Newark, NJ 07103-2757; e-mail:
[email protected].
Submitted October 20, 2003; accepted May 7, 2004. Prepublished online as Blood First Edition Paper, June 22, 2004; DOI 10.1182/blood-2003-10-3559. Supported in part by the American Foundation for Urologic Disease and American Urological Association Research Scholar Program (G.G.). J.B.N. is a scientific consultant and investigator for Abbott Laboratories.
BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734. © 2004 by The American Society of Hematology
2107
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. 2108
BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
GURULI et al
mature DCs. To the best of our knowledge, this is the first demonstration that DCs produce ET-1, as well as express ET receptors, and that the endothelin axis can modify DC function, with a subsequent effect on immune response.
Materials and methods Cells DCs were generated from CD14⫹ monocytes obtained from human peripheral blood of healthy volunteers, as described earlier.32 After gradient separation on HistoPrep medium (1.077 g/mL; Sigma, St Louis, MO), adherent cells were isolated from peripheral blood mononuclear cells on plastic (37°C, one hour) and cultured in 6-well plates in complete medium, supplemented with 1000 U/mL recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) and 1000 U/mL rhIL-4 (Cito G&M, Wexford, PA). Nonadherent DCs were harvested 7 to 8 days later and examined by flow cytometry. Cultured cells were CD14⫺, CD3⫺, CD20⫺, HLA-DR⫹, CD80⫹ CD86⫹ CD40⫹ and CD1a⫹, and CD83⫹, suggesting a common phenotype of monocyte-derived DCs. DC maturation was induced either by TNF-␣33-35 (50 ng/mL; Cito G&M) or inactivated Staphylococcus aureus (S aureus, 5 L/mL; Sigma) for 48 hours.36,37 ET-1 (American Peptide, Sunnyvale, CA), ETA receptor antagonists ABT-627 (Abbott Labs, Chicago, IL) and BQ-123 (American Peptide), and ETB receptor antagonist A-192621 (Abbott Labs) were added to DCs at a final concentration of 10⫺7 M during the last 48 hours of culture. ET-1 ELISA The ET-1 enzyme-linked immunosorbent assay (ELISA) system (BIOTRAK; Amersham Biosciences, Piscataway, NJ) was used for determination of ET-1 concentrations in cell-free supernatants. In every assay, samples and standards were run in duplicates and read at 450-nm wavelength on a Benchmark microplate reader (Bio-Rad Labs, Hercules, CA). ET-1 concentrations were normalized based on cell counts and determined by computer software–generated interpolation from the standard curve.
5 M) of nonradioactive ET-1, ABT-627 and A-192621, and a fixed concentration (100 pM) of 125I–ET-1. Incubation was carried out for 2 hours on ice. Next, membrane suspensions were pipetted onto 25-mm diameter glass microfiber filters (GM/C filters; Whatman, Kent, United Kingdom) under the vacuum suction, and filters were washed with 10 mL cold (4°C) Hanks buffered saline solution. Filters were placed in the 5-mL vials, and the radioactivity was determined on Wallac 1470 gamma counter (PerkinElmer Life Sciences, Turku, Finland). Obtained results (in cpm) were converted to femtomole per milligram of protein using web-based radioactivity calculator software from GraphPad (San Diego, CA). Reverse transcriptase–polymerase chain reaction (RT-PCR) Cells were lysed using RNA-Bee (1 mL per 5 ⫻ 106 cells), and the total RNA was extracted as per the manufacturer’s (Tel-Test, Friendswood, TX) recommendations. The amount of RNA was determined by a spectrophotometric reading at 260 nm. Synthesis of cDNA from 3 g total RNA was carried out using Superscript Preamplification System (GIBCO BRL, Grand Island, NY) with oligo(dT) primers. Amplification of cDNA was performed with 35 cycles of PCR in a 50-L mixture with Taq DNA Polymerase (GeneChoice, Frederick, MD) and primers at a final concentration of 0.2 M. To confirm the quality of cDNA for PCR in every case, human -actin was coamplified using -actin cDNA primers (5⬘CCCAGGCACCAGGGCGTGAT and 5⬘-TCAAACATGATCTGGGTCAT, 262-bp product). For endothelin receptors, the following primers were used: forward, 5⬘-CACTGGTTGGATGTGTAATC and reverse, 5⬘GGAGATCAATGACCACATAG, for human ETA receptor (366-bp PCR product); forward, 5⬘-TCAACACGGTTGTGTCCTGC and reverse, 5⬘ACTGAATAGCCACCAATCTT, for human ETB receptor (530-bp PCR product).38 Each reaction cycle consisted of 1 minute at 93°C (denaturation), 1 minute at 56°C (annealing), and 2 minutes at 72°C (extension). Products of PCR were electrophoresed on 1.2% agarose gel and stained with ethidium bromide (Bio-Rad Labs) for visualization on Molecular Imager FX (Bio-Rad Labs). Obtained PCR products were sequenced using ABI model 3100 Automated DNA Sequencers by the University of Pittsburgh sequencing facility to confirm the specificity. Gene microarray
Immunohistochemistry DCs were harvested and placed on microscope slides using a Cytospin centrifuge (Shandon Lipshaw, Pittsburgh, PA). Samples were air-dried overnight and fixed in ice-cold acetone. Slides were washed in phosphatebuffered saline (PBS) and incubated for one hour at room temperature with the ETA or ETB antibodies (Abbott Labs) at a dilution of 1:250. Further staining with secondary antibodies and development was performed using Vectastatin ABC system (Vector Labs, Burlingame, CA), following the manufacturer’s recommendations. Negative controls included staining with irrelevant isotype-matched antibodies. Semiquantitative assessment of slides was performed by 2 authors (G.G. and M.R.S.) independently to evaluate the intensity of staining. Radioreceptor assay DCs were grown in 6-well plates and collected on day 7. Cells were centrifuged at 200g for 7 minutes. Pellets were resuspended in 20 mL “cold” buffer (50 mM Tris [tris(hydroxymethyl)aminomethane]–HCl, 1 g/mL pepstatin, and 1 g/mL leupeptin; pH 7.7 at 4°C) and homogenized. Resulting suspensions were centrifuged at 60 000g for 30 minutes at 4°C. Pellets were resuspended in “warm” buffer (50 mM Tris-HCl, 1 g/mL pepstatin, 1 g/mL leupeptin; pH 7.7 at 37°C), kept at 37°C for 40 minutes, and then centrifuged at 60 000g for 30 minutes at 20°C. Pellets were kept at ⫺80°C until used. To define the dissociation constant (Kd) and the binding maximum (Bmax), duplicate aliquots (2 ⫻ 125 L) of membrane suspensions were incubated with increasing concentrations (0.98 to 500 nM) of nonradioactive ET-1, and corresponding 125I–ET-1 (2000 Ci/mmol [74 Tbq/mmol]; Amersham Biosciences) was added with increasing concentrations (3.9 to 2000 pM) as well. For the competitive binding studies, membrane suspensions were incubated with increasing concentrations (0 to
