Ergot species of the Claviceps purpurea group from South Africa

f u n g a l b i o l o g y x x x ( 2 0 1 6 ) 1 e1 4

journal homepage: www.elsevier.com/locate/funbio

Ergot species of the Claviceps purpurea group from South Africa b,c, Sylvie PAZOUTOV b, Elna J. VAN DER LINDEa,*, Kamila PESICOV A A b, Miroslav FLIEGERb, Miroslav KOLAR IKb,** Eva STOD ULKOVA a

Biosystematics Division, Plant Protection Research Institute, Agricultural Research Council, Private Bag X134, Pretoria 0121, South Africa b Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology, Academy of Sciences of the Czech ska 1083, 142 20 Praha 4, Czech Republic Republic, v.v.i., Vıden c tska 2, 128 01 Praha 2, Czech Republic Department of Botany, Faculty of Science, Charles University in Prague, Bena

article info

abstract

Article history:

Results of a survey and study of the Claviceps purpurea group of species in South Africa are

Received 29 January 2016

being presented and five new species are described. Morphological descriptions are based

Received in revised form

on the anamorphs and four nuclear genetic loci. Claviceps fimbristylidis sp. nov. on Fimbris-

13 April 2016

tylis complanata was discovered wide-spread across five provinces of the country associated

Accepted 9 May 2016

with water and represents the fourth Claviceps species recorded from the Cyperaceae. Clav-

Corresponding Editor:

iceps monticola sp. nov. is described from Brachypodium flexum growing in mountain forests

Kerry O’Donnell

in Mpumalanga Province, as well as the northern Drakensberg southwards into the Eastern Cape Province. Claviceps pazoutovae sp. nov. is recorded from Stipa dregeana var. dregeana

Keywords:

and Ehrharta erecta var. erecta, also associated with these mountain ranges. Claviceps macro-

Alkaloids

ura sp. nov. is recorded from Cenchrus macrourus from the Eastern Cape and Claviceps capen-

Cyperaceae

sis sp. nov. from Ehrharta villosa var. villosa is recorded from the Western Cape Province.

Phylogeny

Claviceps cyperi, only recorded from South Africa is included in the study. Ergot alkaloid pro-

Plant pathogens

files of all species are provided and showed similarity to C. purpurea. Only C. cyperi and in

Poaceae

lesser degree C. capensis, C. macroura, and C. pazoutovae produced ergot alkaloids in clini-

Taxonomy

cally significant amounts. Several reported species infect invasive grass species, native to South Africa, and thus represent potentially invasive species. ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction Africa is home to numerous invasive grasses which destroyed natural grass ecosystems over the world (Williams & Baruch 2000; Foxcroft et al. 2010). It was also shown that as a result, their specific ergot species expanded their host range e.g. Claviceps africana, Claviceps cynodontis, Claviceps fusiformis, and

Claviceps sulcata and are now spread all over the world (viz. et al. 2011). A crucial step in the monitoring of ergot outova Paz host ranges, geographical distribution, and possible invasion is the characterisation of their host spectrum on native African grasses. Although some studies on Zimbabwean species (previously known as Rhodesia) were performed by authors such as Loveless (1964a, 1967), Loveless & Herd (1964), and

* Corresponding author. Tel.: þ27 12 808 8288; fax: þ27 12 808 829. ** Corresponding author. Tel.: þ420 29644 2332; fax: þ420 29644 2347. E-mail addresses: [email protected] (E. J. van der Linde), [email protected] (M. Kolarık). http://dx.doi.org/10.1016/j.funbio.2016.05.006 1878-6146/ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: van der Linde EJ, et al., Ergot species of the Claviceps purpurea group from South Africa, Fungal Biology (2016), http://dx.doi.org/10.1016/j.funbio.2016.05.006

2

et al. (2008a, 2011), no single comprehensive study outova Paz of the South African species has been done; existing research papers on southern African species mostly describe single or groups of species, most of which were introduced due to the introduction of their hosts, usually for forage purposes. The Claviceps purpurea species group is a phylogenetically well-defined lineage of the closely related species Claviceps arundinis, Claviceps grohi, Claviceps humidiphila, Claviceps nigricans, C. purpurea, Claviceps spartinae, and Claviceps zizaniae et al. 2011, 2015). Among all ergot outova (Lorenz et al. 2009; Paz species, the most potent producers of ergot alkaloids, especially pharmaceutically and ecotoxicologically important ergopeptines, form part of this species group (Lorenz et al. 2009). Only two species from this group have been identified in South Africa to species level namely C. purpurea (with a wide host range including mostly introduced hosts such as Lolium), as well as Claviceps cyperi (on Cyperus esculentus). The conidia seemed to be the only tool for identification of these old herbarium specimens. Although the conidia of Claviceps species vary considerably in shape and size, for some species these features are often quite distinctive; in addition, the range of size as well as length/width (L/W) ratio is a useful character as an accessory to shape in the delimiting of species (Langdon 1954). Loveless (1964b) also demonstrated the use and value of the morphology of the conidia when examining herbarium material and concluded that in many cases they form discriminating taxonomic markers and that these characteristics have to be relied upon especially when examining old herbarium specimens. et al. (2011), numerous Claviceps outova According to Paz anamorphs are deposited in herbaria, but few were formally described as the essential teleomorph was lacking. They also stated that others have found that these conidial dimensions vary considerably in different collections of the same species & outova (viz. Muthusubramanian et al. 2005; Paz Frederickson 2005) and that care should be taken to use these characters in combination with other morphological e and in et al. (2011) outova recent times, also molecular characters. Paz concluded that the coidentification of dated Claviceps herbarium specimens for which cultures and DNA sequences are available is crucial for establishing past and recent distributions and migrations of species. However, despite this variability, conidial shape and length/width ratio are often the only useful markers for the identification of recently found anamorphs by comparison with herbarium specimens of de et al. 2011). outova scribed Claviceps species (Paz In a comprehensive study, we screened ergotised grasses in South Africa which included invasive grass species from the genus Ehrharta and Cenchrus. In this paper we are describing five new species from the C. purpurea species complex; members of this species group were overlooked in South Africa so far.

Materials and methods Herbarium specimens Apart from the collections done over the past 8 y, other relevant unidentified specimens of ergotised grasses in

E. J. van der Linde et al.

the dried herbarium collection of the South African National Collections of Fungi (PREM) have been examined and are included in this study. Cultures generated have also been deposited in its live culture collection (PPRI) as well as in the Culture Collection of Clavicipitaceae at Institute of Microbiology, Academy of Sciences of the Czech Republic (CCC). Isotypes of some specimens have been deposited in the National Museum in Prague (PRM). Isolates and their cultivation. Sclerotia were surface sterilized for 3 min with 1 % sodium hypochlorite, rinsed three times in sterilized distilled water, and plated onto Potato Dextrose Agar (PDA) containing antibiotics. Honeydew drops found on florets of infected grasses were plated onto Water Agar (WA) agar plates containing antibiotics and agar pieces containing germinating macroconidia were subsequently transferred et al. 2015). Isolates are being maintained outova onto PDA (Paz in the PPRI and CCC collection on PDA agar punches covered with sterile water, PDA slants covered with sterile liquid paraffin, by ultra-low freezing as well as freeze dried cultures (Table 1).

