Leptin and Insulin Downregulate Leptin Receptor Gene Expression in Chicken-Derived Leghorn Male Hepatoma Cells S. Cassy,*,1 M. Derouet,* S. Crochet,* S. Dridi,† and M. Taouis‡ *Institut National de la Recherche Agronomique, Station de Recherches Avicoles, 37380 Nouzilly, France; †Unite´ de Recherche Micronutriments, Reproduction, Sante´ ENITAB, 33170 Gradignan, France; and ‡Institut National de la recherche Agronomique, Laboratoire de Biologie Cellulaire et Mole´culaire, 78300 Jouy-En-Josas, France ABSTRACT In chickens, leptin is expressed mainly in the liver, where its receptor gene expression has also been reported, and in adipose tissue. In view of the key role played by the liver in lipogenesis in avian species, the hepatic expression of leptin may have physiological significance. In this study, we showed that leptin is constitutively expressed and secreted in a chicken-derived hepatoma cell line (LMH). Although insulin regulates leptin expression in vivo, incubation of LMH cells in the presence of 100 nM insulin for 24 or 48 h had no effect on leptin expression or its secretion in the culture medium. In
addition, we developed a specific chicken leptin receptor real-time reverse transcription (RT)-PCR, and downregulation of leptin receptor gene expression by homologous and heterologous signals was demonstrated, as relative leptin receptor mRNA levels were significantly decreased after exposure of LMH cells to recombinant chicken leptin or porcine insulin. In conclusion, our results indicate that leptin is probably able to desensitize its own response in the chicken liver. Finally, the ability of insulin and leptin to regulate chicken leptin receptor gene expression suggests a direct role of leptin in the control of hepatic metabolism.
(Key words: chicken, leptin, leptin receptor, real-time reverse transcription-PCR) 2003 Poultry Science 82:1573–1579
INTRODUCTION Leptin, the product of the obese (ob) gene, is a 16-kDa hormone that has been shown to play an important role in the regulation of food intake, energy expenditure, and hypothalamus endocrine function in response to nutritional changes (Friedman and Halaas, 1998; Elmquist et al., 1999). In mammals leptin is expressed primarily in adipose tissue (Zhang et al., 1994) and at a lower level in the placenta and stomach (Masuzaki et al., 1997; Bado et al., 1998). Leptin has also been identified in chickens and turkeys, and its expression is not restricted to adipose tissue but is also expressed in the liver (Taouis et al., 1998; Ashwell et al., 1999). In vivo study of hormonal regulation of leptin expression has revealed that chicken hepatic leptin expression is increased by insulin and dexamethasone and decreased by glucagon and estrogen (Ashwell et al., 1999). The effects of leptin on reducing feed intake in chickens has been demonstrated by intraperitoneal injection of recombinant chicken leptin (Dridi et al., 2000a) and confirmed by intracerebroventricular administration
2003 Poultry Science Association, Inc. Received for publication February 27, 2003. Accepted for publication May 16, 2003. 1 To whom correspondence should be addressed:
[email protected].
of mouse leptin (Denbow et al., 2000). Molecular cloning of the chicken leptin receptor has recently been reported. Its messenger RNA is mainly located in the brain and ovaries and to a lesser extent in the liver, kidneys, and intestine (Horev et al., 2000; Ohkubo et al., 2000). The peripheral action of leptin in the chicken is poorly documented except in the pancreas, where it has recently been demonstrated that leptin has a profound inhibitory influence upon insulin secretion in the perfused chicken pancreas (Benomar et al., 2003). In the mammalian liver, leptin has direct effects on the regulation of carbohydrate and lipid metabolism (Cohen et al., 1998). The role of leptin in the liver has not yet been determined in avian species, but the central role played by the liver in lipid metabolism in this species suggests that leptin may be associated with a role in controlling lipogenesis. Kawaguchi et al. (1987) have isolated and characterized a chicken hepatoma cell line (LMH cells). These cells overexpress insulin receptors compared with chicken liver and primary chicken hepatocytes (Taouis et al., 1993, 1994). This overexpression is accompanied by high sensitivity in terms of insulin signaling and amino-acid trans-
Abbreviation Key: ACTH = adrenocorticotropin hormone; Ct = threshold cycle; IGF = insulin-like growth factor; LMH = Leghorn male hepatoma; RT = reverse transcription; T3 = triiodothyronine.
1573
1574
CASSY ET AL.
port (Taouis et al., 1993). These properties of LMH cells are probably the consequence of their tumor transformation. The present study was designed to assess the direct effects of insulin on leptin secretion and to investigate hormonal regulation of the expression of the leptin receptor gene in the highly insulin-sensitive LMH cells.