For gene array analyses, DCs were obtained from 2 healthy volunteers and divided into 4 groups: unstimulated DCs, DCs stimulated with S aureus during the last 48 hours of culture, and DCs stimulated with S aureus and treated either with ABT-627 or A-192621 (ETA and ETB receptor antagonists, respectively) for the last 48 hours of culture. DCs were collected and snap frozen. Affymetrix chip analysis (Santa Clara, CA) was performed as described earlier.39 Briefly, total RNA was extracted from DCs using Trizol and Qiagen RNeasy kit (Qiagen, Valencia, CA), following the manufacturer’s recommendations. Total RNA (approximately 8 g) was used for the synthesis of first-strand cDNA with Gibco BRL Superscript II system and T7-(dT)24 primer (5⬘-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGC-(dT)24-3⬘). The second-strand cDNA synthesis was carried out at 16°C by adding Escherichia coli (E coli) DNA ligase, E coli DNA polymerase I, and RnaseH in the reaction. The cDNA was purified through phenol/chloroform and ethanol precipitation. Double-stranded DNA was then converted into cRNA using in vitro transcription (IVT) and biotinylated nucleotides with the MEGAscript system (Ambion, Austin, TX) according to the manufacturer’s recommendations. The IVT product was cleaned using Qiagen RNeasy columns, and 15 g cRNA was fragmented at 95°C for 35 minutes. The fragmented cRNA was hybridized with pre-equilibrated Affymetrix chips at 45°C for 14 to 16 hours (human genome U133A set was used, containing more than 22 000 genes and expression sequence tags). The hybridizations were then washed and stained with streptavidin-phycoerythrin (SAPE) according to the manufacturer’s (Affymetrix) recommendation. The hybridized gene chips were scanned using Agilent ChipScanner (Affymetrix) to detect hybridization signals. For analysis, hybridization data from text files were imported to a Microsoft Excel spreadsheet (Seattle, WA). To determine gene products with a significant increase of expression, we analyzed all data sets for at
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
DENDRITIC CELLS AND ENDOTHELIN AXIS
2109
least 3-fold increase in signal intensity. Obtained data were normalized using the ratio of signal intensity derived from GAPDH (glyceraldehydes-3phosphate dehydrogenase) in comparing sets. The level of significance was set at a probability of .05. Mixed leukocyte reaction Allogeneic CD3⫹ T cells were generated using human T-cell enrichment columns (R&D Systems, Minneapolis, MN). Isolated T cells were placed in the round-bottom 96-well plates, 3 ⫻ 105 cells per well. DCs were stimulated either with TNF-␣ or S aureus, and treated with either ET-1, ABT-627, A-192621, or BQ-123 for 48 hours. DCs were then washed, resuspended in complete medium, counted using trypan blue, and added to T cells at different ratios in triplicates. The starting number of live (trypan blue negative) DCs was the same in each group. After 72 hours of incubation at 37°C, radioactive thymidine (3H-TdR; New England Nuclear, Boston, MA) was added to the DC/T-cell mixture, 1 Ci (0.037 MBq) per well. T-cell proliferation was measured by the 3H-TdR incorporation in 16 hours. Cells were harvested onto GF/C glass fiber filter paper with a semiautomated microharvester, and 3H-TdR incorporation was determined by liquid scintillation spectroscopy and expressed as cpm. IL-12 ELISA DuoSet ELISA development kit calibrated for human IL-12 p70 (R&D Systems) was used to determine IL-12 concentration in DC supernatants, according to the manufacturer’s recommendations. DCs were counted using trypan blue before the experiment and supernatants were collected. Samples and standards were run as duplicates in every assay, and were read at 450 nm wavelength in reference to 540 nm. IL-12 concentrations were determined by computer software–generated interpolation from the standard curve and normalized based on cell counts (per million live cells). Assessment of apoptosis Annexin V assay. DCs were collected and double stained with fluorescein isothiocyanate–conjugated Annexin V (PharMingen, San Diego, CA) and propidium iodide (Sigma). Annexin V was added according to the manufacturer’s recommendations. Propidium iodide was used at a final concentration of 10 g/mL. Samples were analyzed by the FACScan flow cytometer with LYSYS II software package (Becton Dickinson, San Jose, CA). Cell death ELISA. DCs were collected on day 8, after the 48-hour treatment with dexamethasone (10⫺6 M) and with or without ET receptor inhibitors, and counted. Samples (30 000 cells) were assayed for death using an ELISA kit according to the manufacturer’s specifications (Roche Diagnostics, Indianapolis, IN). This kit uses monoclonal antibodies directed against DNA and histones in a quantitative sandwich-enzyme–based format. The amount of histone-associated DNA fragments in the cell lysates was determined by a spectrophotometric reading at 405-nm wavelength. Untreated cells were used as controls. Statistical analysis For a single comparison of 2 groups the Student t test was used (SigmaStat Statistical Software; SPSS, Chicago, IL). If data distribution was not normal, Mann-Whitney rank sum test was used. For all analysis, the level of significance was set at a probability of .05 to be considered significant. Data are presented as the mean ⫾ standard error of the mean (SEM). All experiments were repeated at least 3 times.