Alkaloid analysis Sample preparation and alkaloid extraction. Pulverized sclerotia (10 mg) were mixed with extraction mixture consisting of tolueneeethyl alcohol mixture (4:1, v:v, 0.5 mL) and gently stirred for 1 h. Supernatant was separated by centrifugation and kept in the freeze until use (M.F., unpubl.). High-performance liquid chromatography (HPLC) analyses. The HPLC system consisted of a pump equipped with a 600E system controller, auto-sampler 717, and dual UV detector 2487 (Waters, Milford, MA, USA). The data were processed using Empower 2 software. Water containing mobile phases were filtered through a 0.22 mM GS filter (Millipore, Billerica, MA, USA) and degassed in an ultrasonic bath for 10 min before use. A Luna 5 m C18(2) column (250 4.6 mm, Phenomenex) with a guard column was used for the analysis. The mobile phase consisted of: A.) 10 % acetonitrile in water with KH2PO4 (9.18 g 1 L1; pH adjusted at 3.12) and B.) acetonitrile. Gradient elution: 10 % B (0 min), increasing linearly to 35 % B (40 min), increasing linearly to 65 % B (10 min). Each analysis was followed by a column washing (65 % B, 10 min) and equilibration step (10 % B, 10 min). Flow rate, 1.0 mL min1. UV detection was performed at 288 and 315 nm, respectively. Calibration. A standard solution of ergotamine was prepared in methanol at final concentrations of 62.5, 125, 250, 500, and 1000 mg mL1. The calibration graphs were constructed by plotting the integrated peak areas of individual compounds versus concentration. The linear regression equation ( y ¼ 5946.4x) and correlation coefficient (r ¼ 0.997), were obtained. et al. (2011), we have chooutova Taxonomy. Following Paz sen to describe new species from the asexual stage of development in the otherwise teleomorphic genus Claviceps. Descriptions are based on the appearance of macroconidia and sclerotia, and a sequence of the nuclear ribosomal DNA region (nrDNA), minichromosome Maintenance Complex Component 7 (MCM7) gene, elongation factor-1a gene (EF1a), and beta-tubulin gene (Tub2).


Species

Specimen reference

capensis

*PREM 61148

cyperi

PREM 61132

cyperi cyperi

PREM 60647 PREM 61149

fimbristylidis *PREM 61127 fimbristylidis PREM 60662 macroura

PREM 61135

monticola monticola

PREM 61280 *PREM 61136

Culture reference

Location

Lm Wma Qmb nrDNA (ITS/LSU)

MCM7

EF1-a

Tub2

CCC 1504; PPRI 16249 & 16250 CCC 1476; PPRI 16223

Ehrharta villosa var. villosa

Constantia Neck, Cape Town, SA

6.7 3.9

1.7

LN846837

LN846890 LN846862 LN846876

Cyperus esculentus

13.7 4.2

3.3

LN846842

n.d.

CCC 1219; PPRI 10436 CCC 1215 & 1217; PPRI 10430 & 10433 CCC 1472 & 1473; PPRI 16239 & 16240 CCC 1207e1214; PPRI 10563e65, 67, 69e72 CCC 1482; PPRI 16245

Cyperus esculentus Cyperus esculentus

Bredell, Kempton Park, Gauteng, SA Kempton Park, Gauteng, SA Villiers, Free State Province, SA

9.8 3.5 9.8 3.5

2.8 2.8

LN846852 LN846853

LN846884 LN846865 LN846879 LN846883 LN846866 LN846878

Fimbristylis complanata

Bronkhorstspruit, Gauteng, SA

8.5 3.6

2.4

LN846841

LN846885 LN846859 LN846872

Fimbristylis complanata

Retiefklip, Drakensberg, KZN, SA

8.7 3.8

2.3

LN846882 LN846867 LN846877

7.1 3.5

2.0

LN846854 LN846855 LN846844

7.4 3.2 7.0 3.1

2.3 2.3

LN880551 LN846845

LN880553 LN880552 n.d. LN846889 LN846860 LN846875

7.4 3.1

2.4

LN846836

n.d.

n.d.

n.d.

n.d.

n.d.

monticola

PPRI 20146, PPRI 20192 CCC 1483 & 1484; PPRI 16234 & 16235 PREM 611441 CCC 1496 & 1497; PPRI 16232 & 16233 PREM 61119 CCC 1421e1423

monticola

PREM 60852

pazoutovae

PREM 61143

pazoutovae

*PREM 61137

CCC 1222 & 1229; PPRI 11976 & 11983 CCC 1494 & 1495; PPRI 16254 & 16255 CCC 1485; PPRI 16247

pazoutovae

PREM 61134

CCC 1477; PPRI 16246a & b

pazoutovae

pazoutovae

Honeydew CCC 1424e1426 depleted; no specimen PREM 61150 CCC 1393; PPRI 9537

pazoutovae

PREM 61150

monticola

Host

CCC 1397; PPRI 9543

Cenchrus macrourus

n.d.

n.d.

Hogsback, Eastern Cape Province, SA Brachypodium flexum Machadodorp, Mpumalanga, SA Brachypodium flexum Hogsback, Eastern Cape Province, SA Brachypodium flexum Royal Natal National Park, KwaZulu-Natal, SA Brachypodium flexum Royal Natal National Park, KwaZulu-Natal, SA Brachypodium flexum Royal Natal National Park, KwaZulu-Natal, SA Ehrharta erecta var. erecta Royal Natal National Park, KwaZulu-Natal, SA Stipa dregeana var. dregeana Hogsback, Eastern Cape Province, SA Stipa dregeana var. dregeana Royal Natal National Park, KwaZulu-Natal, SA Ehrharta erecta var. erecta Royal Natal National Park, KwaZulu-Natal, SA

n.d.

n.d.

LN846856

n.d.

6.5 2.3

2.8

5.7 2.3

2.5

LN846851 LN846846 LN846838

LN846888 LN846864 LN846881 LN846887 LN846857 LN846880 LN846892 LN846861 LN846874

7.1 3.5

2.0

LN846840

LN846891 LN880554 LN880555

7.4 3.2

2.3

LN846843

n.d.

n.d.

n.d.

5.9 2.3

2.6

LN846849 LN846850

n.d.

n.d.

n.d.

Stipa dregeana

7.2 3.0

2.4

LN846847

n.d.

LN846858 LN846871

7.1 3.2

2.2

LN846848

n.d.

n.d.

Stipa dregeana

Hogsback, Eastern Cape Province, SA Hogsback, Eastern Cape Province, SA

LN846886 LN846863 LN846873

Ergot species of the C. purpurea group from South Africa

n.d.

a Lm e mean spore length (arithmetical mean of all spores, mm), Wm e mean spore width (arithmetical mean of all spores, mm). b Qm e the mean of quotients of spore length and spore width in any one spore.

3


Table 1 e Specimens included in the phylogenetic study, with EMBL accession numbers of their DNA sequences. Holotypes are marked with an asterisk.

4


Fig 1 e Bayesian phylogenetic inference based on four gene dataset showing position of species from the Claviceps purpurea species group. Specimens studied during our study are printed in bold. The outgroup branch is fourth times shortened for visual reasons. Thick branches indicate Bayesian posterior probabilities [ 1.00.

Morphology Conidia were washed off sclerotia from plant specimens and used for observations and measurement of conidial size. Spores were mounted in a drop of water and photographed and measured using a Zeiss Axio Scope A1. Microscope preparations were made in water and observed with an Axio Scope A1 microscope (Carl Zeiss, Jena) using differential interference contrast (DIC) illumination. The measurements were done on photos recorded with a ProgRes SpeedXTcore 5 digital camera (Jenoptik Optical Systems, Jena) using the ProgRes image processing software. At least 30 conidia measurements per specimen were performed. The statistical treatment of spore size data was done using KyPlot 2.0 beta 15 (Yoshioka 2002).

DNA extraction, amplification, and sequencing DNA was purified from 4e7-d old mycelium grown on T2 plates using an ArchivePure DNA Yeast & Gram Kit (5 PRIME, et al. (2015). Nuclear ribooutova Hamburg) as described in Paz somal DNA containing internal transcribed spacers (ITS1 and ITS2), 5.8S, and the 50 end of the large subunit ribosomal RNA gene (LSU) was amplified with primer pair ITS1F-KYO2/NL4 (ca. 1.2 kbp) (O’Donnell 1993; Toju et al. 2012). The MCM7

gene (ca. 0.46 kbp) was amplified and sequenced with new designed primer pair CARCA-F (CARCACAARAAGGCNTAYAGC) and M456-5R (TGTTCCATGACTTCGTGGAT). Primers EF1-983F/EF1-2218R were used for amplification of the EF1a gene (ca. 1.0 kbp) (Rehner & Buckley 2005). The same primers were also used for DNA sequencing. The Tub2 gene (ca. 1.5 kbp) was amplified with primer pair T1/T22 and it was sequenced with primers T2 and T12 (O’Donnell & Cigelnik 1997). The PCR reaction conditions in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany) were as follows: one cycle of 3 min at 95 C, 30 s at 55 C, and 1 min at 72 C; 30 cycles of 30 s at 95 C, 30 s at 55 C, and 1 min at 72 C; one cycle 30 s at 95 C, 30 s at 55 C, and 10 min at 72 C. The reaction mixture consisted of 1 U of PerfectTaq DNA polymerase (5 Prime) or PerfectTaq Plus DNA polymerase (5 Prime) or Maximo Taq Polymerase (GeneON), respective PCR buffer, 0.2 mM deoxynucleotides, 2 pmol of each primer, and 5e50 ng of DNA in 25 ml of total volume. Custom sequencing of DNA was performed at Macrogen Inc. (Seoul, Korea).

Phylogenetic analysis The phylogenetic position of new species in the genus Claviceps was established using single locus analysis and


0.03 0.01 0.22 0.95 0.72 2.12 0.02 0.27 0.15 2.20 9.46 7.23 21.17 0.24

a-Ergocryptine

213.90 31.53 1922.24 575.95 634.47 20 588.14

Ergocornine

40.04 14.56 34.18 234.17 198.58 53.89 4.02

Ergotamine

5

multilocus analysis. The rDNA dataset consisted of 29 isolates (Online Resource 1), from which 12 were selected for multigene analysis (Fig 1). The dataset of nrDNA contained 29 sequences and consisted of 1326 positions (87 parsimony informative, 204 variable, 115 singleton, and 1067 conserved). The number of positions after Gblocks curation was 1110 (83 % of the original 1326 positions) (44 parsimony informative, 134 variable, 90 singleton, and 976 conserved). Sequences were aligned using MAFFT (Katoh & Toh 2008) and curated in Gblocks software (Castresana 2000). A suitable model for each locus was selected using MEGA6 (Tamura et al. 2013): K2 þ G (nrDNA, MCM7), TN93 þ G (EF1-a), HKY þ G (Tub2), TN93 þ G þ I (concatenated dataset). The aligned concatenated dataset (20 sequences) consisted of 4301 positions (including gaps), 322 of them were parsimony informative, 783 of them were variable, 451 of them were singleton, and 3405 of them were conserved. The new number of positions after Gblocks curation was 3982 (92 % of the original 4301 positions). Two hundred and sixty (260) of them were parsimony informative, 678 of them were variable, 418 of them were singleton, and 3304 of them were conserved. The MCM7, EF1-a, and Tub2 datasets for single locus analysis were created from the concatenated curated dataset. Bayesian phylogenetic analyses were performed by using MrBayes v3.2.4 (Ronquist et al. 2012). A metropolis-coupled Markov chain Monte Carlo search algorithm with 10 000 000 generations was used. Burnin was determined with Tracer 1.4 (http://tree.bio.ed.ac.uk/software/tracer) and discarded. Epichlo€e typhina X52616 was used as a sister group to the Claviceps purpurea lineage based on nrDNA phylogeny of the whole genus (data not shown). All datasets were deposited in TreeBASE database (http://treebase.org), accession number 18831 (https://treebase.org/treebase-web/search/study/summary.html?id¼18831).

Results

monticola monticola pazoutovae capensis macroura cyperi fimbristylidis fimbristylidis fimbristylidis

CS CS CS CS CS CS CS CS CS

339 361 342 369 337 328 305 165 144

247.87

8645.76 6394.69 393.04 168.24

20.99 102.43

Phylogeny

C. C. C. C. C. C. C. C. C.

Ergosine Ergometrine Specimen no. Species

Table 2 e Quantitative and qualitative analysis of ergot alkaloids in six studied Claviceps species.

Ergocristine

129.98 71.48

Rt ¼ 27.63 min

Total [mg g1]

Relative content [%]


All studied species can be distinguished based on ITS rDNA, as well as using single protein coding genes (Online Resource 1, 2). Bayesian analysis of the concatenated multigene dataset separated species of the Claviceps purpurea species group into three main lineages (Fig 1). The first lineage consists of the species Claviceps cyperi, Claviceps grohii, Claviceps nigricans, and the newly described Claviceps fimbristylidis. This lineage is homogenous in its ecology (growing in wetlands), and its host specificity to sedges (Poales: Cyperaceae). The second lineage includes Claviceps arundinis, Claviceps humidiphila, Claviceps spartinae, and Claviceps zizaniae, of which the species seem to be host specific to the level of subfamily of grasses from the Poaceae family. Species from this group live in humid locations or directly in wetlands. The third lineage is formed by C. purpurea which is basal to the group of species described in this study e Claviceps macroura, Claviceps capensis, Claviceps pazoutovae, and Claviceps monticola. Ecologically this lineage infects four subfamilies of Poaceae and contains species growing in grasslands including mountainous habitats.


6


Fig 2 e Claviceps capensis (PREM 61148T, culture PPRI 16249). (A) Sclerotia on Ehrharta villosa. (B) Sclerotium (bar 10 mm). (C) Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).

An exception is C. macroura, which infect Cenchrus (Panicoideae), a grass group associated with humid locations.

Alkaloids Sclerotia of the studied species contained alkaloids typically found in Claviceps purpurea, a well-studied member of this species group (Table 2). Only three species, Claviceps capensis, Claviceps cyperi, and Claviceps macroura produced alkaloids in amounts reaching 7 mg g1 or higher. The total amount produced by other species was minute.