Results ET-1 production by human DCs
In the immature state, DCs secreted little or no ET-1, as was determined by ELISA (Figure 1). Following the stimulation with either TNF-␣ or S aureus for 48 hours, ET-1 production by DCs
Figure 1. Human DCs produce ET-1 peptide upon maturation. ET-1 production by immature human DCs, DCs stimulated with TNF-␣ (DC ⫹ TNF-␣), and DCs stimulated with S aureus (DC ⫹ SA). ET-1 concentration was measured in DC supernatants using ET-1 ELISA. Stimulated DCs produced statistically significantly higher ET-1 (P ⬍ .01) in comparison with unstimulated DCs.
increased significantly (Figure 1). ET-1 concentration in the culture medium from immature DCs was 15.3 ⫾ 6.3 pg/mL per 106 cells, whereas TNF-␣–induced DC maturation resulted in a 10-fold increase in ET-1 levels in culture supernatants (170.5 ⫾ 36.9 pg/mL per 106 cells, P ⫽ .004). Similarly, ET-1 concentrations increased 36-fold (559.9 ⫾ 172.3 pg/mL per 106 cells, P ⫽ .006) when DCs were stimulated with S aureus. Expression of endothelin receptors on human DCs
On unstimulated DCs, expression of the endothelin receptors ETA and ETB was also low, whereas stimulated DCs displayed a large increase in ETA and ETB expression (Figure 2) as was assessed by immunostaining using specific ETA and ETB receptor antibodies. We performed semiquantitative evaluation of the slides. The staining of unstimulated DCs was graded as ⫹/⫹ with both ETA and ETB staining, whereas the staining of stimulated DCs was graded as ⫹⫹⫹/⫹⫹⫹ for ETA receptors and ⫹⫹/⫹⫹⫹ for ETB receptors. These findings were confirmed by radioreceptor assay using 125I–ET-1 (Figure 3). During saturation studies, receptor density on mature DCs was more than 2.5-fold higher than on immature DCs: Bmax was 760.3 ⫾ 162.6 fmol/mg protein versus 285.8 ⫾ 86.5 fmol/mg protein, respectively (P ⫽ .02), whereas binding affinity was the same on mature and immature DCs (Kd was 1.81 ⫾ 0.6 nM versus 1.78 ⫾ 0.9 nM, respectively). Competitive binding assays with ABT-627, a highly selective ETA receptor antagonist, and A-192621, a highly selective ETB receptor antagonist, were carried out to determine relative density of each receptor. Total binding was 25.29 ⫾ 1.17 fmol/mg protein in the presence of 0.1 nM 125I–ET-1 alone. ETA receptor density was calculated in the presence of 10⫺6 M A-192621 (16.78 ⫾ 0.81 fmol/mg protein), and ETB receptor density was assessed in the presence of 10⫺6 M ABT-627 (9.75 ⫾ 1.82 fmol/mg protein). Obtained results suggested approximately a 2:1 ratio of ETA to ETB receptors on mature DCs. Expression of messenger RNA for ETA and ETB receptors was confirmed as well in both mature and immature DCs by sequence analysis of RT-PCR amplified cDNA products against the published sequences for those receptor subtypes. Furthermore, the results of gene arrays also confirmed up-regulation of mRNA for ET-1, ETA, and ETB receptors (Table 1) in mature DCs, in comparison with immature cells. Effect of endothelin axis on DC maturation
Endothelin receptor inhibitors have been used to determine if there was a functional significance in the up-regulation of ET-1 production and endothelin receptor expression on mature DCs. Selective blockade of the ETA receptor with either ABT-627 or BQ-123, ETA receptor antagonists, administered together with the DC maturation
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. 2110
BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
GURULI et al
Table 1. Gene expression changes in DCs after activation with Staphylococcus aureus Gene description
Fold change expression
Increased expression Endothelin-1
12.55
ETA receptor
6.24
ETB receptor
10.50
Endothelin-converting enzyme 1 (ECE 1)
4.36
Decreased expression
Figure 2. Human DCs express endothelin receptors upon maturation. Immunohistochemical expression of ETA and ETB receptors by immature human dendritic cells (DC), and by DCs stimulated with S aureus (DC ⫹ SA). DCs were collected on the seventh day of the culture, either immature or after 48-hour stimulation, and cytospun to the slides. Immunostaining was performed using antibodies against ETA and ETB receptors and the Vectastatin ABC system. Negative controls included staining with irrelevant isotype-matched antibodies. The results from a representative experiment (of 3) are shown. (A) Immature DCs stained with anti–ETA receptor antibodies. (B) Mature DCs (DC ⫹ SA) stained with anti–ETA receptor antibodies. (C) Immature DCs stained with anti–ETB receptor antibodies. (D) Mature DCs (DC ⫹ SA) stained with anti–ETB receptor antibodies. (E) Negative control: immature DCs stained with isotype-matched irrelevant antibodies. (F) Negative control: mature DCs (DC ⫹ SA) stained with isotype-matched irrelevant antibodies. Color was developed with a DAB reagent kit (Biogenex, San Ramon, CA) and slides were counterstained. Microscopy was performed using a Zeiss Axioplan 2 microscope (Carl Zeiss Microimaging, Thornwood, NY) equipped with a digital camera and a 20 ⫻/0.5 objective (A-D) or a 10 ⫻/0.5 objective (E,F). Images were acquired using AxioVision KS300 software (Carl Zeiss Microimaging).
Endothelin-2
4.76
Endothelin-3
3.84
48.18 ⫾ 3.32, P ⫽ .014) on DCs. The expression of other DC markers (CD40, CD80, CD1a, CD86, and HLA-DR) was not significantly affected by ET receptor antagonists, though changes were noticeable in some cases (Table 2). Interestingly, the blockade of both ETA and ETB receptors on stimulated DCs resulted in a statistically significant drop in the CD83 expression (23.99 ⫾ 2.57%, P ⬍ .05) in comparison with mature DCs. It seems that in normal conditions, ET-1–ETA receptor interaction is the more prominent part of the endothelin axis. The addition of exogenous ET-1 at high concentrations (10⫺7 M) to cultures of immature or mature DCs had no significant effect on the expression of CD83. The administration of ET receptor antagonists (ABT-627, A-192621, BQ-123) to immature DCs without the addition of stimulation factors did not change CD83 expression on DCs. These data indicate that endogenous ET-1 production by DCs might adequately stimulate the expression of CD83 on DCs. Regulation of DC ability to activate T cells by ET receptor antagonists
The functional consequence of DC maturation is commonly measured by their ability to stimulate T-cell proliferation in a mixed leukocyte reaction (MLR) assay.29 In MLRs (Figure 5A), as expected, mature DCs induced a significantly higher level of T-cell
stimuli (TNF-␣ or S aureus) significantly reduced the expression of CD83 on DCs (from 34.71 ⫾ 3.17 to 19.16 ⫾ 1.13, P ⬍ .001) (Figure 4). However, blocking of ETB receptors with A-192621 induced an increase in CD83 expression (from 34.71 ⫾ 3.17 to
Figure 3. Saturation curve demonstrates the binding of endothelin-1 to DCs. DC cell membranes were made from immature and mature DCs, and the saturation binding studies were performed with 8 different concentrations of 125I–ET-1 (3.9 to 2000 pM). Representative saturation plots from 3 independent experiments are shown for immature and mature DCs (Bmax: 285.8 ⫾ 86.5 fmol/mg protein and 760.3 ⫾ 162.6 fmol/mg protein, respectively; Kd: 1.78 ⫾ 0.9 nM and 1.81 ⫾ 0.6 nM, respectively). Dashed and solid lines represent saturation curves for unstimulated and stimulated DCs, respectively.
Figure 4. CD83 expression on DCs treated with endothelin receptor antagonists. Results of flow cytometry analysis of DCs stained with CD83 antibodies. Representative histograms are shown from 5 independent experiments. DCs indicates immature DCs; DC ⫹ SA, mature DCs; DC ⫹ SA ⫹ ABT-627, mature DCs treated with ETA receptor antagonist ABT-627 for 48 hours, leading to a significant lowering of CD83 expression in comparison with mature DCs (P ⬍ .001); and DC ⫹ SA ⫹ A-192621, mature DCs treated with ETB receptor antagonist A-192621 for 48 hours, displaying a significant increase in CD83 expression in comparison with mature DCs (P ⫽ .014). Isotype control (black line) was anti-immunoglobulin G–conjugated to phycoerythrin. Cells stained with CD83 are indicated by gray lines. Numbers on the horizontal bar indicate the percentage of cells positive for CD83.
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
DENDRITIC CELLS AND ENDOTHELIN AXIS
2111
Table 2. Modulation of DC phenotype by the endothelin receptor antagonists Human DCs, %
hDCs ⴙ SA, %
hDCs ⴙ SA ⴙ ABT-627, %
CD1a
39.19 ⫾ 11.56
33.68 ⫾ 12.30
37.40 ⫾ 8.17
hDCs ⴙ SA ⴙ A-192621, % 24.36 ⫾ 16.48
CD40
72.24 ⫾ 4.75
87.25 ⫾ 3.41*
79.35 ⫾ 5.49
92.04 ⫾ 3.37
CD80
34.29 ⫾ 2.4
51.12 ⫾ 1.69*
45.50 ⫾ 5.44
54.85 ⫾ 2.44
CD83
15.82 ⫾ 0.52
34.71 ⫾ 3.17*
19.16 ⫾ 1.31*
48.18 ⫾ 3.32*
CD86
69.09 ⫾ 4.15
88.21 ⫾ 1.86*
78.46 ⫾ 5.35
91.52 ⫾ 2.21
HLA-DR
91.21 ⫾ 0.77
96.15 ⫾ 0.98*
92.65 ⫾ 2.29
96.23 ⫾ 1.09
DCs indicates dendritic cells; hDCs, human dendritic cells; SA, staphylococcus aureus; ABT-627, endothelin receptor A antagonist; and A-192621, endothelin receptor B antagonist. Data are presented as means ⫾ SEM. *Statistically significant difference. In the case of CD40, between human DCs and hDCs ⫹ SA (P ⫽ .012); CD80, between human DCs and hDCs ⫹ SA (P ⫽ .015); CD83, between human DCs and hDCs ⫹ SA (P ⫽ .003), between hDCs ⫹ SA and hDCs ⫹ SA ⫹ ABT-627 (P ⬍ .001), and between hDCs ⫹ SA and hDCs ⫹ SA ⫹ A-192621 (P ⫽ .014); CD86, between human DCs and hDCs ⫹ SA (P ⬍ .001); and HLA-DR, between human DCs and hDCs ⫹ SA (P ⫽ .004).
proliferation compared with immature DCs. ETA receptor blockade on mature DCs with either ABT-627 or BQ-123 resulted in a statistically significant reduction of their ability to induce T-cell proliferation (P ⬍ .05 at DC–T-cell ratios ranging from 1:2187 to 1:9), whereas ETB receptor blockade on DCs with A-192621 had no effect on antigen-presenting capacity of DCs. The addition of exogenous ET-1 to mature DCs had no significant effect on MLR results, since mature DCs produce high levels of ET-1 by them-
selves (Figure 1). Similarly, ET-1 or endothelin receptor antagonists did not change antigen-presenting activity of immature DCs. Effect of ET-1 on IL-12 production by DCs
Production of the IL-12 by DCs has an important regulatory function on the host immune response, particularly by regulating T helper 1 (Th1)/Th2 balance. Treatment of mature DCs with ETA receptor antagonist ABT-627 significantly reduced S aureus– induced IL-12 production from 584.8 ⫾ 152.2 pmol/mL per 106 cells to 179.8 ⫾ 77.4 pmol/mL per 106 cells (P ⬍ .05) (Figure 5B). However, neither exogenous ET-1 nor ETB receptor antagonist A-192621 had any significant effect on the induction of IL-12 secretion by mature DCs. Modulation of DC survival by endothelin axis
In many cell types, ET-1 is both a mitogenic and an antiapoptotic factor primarily binding to the ETA receptor. Using either dexamethasone (10⫺6 M) or serum starvation to induce apoptosis in DCs, we have shown that blockade of ETA receptors by ABT-627 or BQ-123 resulted in increased levels of DC apoptosis, as measured by both Annexin V binding (P ⬍ .05) and the cell death ELISA assay (P ⫽ .002) (Figure 6A and 6B, respectively). Interestingly, blockade of ETB receptors on DCs with A-192621 led to an increased resistance of DCs to the dexamethasone-induced apoptosis, assessed by Annexin V binding assay (P ⫽ .002) and cell death ELISA (P ⬍ .001). Regulation of gene expression in DCs by endothelin axis
Figure 5. Endothelin-1 influence of DC function. (A) ETA receptor blockade decreases the ability of mature DCs to stimulate T-cell proliferation in mixed leukocyte reaction (MLR). DCs were matured with S aureus treatment (DC ⫹ SA) for 48 hours. Mature DCs were treated either with ETA receptor antagonist (DC ⫹ SA ⫹ ABT-627) or with ETB receptor antagonist (DC ⫹ SA ⫹ A-192621). Different DCs were used in MLR to stimulate T-cell proliferation at different DC/T-cell ratios, and T-cell proliferation was assessed on the beta-counter by radioactive thymidine (3H-TdR) uptake. Results of 1 representative experiment of 5 are presented as mean ⫾ SEM. (B) IL-12 production by DCs. Stimulation of DCs with S aureus (DC ⫹ SA) resulted in increased production of IL-12, as expected. Blockade of ETA receptor on mature DCs (DC ⫹ SA ⫹ ABT-627) led to statistically significant drop in IL-12 production. Blockade of ETB receptors (DC ⫹ SA ⫹ A-192621) had no significant effect on IL-12 production. *Statistically significant difference (P ⬍ .05) in IL-12 production between mature DCs and mature DCs with the ETA receptor blockade.