Taxonomy

, M. Kolarık, Claviceps capensis E. van der Linde, K. Pesicova sp. nov. MycoBank No.: MB815478, Fig 2. Typification. SOUTH AFRICA. WESTERN CAPE PROVINCE: Cape Town, Constantia Neck, on Ehrharta villosa var. villosa, Sep. 2013, Alan Wood, CS 369 (holotype PREM 61148). Isotype PRM 933998. Ex-type culture CCC 1504, additional cultures CCC 1505, PPRI 16249, 16250. See Table 1 for accession numbers. Etymology. Based on its limited distribution, the Western Cape Province, South Africa. Geographic distribution/host range. South Africa: Western Cape Province on Ehrharta villosa var. villosa.

Specimens examined. SOUTH AFRICA. CAPE PROVINCE: Cedarberg, on Ehrharta calycina, Jan. 1948, N.J.G. Smith (as C. purpurea, PREM 41843); CAPE PROVINCE: Cape Town, Lions Head, on Ehrharta calycina, Jan. 1921, M.R.H. Thomson (as C. purpurea, PREM 14266); CAPE PROVINCE: Kirstenbosch, on Ehrharta sp., Dec. 1920, I.B. Pole Evans (as C. purpurea, PREM 14249). Diagnosis. Macroconidia hyaline, distinctively ovoid to broadly cylindric (5.2e)5.7e8.6(e9.1) (2.5e) 3.0e4.7(e5.2) mm, mean 6.7 3.9 mm. Sclerotia brown to dark brown, protruding, 15 2 mm. Teleomorph not observed. Cultural characteristics. Colonies (21 d, 24 C) on PDA 30 mm in diameter, aerial mycelium off-white, buff reverse fading towards the margin; velutinous, with diffuse margin. Commentary. C. capensis is phylogenetically closest to C. macroura and is grouped in a clade separate from C. pazoutovae. Conidia of C. capensis are distinctively ovoid with an L/W ratio of 1.7, which clearly distinguishes it from both these species. It shares its host genus Ehrharta with that of C. pazoutovae, also described here, which includes isolates and specimens from Ehrharta erecta var. erecta and E. calycina. Together with its molecular data, C. capensis is distinct from any other previously described species. Ehrharta villosa var. villosa is recorded as endemic to South Africa and noted on the South African National Botanical Institute’s endangered list (http://redlist.sanbi.org/, accessed 22 Oct. 2015). Closely related Ehrharta villosa var. maximensis has however been introduced to other parts of the world to stabilize sand dunes and is now recorded to be a serious



7

Fig 3 e Claviceps cyperi (PREM 61132, culture PPRI 16223). (A) Sclerotia on Cyperus esculentus. (B) Sclerotium (bar 10 mm). (C) Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).

invasive weed in Australia and New Zealand (CABI 2015). There is no report of ergotised Ehrharta villosa outside of South Africa. Claviceps cyperi Loveless MycoBank No.: MB328385, Fig 3 e included as species of the C. purpurea group, only recorded from South Africa. Typification. SOUTH AFRICA. GAUTENG: Pretoria, on Cyperus esculentus, Apr. 1944, E.J. Scott (holotype PREM 34102, Loveless 1967). Etymology. Referring to the name of the host, Cyperus esculentus. Geographic distribution/host range. South Africa: widely distributed in association with its host which is a common weed in Gauteng, Free State, KwaZulu-Natal, and Mpumalanga Provinces; on Cyperus esculentus and Cy. rotundus. Specimens examined. SOUTH AFRICA. GAUTENG: Kempton Park, Bredell, on Cyperus esculentus, Mar. 2014, W.M. Kriel, CS 328 (PREM 61132), cultures CCC 1476, PPRI 16223; GAUTENG: Kempton Park, Bredell, on Cyperus esculentus, Mar. 2013, W.M. Kriel, CS 226 (PREM 61115); GAUTENG: Kempton Park, on Cyperus esculentus, Mar. 2011, E.J. van der Linde, CS 124 (PREM 60647), cultures CCC 1219, PPRI 10436. FREE STATE PROVINCE: Villiers, along N3 highway, on Cyperus esculentus, Mar. 2010, E.J. van der Linde, CS 83 (PREM 61149), cultures CCC 1215, 1217, PPRI 10430, 10433. Commentary. Originally described by Loveless (1967) from Cyperus esculentus and Cy. rotundus and included in this

paper to distinguish between species occurring on the Cyperaceae. Examined material had macroconidia hyaline, narrowly oblong or narrowly elliptic (5.5e) 8.0e10.5(e13) 2.0e3.5(e4) mm. Sclerotia dark brown to black, protruding, variable length, most commonly 8e15 mm long, straight to slightly curved, floating on water for 30 min or sometimes longer. Colonies reaching up to 20 mm in diameter (21 d, 24 C) on PDA, densely growing, velutinous, buff reverse fading towards the margin; colonies raised and slightly wrinkled in the centre. Teleomorph described by Loveless (1967). C. cyperi is sister to C. fimbristylidis based on our phylogenetic analysis (Fig 1, Online Resource 2). Sclerotia of C. cyperi are dark brown to black, 8e15 1.5 mm (Loveless 1967) compared with C. fimbristylidis sclerotia of 4e5 0.5e0.8 mm (mean length and width; up to 7 mm long). Conidial shape in C. cyperi is narrowly oblong or narrowly elliptical, varying from 8.5e11.0 2.5e3.5 mm (with a mean of 10.7 and L/W ratio 3.1 in this study for specimens examined) compared with conidia from C. fimbristylidis that are oblong (mean 8.5; L/W ratio 2.3). C. grohii and C. nigricans outova have never been recorded from South Africa (Paz et al. 2008b). Cyperus esculentus, and to a lesser degree also Cy. rotundus, occurs as invasive weed in almost all temperate, tropical, and subtropical regions of the world. Once established, it is extremely difficult to eradicate (CABI 2015, www.cabi.org/isc, accessed 28 Aug. 2015). The


8


Fig 4 e Claviceps fimbristylidis (PREM 61127T, culture CCC 1472). (A) Sclerotia on Fimbristylis complanata. (B) Sclerotium (bar 1 mm). (C) Conidia (bar 10 mm). (D) Culture on medium PDA (21 d old).

distribution of C. cyperi however, seems to be restricted to South Africa. , M. Claviceps fimbristylidis E. van der Linde, K. Pesicova Kolarık, sp. nov. MycoBank No.: MB815479, Fig 4. Typification. SOUTH AFRICA. GAUTENG: Bronkhorstspruit, on Fimbristylis complanata, Apr. 2014, W.M. Kriel, CS 305 (holotype PREM 61127). Isotype PRM 933997. Ex-type culture CCC 1472, additional cultures CCC 1473, PPRI 16239, 16240. See Table 1 for EMBL accession numbers. Etymology. Named after its host Fimbristylis complanata, belonging to the Cyperaceae. Geographic distribution/host range. South Africa: Eastern Cape Province, Free State Province, Gauteng, KwaZuluNatal, and Mpumalanga; on Fimbristylis complanata. Specimens examined. SOUTH AFRICA. GAUTENG: Pretoria, Rietvlei Nature Reserve, on Fimbristylis complanata, Apr. , CS 279 (PREM 61123); Bronkhorstspruit, 2013, S. Pa zoutova on Fimbristylis complanata, Apr. 2011, W.M. Kriel, CS 165 (PREM 60684). MPUMALANGA: Warburton, on Fimbristylis complanata, Mar. 2011, E.J. van der Linde, CS 144 (PREM 60846). KWAZULU-NATAL: northern Drakensberg, Retiefklip, on Fimbristylis complanata, Mar. 2010, E.J. van der Linde, CS 85 (PREM 60662), cultures CCC 1207e1214, PPRI 10563e65, 10567, 10569e10672. FREE STATE PROVINCE: Warden/Bethlehem, on Fimbristylis complanata, Mar. 2011, W.M. Kriel, CS 139 (PREM 60661). Diagnosis. Macroconidia hyaline, varying in shape, most (3.2e) commonly oblong (5.5e)6.5e10.7(e11.7)