We have analyzed gene expression in DCs using human genome U133A set from Affymetrix. Comparison of gene expression was first made between immature DCs and mature DCs stimulated with S aureus. Next, we analyzed changes in gene expression in mature DCs after blocking ETA or ETB receptors with selective antagonists ABT-627 and A-192621, respectively. Signal intensity is the GeneChip (Affymetrix) parameter indicating the level of gene expression. Fold change of the same gene was obtained by comparing signal intensity between different sets of the DCs from the same individual. The results of these studies are presented in Tables 1, 3, and 4. As shown, blocking of ETA receptors on DCs led to the increased expression of many proapoptotic genes, including genes for several caspases. In addition, down-regulation of the genes involved in the generation of type I immune response (interferon, IL-12, major histocompatibility complex [MHC] class II molecules) was also seen after ETA receptor blockade on DCs. In contrast, ETB receptor blockade on DCs was associated with the down-regulation of proapoptotic genes, for instance, serinethreonine kinase 17␣, bcl2-like protein 11, and others. Thus, the analysis of gene expression on DCs confirmed our data demonstrating the
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. 2112
BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
GURULI et al
Figure 6. Assessment of endothelin axis influence on DC death. (A) Cell death assessment with Annexin V assay. Mature DCs (DC ⫹ SA) were treated either with ABT-627, ETA receptor antagonist, or A-192621, ETB receptor antagonist, and apoptosis was induced by dexamethasone (Dex, 10⫺6 M) treatment for 48 hours. Untreated mature DCs served as a control. After 48 hours of treatment, DCs were collected, stained with Annexin V, and flow cytometry was performed for annexin-positive (early and late apoptotic) cells. Representative histograms from 1 of 3 experiments with similar results are shown. Isotype control (black lines) was anti-immunoglobulin G conjugated to fluorescein isothiocyanate. Gray lines indicate cells stained with annexin V. Numbers on horizontal bars indicate the percentage of annexin-positive cells. (B) DC death assessment with ELISA assay. Mature DCs (DC ⫹ SA) were treated either with ABT-627, ETA receptor antagonist, or A-192621, ETB receptor antagonist, and apoptosis was induced by dexamethasone (Dex, 10⫺6 M) treatment for 48 hours. Untreated mature DCs provided control. After 48 hours of treatment, DCs were collected and the amount of cell death was determined using cell death ELISA kit (Roche Diagnostics) by assessing the amount of histone-associated DNA fragments (mononucleosomes and oligonucleosomes) in the cell lysates by a spectrophotometric reading at 405 nm wavelength. Combined data of 3 independent experiments are presented. *Statistically significant difference (P ⬍ .05) compared with mature DCs treated with dexamethasone only.
up-regulation of ET-1 and endothelin receptors on DCs during maturation, and the influence of endothelin axis on the function and survival of mature DCs.
Discussion After being discovered as a potent vasoconstrictor, ET-1 was later demonstrated to possess a wide range of pleiotropic functions as well.11,12,25,40 This includes the regulation of basic cell functions such as cell survival, proliferation, and matrix remodeling. Endothelin-1 action Table 3. Gene expression changes in mature DCs after treatment with ABT-627, an endothelin A receptor antagonist Gene description
Fold change expression
Increased expression Caspase-5 IL-10
19.60 6.25
is mediated by the ETA and ETB receptors.13-15 While so-called “positive” ET-1 actions (vasoconstriction, improved survival, mitogenic action) are mediated primarily through the ETA receptors, the activation of the ETB receptors counteracts these activities in many cases, such as inducing vasodilation through nitric oxide (NO) release.41 We have shown here that DCs produce large amounts of ET-1 after stimulation with either TNF-␣ or inactivated S aureus, with concomitant increase in the expression of ETA and ETB receptors. The range of ET-1 production by DCs after their stimulation with S aureus is wide, but the coefficients of variation (standard deviation/mean) were similar in both stimulated groups (0.53 for TNF-␣ and 0.62 for S aureus), indicating that variability is consistent across treatments. The wide ET-1 concentration range with S aureus treatment may be explained by the nonspecificity of its action and individual response of DCs derived from different Table 4. Gene expression changes in mature DCs after the treatment with A192621, an endothelin B receptor antagonist Gene description
Fold change expression
Caspase-2
5.20
P53 regulated apoptosis inducing protein mRNA
5.03
Death receptor 3
3.90
IL-15
19.20
Caspase-8
3.89
Interferon-␣8
11.76
Apoptotic protease activating factor 1 (ARAF 1)
3.57
IL-12 receptor ␣
6.80
Caspase recruitment domain protein 10 mRNA
3.28
Interferon-␣ F
5.18
IL-2 receptor ␣
3.14
Decreased expression Interferon-␣1
19.79
Increased expression
Decreased expression
Mature T-cell proliferation 1 protein mRNA
6.50
Bcl2-like 11 (apoptosis facilitator) protein mRNA
6.29
IL-12 A
4.28
Programmed cell death 4 protein mRNA
4.39
IL-12 receptor
4.01
Serinethreonine kinase 17␣ (apoptosis inducing)
4.02
MHC class II
3.72
Caspase-10d
3.40
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
volunteers. The mechanisms of ET-1 production from DCs upon stimulation will be the subject of future studies. Addition of an exogenous ET-1 to immature or mature DC cultures had no significant effect on DC function. Immature DCs express low levels of endothelin receptors, apparently insufficient to significantly impact their function following the ET-1 binding. On the other hand, mature DCs had high numbers of endothelin receptors and appear to be sufficiently stimulated with the DC-derived endogenous ET-1, explaining why the addition of exogenous ET-1 to DC culture did not significantly change DC phenotype or function. The large increase in both ligand (ET-1) and receptor (ETA, ETB) expression occurring with DC maturation indicates the potential for a functional autocrine loop: DCs produce abundant ET-1 that binds to greater numbers of endothelin receptors. Blockade of the endothelin receptors had a profound effect on mature DCs. We observed a significant decline in the expression of CD83 with the blockade of ETA receptors. It is known that CD83 is the marker of mature DCs and that CD83⫹ cells are the most effective stimulators in allogeneic MLRs.42 Recent studies also demonstrated that CD83 is not just a DC marker, but probably has immunostimulatory as well as regulatory effects,43 and it is possible that decreased expression of CD83 by itself might affect DC function. We have observed some changes in the expression of other costimulatory molecules as well (Table 2). Although these differences were not statistically significant, they might have induced biologic effects. In addition, it is possible that proapoptotic features of the ETA receptor antagonists have contributed to the observed effects as well. Another DC function affected by ETA receptor blockade was IL-12 production. IL-12 increases proliferation and activity of natural killer and T cells, and plays a central role in promoting type 1 T helper cell (TH1) responses. Its production by antigenpresenting cells seems to be essential for host defense against intracellular microbial infections and control of malignancy,44-47 and alterations in its production may affect the competence of the immune system. Our data demonstrated significant decrease in the IL-12 production by mature DCs with the blockade of the ETA receptor, suggesting the involvement of the ET-1/ETA loop in the generation of TH1 responses. ET-1 is a known survival factor for many cell types, acting mainly through the ETA receptor.1,11,38,40,48,49 We observed a decreased resistance of mature DCs to apoptotic stimuli (high-dose dexamethasone or serum starvation) when ETA receptor was blocked, meaning that ETA receptor activation is protective and antiapoptotic in DCs. The role of the ETB receptor so far is not well studied. In general, it is believed that ETB receptor activation leads to cell differentiation and apoptosis,50 but in some cell types ETB was found to promote cell survival.51,52 In our experiments, ETB receptor blockade in the presence of agonist (endogenous ET-1) resulted in increased resistance of DCs to apoptotic stimuli. Thus, ETB receptor activation on DCs seems to promote their apoptosis, and might play an important role in abolishing the specific immune responses. Based on the loss of function associated with the administration of ETA receptor antagonists, it appears that ETA receptor stimulation improves DC survival, and mediates antigen-presenting T-cell– stimulating and IL-12–producing features of DCs. These alterations in DCs are consistent with an immunostimulating role of ETA. These findings were further supported by gene array studies, demonstrating the up-regulation of proapoptotic genes associated with the ETA receptor blockade and down-regulation of proinflammatory cytokines (Table 3). Gene array data obviously need to be confirmed with additional experiments, but changes in the expression levels of several genes in pathways involving apoptotic and immunostimulatory factors warrant further studies.
DENDRITIC CELLS AND ENDOTHELIN AXIS
2113
We have shown here that the blockade of ETB receptors improved survival and increased CD83 expression on DCs. It seems that observed ETB-mediated effects on DCs are the opposite of those mediated by the ETA receptor. This pattern of cell regulation was also seen in other endothelin-driven functions. The results of gene array experiments also demonstrated decreased expression of several proapoptotic genes (Table 4) in DCs after the blockade of ETB receptors. These divergent effects of ET-1 on DC function provide 2 means for potential immunomodulation, depending on receptor subtype targeted: blocking of ETA receptors may be immunosuppressive, whereas blocking of ETB receptors may be stimulatory for DCs. The exact mechanisms of ET-1 action on DCs still need to be elucidated. Although the outcome of some experiments may be thought to be the result of increased DC apoptosis due to ETA receptor blockade (for example, CD83 expression), in most cases experiments were performed with the same number of live cells (MLR), or results have been normalized according to the number of counted live cells (IL-12 production). Still, due to apparent enhanced apoptosis of DCs with ETA receptor blockade, this possibility needs to be always kept in mind, with some monitoring of the number of live DCs before the start of experiment. Another possible mechanism of ET influence on DCs worth exploring is the involvement of NO. As we have mentioned, ETB receptor activation was found to increase NO synthesis in endothelial cells.41 Other studies also demonstrated the change in NO level with the stimulation or blockade of different ET receptors, with ETA receptor activation or ETB receptor blockade leading mostly to the decreased NO levels,53,54 while ETB receptor stimulation was accompanied with increased NO synthesis.55 NO was also found to interfere with the ET-1/ETA–mediated increased cell proliferation.56 Regarding DCs, it is known that NO may be involved in DC apoptosis57,58 and may have a role in DC-mediated T-cell proliferation.59,60 Further experiments should clarify the role of NO in ET-1–induced DC modifications. Administration of ETA receptor antagonist in rats during the experimental renal transplantation improved graft survival,61,62 which was mainly attributed to the probable vasodilating features of the ETA receptor antagonists. It is possible, however, that improved graft survival was due to the ETA receptor blockade on DCs, accompanied by the suppression of their T-cell–stimulating capacity. In other studies, administration of BQ-123, an ETA receptor antagonist, inhibited eosinophil and mononuclear cell migration, due to the inhibition of CD4⫹ and CD8⫹ T lymphocytes.63 We failed to identify endothelin receptors on T cells by immunohistochemical staining (data not shown), leading us to speculate that the inhibition of T cells might be mediated by DC suppression due to blockade of ETA receptors. However, this hypothesis requires further experimental confirmation. In conclusion, our data showed for the first time that human DCs produce ET-1 and express functional ETA and ETB receptors, which are up-regulated during DC maturation. We demonstrated that ET-1 production and ETA activation play an important role in the activity of human DCs. The observed ability of ETA receptor antagonists to interfere with the behavior of DCs and suppression of DC-mediated immune response should be further explored, both experimentally and clinically, including many areas of possible DC-based therapies, ranging from cancer to transplantation.64-69 Likewise, the counter-regulatory activities of ET-1/ETB and ET-1/ ETA autocrine or paracrine loops might provide a new means to modulate DC function, such as increase in cell survival, cytokine production, and T-cell activation. The wide availability of selective ET receptor antagonists should accelerate these investigations.