3.7e4.5(e5.0) mm, mean 8.5 3.7 mm. Sclerotia smooth, dark brown to black, protruding, straight to slightly curved, more or less triangular in cross section, most commonly 4e5 mm long but reaching up to 7 mm, floating for several days. Teleomorph not observed. Cultural characteristics. Colonies (21 d, 24 C) on PDA 30 mm in diameter, aerial mycelium off-white, buff in the centre, in reverse fading towards the margin; velutinous, with diffuse margin. Commentary. Three Claviceps species were previously described from the Cyperaceae: C. cyperi from Cyperus esculentus and Cy. rotundus (Loveless 1967), Claviceps grohii on Carex (Groves 1943) and C. nigricans on Eleocharis and Scirpus (Brady 1962). Fimbristylis complanata is associated with water and commonly found in the Eastern Cape, Free State, Gauteng, KwaZulu-Natal, and Mpumalanga Provinces. C. fimbristylidis is phylogenetically close to C. cyperi and other species with host plants from the Cyperaceae family (Fig 1, Online Resource 1). Sclerotia of C. fimbristylidis are smaller (4e5 mm) than those of C. cyperi, conidial shape in C. cyperi is cylindrical and longer (mean 10.3; L/W ratio 3.2) and oblong in C. fimbristylidis (mean 8.5; L/W ratio 2.3). C. grohii and C. nigricans have never been recorded from South Africa. Although Fimbristylis complanata has a pantropical distribution and very common throughout these areas (WCSP 2015), its parasitization by ergot has not yet been reported outside of South Africa. , M. Kolarık, Claviceps macroura E. van der Linde, K. Pesicova sp. nov.



9

Fig 5 e Claviceps macroura (PREM 61135T, PPRI 16245). (A) Sclerotia on Cenchrus macrourus. (B) Sclerotium (bar 10 mm). (C) Macroconidia (bar 10 mm). (D) Culture on medium PDA (21 d old).

MycoBank No.: MB815480, Fig 5. Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE: Hogsback, on Cenchrus macrourus, Apr. 2014, W.M. Kriel, CS 337 (holotype PREM 61135). Isotype PRM 934000. Ex-type CCC 1482, additional isolate PPRI 16245. See Table 1 for EMBL accession numbers.

Etymology. Gr. makros long, oura tail, ‘long-tailed’, with reference to the name of the hostplant. The specific epithet is a noun in apposition and hence indeclinable. Geographic distribution/host range. South Africa: Eastern and Western Cape Provinces; on Cenchrus macrourus (¼Pennisetum macrourus) and Cenchrus sphacelatus.

Fig 6 e Claviceps monticola (PREM 61136T, culture PPRI 16234). (A, B) Sclerotia and honeydew on Brachypodium flexum. (C) Sclerotium (bar 10 mm). (D) Culture on medium PDA (21 d old). (E) Macroconidia (bar 10 mm). Please cite this article in press as: van der Linde EJ, et al., Ergot species of the Claviceps purpurea group from South Africa, Fungal Biology (2016), http://dx.doi.org/10.1016/j.funbio.2016.05.006

10


Fig 7 e Claviceps pazoutovae (PREM 61137T, culture PPRI 16247). (A) Sclerotia on Stipa dregeana. (B) Sclerotium (bar 10 mm). (C) Culture on medium PDA (21 d old). (D) Macroconidia (bar 10 mm).

Specimens examined. SOUTH AFRICA. EASTERN CAPE PROVINCE: Hogsback, on C. macrourus, Mar. 2011, E.J. van der Linde, CS 146 (PREM 60668); Hogsback, on C. macrourus, Apr. 2008, E.J. van der Linde (PREM 61150). CAPE PROVINCE: Sir Lowrys Pass, on C. macrourus, Feb. 1978, C. J. Rafin (PREM 45338); Stellenbosch, on C. macrourus, Oct. 1943, Dippenaar (PREM 33983); Stellenbosch, on Cenchrus sphacelatus, Jan. 1941, L. Verwoerd (PREM 32494). Diagnosis. Macroconidia hyaline, oblong to broad cylindric (5.3e)5.9e8.5(e9.1) (2.5e)2.8e4.4(e4.7) mm, mean 7.1 3.5 mm, and L/W ratio 2.0. Sclerotia brown to dark brown, protruding, up to 22 mm long. Teleomorph not observed. Cultural characteristics. Colonies on PDA 25 mm in diameter (21 d, 24 C), velutinous, aerial mycelium off-white, buff reverse. Commentary. C. macroura is phylogenetically closest to, but morphologically clearly distinct from C. capensis which has ovoid conidia. Another clade formed by C. pazoutovae is closest to these two species. C. macroura however, has oblong to broad cylindric, and a mean L/W ratio of 2.0, opposed to the 2.0e2.6 (mean of 2.3 on all hosts) of C. pazoutovae. Brewer & Loveless (1977) examined four South African Claviceps specimens from Cenchrus macrourus collected in close proximity in the Western Cape Province (one of which was PREM 32494) and noted mean conidial dimensions of 5.9 2.46 mm (L/W ratio 2.4) which were identified as C. purpurea. However, re-examination of the specimens in PREM collected in the Western Cape Province demonstrated conidial sizes well within the range noted for the specimens from the Eastern Cape Province. Two other species were recorded from Pennisetum and Cenchrus; C. fusiformis and C. tenuispora are phylogenetically not close to the C. purpurea group and have distinct fusiform and narrowly et al. outova allantoid macroconidia respectively (Paz

2008a, 2011). Cenchrus macrourus is native to southern and eastern Africa but widely introduced on all continents, including Australia and New Zealand where is reported as a highly invasive species (CABI 2015, www.cabi.org/isc, accessed 28 Aug. 2015). There are no records of ergotised C. macrourus outside of South Africa. , M. Kolarık, Claviceps monticola E. van der Linde, K. Pesicova sp. nov. MycoBank No.: MB815481, Fig 6. Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE: Hogsback, on Brachypodium flexum, May 2014, W.M. Kriel, CS 339 (holotype PREM 61136). Isotype PRM 933996. Extype cultures CCC 1483, 1484. See Table 1 for EMBL accession numbers. Etymology. Referring to its association with mountain ranges in South Africa. Geographic distribution/host range. South Africa: along mountain ranges, Mpumalanga, KwaZulu-Natal, and Eastern Cape Provinces; on Brachypodium flexum. Specimens examined. SOUTH AFRICA. MPUMALANGA PROVINCE: Machadodorp, Bermanzi hiking trail, on Brachypodium flexum, May 2015, W.M. Kriel, CS 372 (PREM 61280). EASTERN CAPE PROVINCE: Hogsback, Amathola hiking trail, on Brachypodium flexum, May 2014, W.M. Kriel, CS 336 (PREM 61136). KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium flexum, Apr. 2014, W.M. Kriel, CS 361 (PREM 61144), cultures CCC 1496, 1497, PPRI 16232, 16233; KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium , CS 253 (PREM 61119), culflexum, Mar. 2013, S. Pazoutova tures CCC 1421, 1422, 1423; KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium flexum, Mar. 2012, W.M. Kriel, CS 205 (PREM 60852); KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium flexum, Mar. 2011, W.M. Kriel,



CS 150 (PREM 60672); KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium flexum, Apr. 2010, E.J. van der Linde, CS 88 (PREM 60841); KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Brachypodium flexum, Mar. 2009, E.J. van der Linde, CS 99 (PREM 60845). NATAL: Cathedral Peak area, Indumeni Forest, on Brachypodium flexum, Aug. 1944, E. Schelpe (PREM 34132); NATAL: Donnybrook, Xumeni Forest, on Brachypodium flexum, Jun. 1938, K.E. Morgan, E.M. Doidge (PREM 32770). Diagnosis. Macroconidia hyaline, oblong to broadly cylindric (4.8e)5.7e8.9(e12.2) (1.9e)2.6e3.6(e4.8) mm, mean 7.2 3.1 mm, L/W 2.3. Sclerotia greyish brown to brown, protruding, variable in length, up to 50 mm long, slightly to strongly curved to coiled, not floating on water. Teleomorph not observed. Cultural characteristics. Colonies on PDA reaching 20e30 mm in diameter in 21 d at 24 C, sparsely with diffuse margin, somewhat irregularly raised in the centre, aerial mycelium white, reverse off-white, and yellowish in the centre. Commentary. C. monticola is phylogenetically close to one clade formed by C. pazoutovae (on Ehrharta erecta and Stipa dregeana) as well as a second clade formed by C. capensis (on Ehrharta villosa) and C. macroura (on Cenchrus macrourus) (Fig 1, Online Resource 1). The conidial L/W ratio in C. monticola varied between 2.3 and 2.9 (mean of 2.6 in specimens examined) when compared with C. pazoutovae with a conidial ratio of 2.0e2.6 (mean of 2.2 in specimens examined). In addition, the conidia of C. capensis are distinctively ovoid with an L/W ratio of 1.7. Brachypodium spp. are also typical hosts of Claviceps purpurea in Europe (Barger 1931; Langdon et al. 2015). The potential distribution of C. outova 1952; Paz monticola is the whole of tropical Africa, where its host is spread (WCSP 2015, http://apps.kew.org/wcsp/, accessed 28 Aug. 2015). , M. Claviceps pazoutovae E. van der Linde, K. Pesicova Kolarık, sp. nov. MycoBank No.: MB815482, Fig 7. Typification. SOUTH AFRICA. EASTERN CAPE PROVINCE: Hogsback, on Stipa dregeana var. dregeana, May 2014, W.M. Kriel, CS 342 (holotype PREM 61137). Isotype PRM 933999. Ex-type CCC 1485, 1486, additional cultures PPRI 16247, 16248. See Table 1 for EMBL accession numbers. who outova Etymology. In honour of the late Dr Sylvie Paz dedicated a lifetime to Claviceps research. Geographic distribution/host range. South Africa: Eastern Cape Province, KwaZulu-Natal, and Western Cape Province; on Ehrharta erecta var. erecta, Ehrharta calycina, and Stipa dregeana var. dregeana. Specimens examined. SOUTH AFRICA. KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Ehrharta erecta var. erecta, Apr. 2014, E.J. van der Linde, CS 360 (PREM 61143), cultures CCC 1494, 1495, PPRI 16254, 16255; KWAZULU-NATAL: northern Drakensberg, Royal Natal National Park, on Ehrharta erecta var. erecta, Mar. 2013, S. , cultures CCC 1424e1426. CAPE PROVINCE: Pa zoutova Cedarberg, on Ehrharta calycina, Jan. 1948, N.J.G. Smith (as C. purpurea, PREM 41843); CAPE PROVINCE: Cape Town, Lions Head, on Ehrharta calycina, Jan. 1921, M.R.H. Thomson

11

(as C. purpurea, PREM 14266); CAPE PROVINCE: Kirstenbosch, on Ehrharta sp., Dec. 1920, I.B. Pole Evans (as C. purpurea, PREM 14249). KWAZULU-NATAL: Royal Natal National Park, on Stipa dregeana var. dregeana, Apr. 2014, E.J. van der Linde, CS 332 (PREM 61134), cultures CCC 1477, PPRI 16246; KWAZULU-NATAL: Royal Natal National Park, , CS on Stipa dregeana var. dregeana, Mar. 2013, S. Pazoutova 255 (PREM 61120). EASTERN CAPE PROVINCE: Hogsback, on Stipa dregeana var. dregeana, Mar. 2009, E.J. van der Linde, CS 90 (PREM 60842); EASTERN CAPE PROVINCE: Hogsback, on Stipa dregeana var. dregeana, Mar. 2008, W.M. Kriel (PREM 61150), cultures CCC 1392e1394, PPRI 9535e9537; EASTERN CAPE PROVINCE: Hogsback, on Stipa dregeana var. dregeana, Mar. 2007, W.M. Kriel, CS 215 (PREM 60860). Diagnosis. Macroconidia hyaline, oblong or broadly cylindric (4.3e)4.8e7.3(e11.1) (1.7e)1.9e3.9(e4.5) mm, mean 6.6 2.9 mm, mean L/W ratio from all hosts 2.3. Sclerotia variable on different hosts: on Ehrharta erecta var. erecta dark brown to almost black, up to 12 mm long and on Stipa dregeana var. dregeana sclerotia greyish brown to brown to dark brown or almost black, slightly curved to spirally coiled, up to 40 mm long. Teleomorph not observed. Cultural characteristics. Colonies relatively fast-growing (21 d, 24 C) on PDA up to 70 mm in diameter, aerial mycelium off-white, colonies irregularly raised in the centre, reverse buff, velutinous, with diffuse margin. Commentary. C. pazoutovae is phylogenetically close to the two other (but separate) clades formed by C. monticola (on B. flexum) and C. capensis (on E. villosa) respectively. Although the conidial shape is much the same as the latter two species (i.e. most commonly oblong to broadly cylindric), the conidial L/W ratio of C. pazoutovae varies between 2.0 and 2.6 (mean of 2.3), differing from C. monticola which varies between 2.3 and 2.9 (mean of 2.6 in specimens examined); these dimensions also falls outside the range of C. et al. 2015). It also differs from the conoutova purpurea (Paz idia of C. capensis (on Ehrharta villosa) which is distinctively ovoid with an L/W ratio of 1.7. The conidial shape was the same on both hosts: oblong or broadly cylindric. On Ehrharta the conidia were (4.8e)5.3e7.2(e7.7) (1.7e) 1.9e2.7(e2.9) mm, mean 5.9 2.3 mm, and L/W 2.6, while those on Stipa were (5.1e)6.0e10.1(e11.0) (2.1e) 2.8e3.2(e3.9) mm, mean 6.5 2.8 mm, and L/W 2.3. Although the conidia on Ehrharta were slightly shorter than those on Stipa, it is clearly evident from molecular data that these are the same species. Such differences in size of sclerotia and conidia had previously been described as phenoplasticity especially observed in C. purpurea from different et al. 2015). Only Langdon (1952) referred outova hosts (Paz to Claviceps on Ehrharta calycina and Ehrharta capensis, as sp. indet. Ehrharta erecta is native to a large part of eastern Africa, whereas E. calycina is native to South Africa. Both Ehrharta species have spread to various countries on all continents and often behave as strong competitors and invasive species (CABI 2015, www.cabi.org/isc, accessed 28 Aug. 2015). There are no records of ergot on these two hosts outside of South Africa. Stipa dregeana occurs only in Africa is commonly found in South Africa associated with forested mountainous areas (http://eol.org/pages/, http://redlist.sanbi.org/, accessed 22 Oct. 2015).