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. 2114
BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
GURULI et al
References 1. Yanagisawa M, Kurihara H, Kimura S, et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411415. 2. Yanagisawa M, Inoue A, Ishikawa T, et al. Primary structure, synthesis, and biologic activity of rat endothelin, an endothelium-derived vasoconstrictor peptide. Proc Natl Acad Sci U S A. 1988;85: 6964-6967. 3. Springall DR, Howarth PH, Counihan H, Djukanovic R, Holgate ST, Polak JM. Endothelin immunoreactivity of airway epithelium in asthmatic patients. Lancet. 1991;337:697-701. 4. Marsh MM, Findlay JK, Salamonsen LA. Endothelin and menstruation. Hum Reprod. 1996;11: 83-89. 5. Langenstroer P, Tang R, Shapiro E, Divish B, Opgenorth T, Lepor H. Endothelin-1 in the human prostate: tissue levels, source of production and isometric tension studies. J Urol. 1993;150:495499. 6. Ishikawa T, Yanagisawa M, Kimura S, Goto K, Masaki T. Positive inotropic action of novel vasoconstrictor peptide endothelin on guinea pig atria. Am J Physiol. 1988;255:H970-H973. 7. Uchida Y, Ninomiya H, Saotome M, et al. Endothelin, a novel vasoconstrictor peptide, as potent bronchoconstrictor. Eur J Pharmacol. 1988;154: 227-228. 8. Lopez-Farre A, Montanes I, Millas I, Lopez-Novoa JM. Effect of endothelin on renal function in rats. Eur J Pharmacol. 1989;163:187-189. 9. Stojilkovic SS, Merelli F, Iida T, Krsmanovic LZ, Catt KJ. Endothelin stimulation of cytosolic calcium and gonadotropin secretion in anterior pituitary cells. Science. 1990;248:1663-1666. 10. Nelson JB, Hedican SP, George DJ, et al. Identification of endothelin-1 in the pathophysiology of metastatic adenocarcinoma of the prostate. Nature Med. 1995;1:944-999. 11. Wu-Wong JR, Chiou WJ, Dickinson R, Opgenorth TJ. Endothelin attenuates apoptosis in human smooth muscle cells. Biochem J. 1997;328:733737.
21. Hosoda K, Hammer RE, Richardson JA, et al. Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice. Cell. 1994;79:1267-1276. 22. Puffenberger EG, Hosoda K, Washington SS, et al. A missense mutation of the endothelin-B receptor gene in multigenic Hirschsprung’s disease. Cell. 1994;79:1257-1266. 23. Levin ER. Endothelins. N Engl J Med. 1995;333: 356-363.
25. Benigni A, Remuzzi G. Endothelin antagonists. Lancet. 1999;353:133-138.
44. Scott P. IL-12: initiation cytokine for cell-mediated immunity. Science. 1993;260:496-497.
26. Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice, I: morphology, quantitation, tissue distribution. J Exp Med. 1973;137:1142-1162.
45. Brunda MJ. Interleukin-12. J Leukoc Biol. 1994; 55:280-288.
27. Hart DN. Dendritic cells: unique leukocyte populations which control the primary immune response. Blood. 1997;90:3245-3287. 28. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245252.
30. Ehrenreich H, Anderson RW, Fox CH, et al. Endothelins, peptides with potent vasoactive properties, are produced by human macrophages. J Exp Med. 1990;172:1741-1748.
49. Shichiri M, Kato H, Marumo F, Hirata Y. Endothelin-1 as an autocrine/paracrine apoptosis survival factor for endothelial cells. Hypertension. 1997; 30:1198-1203.
31. Ruetten H, Thiemermann C. Endothelin-1 stimulates the biosynthesis of tumour necrosis factor in macrophages: ET-receptors, signal transduction and inhibition by dexamethasone. J Physiol Pharmacol. 1997;48:675-688.
50. Masaki T, Miwa S, Sawamura T, Ninomiya H, Okamoto Y. Subcellular mechanisms of endothelin action in vascular system. Eur J Pharmacol. 1999;375:133-138.
32. Pirtskhalaishvili G, Shurin GV, Esche C, et al. Cytokine-mediated protection of human dendritic cells from prostate cancer-induced apoptosis is regulated by the Bcl-2 family of proteins. Br J Cancer. 2000;83:506-513.
15. Sakurai T, Yanagisawa M, Masaki T. Molecular characterization of endothelin receptors. Trends Pharmacol Sci. 1992;13:103-108.
35. Brunner C, Seiderer J, Schlamp A, et al. Enhanced dendritic cell maturation by TNF-alpha or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo. J Immunol. 2000;165: 6278-6286.
19. Kurihara Y, Kurihara H, Suzuki H, et al. Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature. 1994;368: 703-710. 20. Baynash AG, Hosoda K, Giaid A, et al. Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons. Cell. 1994;79:12771285.
47. Ma X, Trinchieri G. Regulation of interleukin-12 production in antigen-presenting cells. Adv Immunol. 2001;79:55-92. 48. Nelson JB, Chan-Tack K, Hedican SP, et al. Endothelin-1 production and decreased endothelin B receptor expression in advanced prostate cancer. Cancer Res. 1996;56:663-668.
34. Cella M, Engering A, Pinet V, Pieters J, Lanzavecchia A. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature. 1997;388:782-787.
18. Newman P, Kakkar VV, Kanse SM. Modulation of endothelin receptor expression in human vascular smooth muscle cells by interleukin-1 beta. FEBS Lett. 1995;363:161-164.
46. Gately MK, Renzetti LM, Magram J, et al. The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses. Annu Rev Immunol. 1998;16:495-521.
29. Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol. 2000; 18:767-811.
14. Sakurai T, Yanagisawa M, Takuwa Y, et al. Cloning of a cDNA encoding a non-isopeptide-selective subtype of the endothelin receptor. Nature. 1990;348:732-735.
17. Nambi P, Pullen M, Contino LC, Brooks DP. Upregulation of renal endothelin receptors in rats with cyclosporine A-induced nephrotoxicity. Eur J Pharmacol. 1990;187:113-116.
42. Zhou LJ, Tedder TF. Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily. J Immunol. 1995;154: 3821-3835. 43. Lechmann M, Zinser E, Golka A, Steinkasserer A. Role of CD83 in the immunomodulation of dendritic cells. Int Arch Allergy Immunol. 2002;129: 113-118.