12

Discussion outova Most of the almost 50 species in the genus Claviceps (Paz et al. 2008a) have a defined, outova 2001; Alderman 2003; Paz narrow host range representing single plant species or several related genera. Among them some species of the Claviceps purpurea species group are unique by way of their host range. An extreme example is C. purpurea infecting various unrelated lineages of Pooideae or Claviceps humidiphila and Claviceps arundinis with hosts belonging to both to Arundinoideae and et al. 2015). The same outova Pooideae (Neg ard et al. 2015; Paz is true for Claviceps pazoutovae which was found on Ehrhartoideae as well as Pooideae. Consequently, the wide host spectrum of the whole species group includes all lineages of ergot hosts covering Arundinoideae, Chloridoideae, Cyperaceae, Ehr et al. outova hartoideae, Pooideae, and Panicoideae (Fig 1, Paz 2015). Surprisingly, all species outside of the C. purpurea species group possess a much less diverse set of hosts, infecting various lineages of Panicoideae and Chloridoideae only 2001; Lorenz et al. 2009; Paz et al. 2011). outova outova (Paz It is evident that species of the C. purpurea species group have great evolutionary adaptability and tendency for the rapid spreading and subsequent cosmopolitan distribution is seen at least in C. purpurea which is thought to be spread by humans over the world as well as Claviceps spartinae recently invading various areas of Northern America and Europe (Boestfleisch et al. 2015). With this in mind, it is important to study the diversity, host, and geographical ranges of these ergots. African grasses are often reported as invasive; in our study we identified ergot parasitizing a number of these invasive grass species. Ehrharta erecta (erect veldt grass, panic veldt grass) native to Africa has been introduced to Europe (Holverda & Denters 2006), China (Weber et al. 2008), Australia, and New Zealand. Introduced to the USA as experimental grass, it is now commonly found along California’s coastline in disturbed areas, including riparian areas, scrub, grassland, woodland, urban areas, and turf (Steers et al. 2013, http:// www.cal-ipc.org/ip/management/plant_profiles/Ehrharta_erecta.php, accessed 22 Oct. 2015). Its congeneric species, Ehrharta villosa var. villosa is endemic to SA; E. villosa var. maximensis is reported as invasive in both Australia and New Zealand (Hilton et al. 2007). Ehrharta calycina native to southern Africa has been introduced to at least 17 countries around the world (North and South America, Europe, and Australasia; Calflora 2015, http://www.calflora.org/, accessed 28 Aug. 2015) including western Australia, with most records in the Perth area (CABI 2015, http://www.cabi.org/isc, accessed 28 Aug. 2015), as well as in four other states (Blood 2001). It should be noted that E. calycina is, at least regionally, a species of greatest concern (http://wiki.bugwood.org, accessed 22 Oct. 2015). Cenchrus macrourus (African fountain grass or feather grass) is a perennial grass native to South Africa. It has been introduced to New Zealand and Australia, where it has established and is known to replace desirable stock grass with grass of low palatability in pastoral areas and has the potential to become a major weed of production forestry, roadsides, coastlines, wetlands, amenity, and urban areas in New Zealand and Australia (Global invasive species database, http://www.issg.org/database/, accessed 22 Oct. 2015). As far as the


Cyperaceae is concerned, Cyperus esculentus has a worldwide distribution and often considered a noxious weed, often associated with disturbed soils including farming activities any crop. Native to the Mediterranean, it was cultivated in ancient Egypt for its taste tubers. The only other host to Claviceps from this family now recorded from South Africa is Fimbristylis complanata; Claviceps cyperi and Claviceps fimbristylidis are phylogenetically closely related but infection of Cyperus by C. fimbristylidis was not confirmed during our study. Ergot alkaloids and their derivatives are used worldwide as therapeutic agents. The capacity for the alkaloid production differs widely within the genus in dependence to the complexness of the ergot synthesis gene cluster. Only the species from the C. purpurea group have complete gene cascade and produce the ‘high-end’ ergopeptines including pharmaceutically et al. 2008b; Lorenz et al. outova important ergotamine (Paz 2009). The new species described in our study contained alkaloids typically found in C. purpurea (Table 2) including ergopeptines and apart from the biotechnological relevance (i.e. discovery of new alkaloids) represents interesting models in the study of the alkaloid gene cluster evolution. Four of them, Claviceps capensis, C. cyperi, Claviceps macroura, and C. pazoutovae produced alkaloids in amounts ranging from 2 to 9.5 mg g1 which is comparable to the maximal values reported in the wild populations of C. purpurea sensu lato (it means C. arundinis, C. humidiphila, C. purpurea, and C. spartinae) et al. 2000; Uhlig et al. 2007). Total alkaloid content outova (Paz found in C. capensis (9.46 mg g1) even exceeds the highest value so far reported in C. purpurea s.l. (Uhlig et al. 2007). et al. (2005) studied C. cyperi sclerotia responsible for Naude the ergotism of cattle and found total alkaloid values reaching 4 mg g1 with dominance of ergocryptine. In our study, we confirmed C. cyperi as extremely potent alkaloid producer with dominance of ergocryptine in sclerotia (Table 2). The total amount produced by other species was minute. This brings to five the total number of mycotoxigenic Claviceps species in South Africa: C. capensis, C. cyperi, C. macroura, and C. purpurea. In 1993, Schneider et al. (1996) diagnosed in cattle in the Western Cape Province, after feeding barley screenings (broken and undersized barley and grass seeds) heavily contaminated with annual ryegrass (Lolium sp.) seeds and C. purpurea sclerotia. A similar syndrome in dairy cattle occurred in 1996/97 following feeding of maize silage or teff hay contaminated with Cy. escu et al. lentus containing numerous sclerotia of C. cyperi (Naude 2005). One other clavicipitaceous fungus reported to cause gangrenous ergotism in South Africa is Neotyphodium coenophialum, in an endophyte of Festuca elatior producing high levels of ergovaline (Botha et al. 2004) which, in combination with C. purpurea, caused the syndrome.

Acknowledgements Funding for this research has been provided through grants from: Czech Science Foundation (GACR, 13-00788S). European Regional Development Fund BIOCEV (CZ.1.05/1.1.00/02.0109). South African National Department of Science and Technology and the Professional Development Programme of the



Agricultural Research Council for financial support and facilities. Ms Wilmarie Kriel is acknowledged for technical assistance, photography, and field work, and Mr Riaan Stals for his assistance with species etymologies.