13. Arai H, Hori S, Aramori I, Ohkubo H, Nakanishi S. Cloning and expression of a cDNA encoding an endothelin receptor. Nature. 1990;348:730-732.
16. Liu J, Chen R, Casley DJ, Nayler WG. Ischemia and reperfusion increase 125I-labeled endothelin-1 binding in rat cardiac membranes. Am J Physiol. 1990;258:H829-H835.
41. Hirata Y, Emori T, Eguchi S, et al. Endothelin receptor subtype B mediates synthesis of nitric oxide by cultured bovine endothelial cells. J Clin Invest. 1993;91:1367-1373.
24. Goldie RG. Endothelins in health and disease: an overview. Clin Exp Pharmacol Physiol. 1999;26: 145-148.
33. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med. 1994;179:1109-1118.
12. Pirtskhalaishvili G, Nelson JB. The endothelin receptor: a novel target for anticancer therapy. Am J Cancer. 2002;1:81-91.
decreased by endothelin A receptor blockade. Urology. 1999;53:1063-1069.
36. Rescigno M, Granucci F, Ricciardi-Castagnoli P. Molecular events of bacterial-induced maturation of dendritic cells. J Clin Immunol. 2000;20:161166. 37. Ebner S, Ratzinger G, Krosbacher B, et al. Production of IL-12 by human monocyte-derived dendritic cells is optimal when the stimulus is given at the onset of maturation, and is further enhanced by IL-4. J Immunol. 2001;166:633-641. 38. Moraitis S, Miller WR, Smyth JF, Langdon SP. Paracrine regulation of ovarian cancer by endothelin. Eur J Cancer. 1999;35:1381-1387. 39. Ren B, Yu YP, Jing L, et al. Gene expression analysis of human soft tissue leiomyosarcomas. Hum Pathol. 2003;34:549-558. 40. Nelson JB, Nguyen SH, Wu-Wong JR, et al. New bone formation in an osteoblastic tumor model is increased by endothelin-1 overexpression and
51. Lahav R, Heffner G, Patterson PH. An endothelin receptor B antagonist inhibits growth and induces cell death in human melanoma cells in vitro and in vivo. Proc Natl Acad Sci U S A. 1999;96:1149611500. 52. Bagnato A, Rosano L, Di Castro V, et al. Endothelin receptor blockade inhibits proliferation of Kaposi’s sarcoma cells. Am J Pathol. 2001;158:841847. 53. Murakoshi N, Miyauchi T, Kakinuma Y, et al. Vascular endothelin-B receptor system in vivo plays a favorable inhibitory role in vascular remodeling after injury revealed by endothelin-B receptorknockout mice. Circulation. 2002;106:1991-1998. 54. Wu R, Flammer J, Yao K, Haefliger IO. Reduction of nitrite production by endothelin-1 in isolated porcine ciliary processes. Exp Eye Res. 2003;77: 189-193. 55. Mathison Y, Israel A. Role of endothelin type B receptor in NO/cGMP signaling pathway in rat median eminence. Cell Mol Neurobiol. 2002;22: 783-795. 56. Kizawa Y, Ohuchi N, Saito K, Kusama T, Murakami H. Effects of endothelin-1 and nitric oxide on proliferation of cultured guinea pig bronchial smooth muscle cells. Comp Biochem Physiol C Toxicol Pharmacol. 2001;128:495-501. 57. Lu L, Bonham CA, Chambers FG, et al. Induction of nitric oxide synthase in mouse dendritic cells by IFN-gamma, endotoxin, and interaction with allogeneic T cells: nitric oxide production is associated with dendritic cell apoptosis. J Immunol. 1996;157:3577-3586. 58. Stanford A, Chen Y, Zhang XR, Hoffman R, Zamora R, Ford HR. Nitric oxide mediates dendritic cell apoptosis by downregulating inhibitors of apoptosis proteins and upregulating effector caspase activity. Surgery. 2001;130:326-332. 59. Bonham CA, Lu L, Li Y, Hoffman RA, Simmons RL, Thomson AW. Nitric oxide production by
From bloodjournal.hematologylibrary.org by guest on June 9, 2013. For personal use only. BLOOD, 1 OCTOBER 2004 䡠 VOLUME 104, NUMBER 7
mouse bone marrow-derived dendritic cells: implications for the regulation of allogeneic T cell responses. Transplantation. 1996;62:1871-1877. 60. Paolucci C, Burastero SE, Rovere-Querini P, et al. Synergism of nitric oxide and maturation signals on human dendritic cells occurs through a cyclic GMP-dependent pathway. J Leukoc Biol. 2003;73:253-262. 61. Orth SR, Odoni G, Amann K, Strzelczyk P, Raschack M, Ritz E. The ET(A) receptor blocker LU 135252 prevents chronic transplant nephropathy in the “Fisher to Lewis” model. J Am Soc Nephrol. 1999;10:387-391. 62. Braun C, Conzelmann T, Vetter S, et al. Preven-
DENDRITIC CELLS AND ENDOTHELIN AXIS
tion of chronic renal allograft rejection in rats with an oral endothelin A receptor antagonist. Transplantation. 1999;68:739-746. 63. Sampaio AL, Rae GA, Henriques MM. Role of endothelins on lymphocyte accumulation in allergic pleurisy. J Leukoc Biol. 2000;67:189-195. 64. Thomson AW, Lu L. Are dendritic cells the key to liver transplant tolerance? Immunol Today. 1999; 20:27-32. 65. Dhodapkar MV, Bhardwaj N. Active immunization of humans with dendritic cells. J Clin Immunol. 2000;20:167-174. 66. Brossart P, Wirths S, Brugger W, Kanz L. Den-
2115
dritic cells in cancer vaccines. Exp Hematol. 2001;29:1247-1255. 67. Ludewig B, Junt T, Hengartner H, Zinkernagel RM. Dendritic cells in autoimmune diseases. Curr Opin Immunol. 2001;13:657-662. 68. Link H, Huang YM, Masterman T, Xiao BG. Vaccination with autologous dendritic cells: from experimental autoimmune encephalomyelitis to multiple sclerosis. J Neuroimmunol. 2001;114: 1-7. 69. Lu L, Thomson AW. Manipulation of dendritic cells for tolerance induction in transplantation and autoimmune disease. Transplantation. 2002;73: S19-S22.