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2016.05.006.

references

Alderman SC, 2003. Diversity and speciation in Claviceps. In: White JF, Bacon CW, Hywel-Jones NL, Spatafora JW (eds), Clavicipitalean Fungi: evolutionary biology, chemistry, biocontrol and cultural impacts. Mycology, vol. 19. Marcel Dekker, New York, pp. 195e246. Barger G, 1931. Ergot and Ergotism. Gurney and Jackson, London. Blood K, 2001. Environmental Weeds: a field guide for SE Australia. C. H. Jerram Science Publishers, Mt. Waverley, Victoria, Australia. S, outova Boestfleisch C, Drotleff AM, Ternes W, Nehring S, Paz Papenbrock J, 2015. The invasive ergot Claviceps purpurea var. spartinae recently established in the European Wadden Sea on common cord grass is genetically homogeneous and the sclerotia contain high amounts of ergot alkaloids. European Journal of Plant Pathology 141: 445e461. TW, Moroe ML, Rottinghaus GE, 2004. GangreBotha CJ, Naude nous ergotism in cattle grazing fescue (Festuca elatior L.) in South Africa. Journal of the South African Veterinary Association 75: 45e48. Brady LR, 1962. Phylogenetic distribution of parasitism by Claviceps species. Lloydia 25: 1e36. Brewer J, Loveless AR, 1977. Ergot of Pennisetum macrourum in South Africa. Kirkia 10: 589e600. Castresana J, 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540e552. Foxcroft LC, Richardson DM, Rejmanek M, Pysek P, 2010. Alien plant invasions in tropical and sub-tropical savannas: patterns, processes and prospects. Biological Invasions 12: 3913e3933. Groves JW, 1943. A new species of Claviceps on Carex. Mycologia 35: 604e609. Hilton M, Harvey N, James K, 2007. The impact and management of exotic dune grasses near the mouth of the Murray River, South Australia. Australasian Journal of Environmental Management 14: 220e228. Holverda W, Denters T, 2006. Ehrharta erecta Lam., another cosmopolitan grass spreading in our direction? Gorteria 32: 34e36. Katoh K, Toh H, 2008. Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9: 286e298. Langdon RFN, 1952. Studies on Ergot Dissertation. University of Queensland, Brisbane, Australia. Langdon RFN, 1954. The origin and differentiation of Claviceps species. University of Queensland Papers 3: 61e68. Loveless AR, 1964a. Studies of Rhodesian ergots 1. Claviceps maximensis Theis and Claviceps pusilla Cesati. Kirkia 4: 35e40. Loveless AR, 1964b. Use of the honeydew state in the identification of ergot species. Transactions of the British Mycological Society 47: 205e213.

13

Loveless AR, 1967. A new species of Claviceps on Cyperaceae. Transactions of the British Mycological Society 50: 19e23. Loveless AR, Herd GW, 1964. Studies of Rhodesian ergots 2. A redescription of Claviceps sulcata Langdon. Kirkia 4: 41e43. S, Jung M, Tudzynski P, 2009. outova Lorenz N, Haarmann T, Paz The ergot alkaloid gene cluster: functional analyses and evolutionary aspects. Phytochemistry 70: 1822e1832. Muthusubramanian V, Bandyopadhyay R, Tooley PW, Reddy DJ, 2005. Inoculated host range and effect of host on morphology and size of macroconidia produced by Claviceps africana and Claviceps sorghi. Journal of Phytopathology 153: 1e4. TW, Botha CJ, Vorster JH, Roux C, Van der Linde EJ, Van Naude der Walt SI, Rottinghaus GE, Van Jaarsveld L, Lawrence AN, 2005. Claviceps cyperi, a new cause of severe ergotism in dairy cattle consuming maize silage and teff hay contaminated with ergotised Cyperus esculentus (nut sedge) on the Highveld of South Africa. Onderstepoort Journal of Veterinary Research 72: 23e37. Neg ard M, Uhlig S, Kauserud H, Andersen T, Høiland K, Vr alstad T, 2015. Links between genetic groups, indole alkaloid profiles and ecology within the grass-parasitic Claviceps purpurea species complex. Toxins 7: 1431e1456. O’Donnell K, 1993. Fusarium and its near relatives. In: Reynolds DR, Taylor JW (eds), The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics. CAB International, Wallingford, UK, pp. 225e233. O’Donnell K, Cigelnik E, 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetic Evolution 7: 103e116. S, Ol J, Linka M, Kolınska R, Flieger M, 2000. outova Paz sovska Chemoraces and habitat specialization of Claviceps purpurea populations. Applied and Environmental Microbiology 66: 5419e5425. S, 2001. The phylogeny and evolution of the genus outova Paz Claviceps. Mycological Research 105: 275e283. S, Frederickson DE, 2005. Genetic diversity of Claviceps outova Paz africana on sorghum and Hyparrhenia. Plant Pathology 54: 749e763. S, Kolarık M, Odvody GN, Frederickson DE, Ol J, outova Paz sovska Man P, 2008a. A new species complex including Claviceps fusiformis and Claviceps hirtella. Fungal Diversity 31: 95e110. S, Ol J, Sulc kova M, Flieger M, 2008b. outova Paz sovska M, Chudıc Claviceps nigricans and Claviceps grohii: their alkaloids and phylogenetic placement. Journal of Natural Products 71: 1085e1088. S, Odvody GN, Frederickson DE, Chudıc kova M, outova Paz J, Kolarık M, 2011. New Claviceps species from warmOl sovska season grasses. Fungal Diversity 49: 145e165. S, Pe K, Chudıc kova M, Sr outova Paz sicova utka P, Kolarık M, 2015. Delimitation of cryptic species inside Claviceps purpurea. Fungal Biology 119: 7e26. Rehner SA, Buckley E, 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84e98. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, € hna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP, 2012. Ho MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539e542. Schneider DJ, Miles CO, Garthwaite I, Van Halderen A, Wessels JC, Lategan HJ, 1996. First report of field outbreaks of ergot alkaloid toxicity in South Africa. Onderstepoort Journal of Veterinary Research 63: 97e108. Steers RJ, Fritzke SL, Rogers JJ, Cartan J, Hacker K, 2013. Invasive pine tree effects on northern coastal scrub structure and composition. Invasive Plant Science and Management 6: 231e242.


14

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725e2729. Toju H, Tanabe AS, Yamamoto S, Sato H, 2012. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PloS One 7: e40863. Uhlig S, Vikøren T, Ivanova L, Handeland K, 2007. Ergot alkaloids in Norwegian wild grasses: a mass spectrometric approach. Rapid Communications in Mass Spectrometry 21: 1651e1660.


Weber E, Sun S-G, Li B, 2008. Invasive alien plants in China: diversity and ecological insights. Biological Invasions 10: 1411e1429. Williams DG, Baruch Z, 2000. African grass invasion in the Americas: ecosystem consequences and the role of ecophysiology. Biological Invasions 2: 123e140. Yoshioka K, 2002. KyPlot: a user-oriented tool for statistical data analysis and visualization. Computational Statistics 17: 425e437.