TOPO 2.1 cloning kit.7 The cloned fragments were sequenced automatically with an ABI automated Sequencer.10
MATERIALS AND METHODS
For leptin receptor real-time PCR, primers were chosen from two different exons using Primer Express Software10 (Rec3, Table 1). To achieve the calibration curves, the RTPCR product obtained with Rec 3 primers was cloned using the pCR TOPO 2.1 cloning kit.7 Linear doublestranded recombinant DNA (receptor DNA) was quantified by densitometry or estimated on ethidium bromide stained agarose gels. Ten-fold serial dilutions of recombinant leptin receptor cDNA [from 105 single stranded (ss) molecules/µL down to 3′), PCR product length of the chicken leptin and its receptor Primer
Sequence
Position and length
Lep1 F Lep1 R
GCAGTGCCGTGCCAGATCTTCCAG TCAGCATTCCGGGCTAAT
52–492 441 bp
Lep2 F Lep2 R Lep3 F Lep3 R Rec1 F Rec1 R Rec2 F Rec2 R
CGTCGGTATCCGCCAAGCAGAGGG CCAGGACGCCATCCAGGCTCTCTGGC ACACGTCGGTATCCGCCAAG AGCAGATGGAGGAGGTCTCG GTCCACGAGATTCATCCCAG CCTGAGATGCAGAGATGCTC GCTTGCTCAGGTAGCTCCTG TGCGGCACGTATGGCACGAT
134–394 261 bp 131–320 190 bp 257–527 271 bp 3,221–3,579 359 bp
Rec3 F Rec3 R
GCATCTCTGCATCTCAGGAAAGA GCAGGCTACAAACTAACAAATCCA
362–448 87 bp
1% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, aprotinin (15 trypsin inhibitor units/mL), 0.1 mM antipain, and 5 mg/mL leupeptin. Leptin was immunoprecipitated from 600 µg LMH protein with 40 µg of rabbit recombinant chicken leptin antiserum (Dridi et al., 2000b). Immune complexes were precipitated with protein Aagarose,4 and the pellets were washed three times with lysis buffer. After the last wash, the samples were subjected to Western blot analysis. After SDS-PAGE, proteins were transferred onto a nitrocellulose membrane. Leptin was detected by sequential incubation with rabbit recombinant chicken leptin antiserum (1 µg/mL) and goat horseradish peroxidase-linked anti-rabbit γ-globulin. Membranes were washed, and signals were detected by chemiluminescence. Recombinant chicken leptin (100 ng) was also subjected to Western blot analysis and used as a control.
Chicken Leptin-Specific Radioimmunoassay Secretion of leptin in culture medium was determined by chicken leptin-specific RIA as previously described (Dridi et al., 2000b).
Statistical Analysis
quence (Taouis et al., 1998) (GenBank Accession Number AF012727) (Table 1). As shown in Figure 1, a single band identical in size to the expected fragment was amplified from each pair of primers. The fragments were cloned and sequenced. The sequences obtained were 100% identical to those previously described by Ashwell (1999) for hepatic and adipose tissue chicken leptin cDNA. The presence of leptin in LMH cell lysates was demonstrated by immunoprecipitation with rabbit recombinant chicken leptin antiserum and immunoblotting with the same antiserum. As depicted in Figure 2, a single band was revealed in LMH cells deprived of serum or treated with 100 nM of insulin for 24 h. This band exhibited an apparent molecular weight of approximately 16 kDa, corresponding to the molecular weight of recombinant chicken leptin (Raver et al., 1998). Insulin did not induce significant changes in leptin expression. A chicken leptinspecific RIA was used in order to determine whether the leptin expressed was released in cell culture medium. After 24 h of culture in serum-free medium or in the presence of insulin, the level of leptin in the culture medium was estimated at 0.58 ± 0.10 ng leptin/mg of total cellular proteins and increased to 0.89 ± 0.04 ng leptin/ mg of total cellular proteins after 48 h of culture. Insulin did not affect leptin secretion in the medium during either period (Figure 3).
Statistical analysis was carried out using ANOVA followed by Newman-Keuls test for multiple means comparison.11 Results are expressed as means ± SEM and considered significantly different at P < 0.05.
RESULTS Expression of the Chicken Leptin Gene In order to analyze the expression of the chicken leptin gene in LMH cells by RT-PCR, three pairs of primers (Lep1, Lep2, Lep3) were chosen from the published se-
11
StatView, version 5.0, SAS Institute Inc., Cary, NC.
FIGURE 1. Amplification of leptin mRNA by PCR in Leghorn male hepatoma (LMH) cells using three pairs of primers (Lep1, Lep2, and Lep3). Sizes of the amplified DNA fragments and those of the standard molecular weight (MW) are given on the left and right, respectively.
1576
CASSY ET AL.
FIGURE 2. Immunoprecipitation and Western blot analysis of chicken leptin in Leghorn male hepatoma (LMH) cell lysates. LMH cells were incubated in serum-free medium (SF) with or without insulin (Ins) for 24 h. After cell lysis and immunoprecipation with chicken leptin antiserum, immunoprecipitates were subjected to SDS-PAGE and Western blotting with chicken leptin antiserum. The size of the detected band is indicated in the left margin.
Expression and Hormonal Regulation of Expression of Leptin Receptor mRNA The RT-PCR performed with two different pairs of primers (Rec1 and Rec2) located in the sequences coding for the extracellular domain and cytoplasmic region of the receptor, respectively, demonstrated that at least the long form of leptin receptor mRNA was expressed in LMH cells (Figure 4). Subsequent sequencing of the amplified fragments revealed that the sequences were identical to those previously described (Horev et al., 2000; Ohkubo et al., 2000). Because it was not possible to detect leptin receptor protein by Western blot analysis with heterologous leptin receptor antibody (data not shown), a quantitative realtime RT-PCR was developed and used to evaluate the hormonal regulation of the expression of the leptin receptor. Specificity of the desired product was demonstrated with melting curve analysis and gel electrophoresis (Figure 5C). The melting temperature of the 87-bp leptin receptor fragment was 76.4°C (Figure 5D). The real-time
FIGURE 3. Secretion of leptin in the culture medium. Leghorn male hepatoma (LMH) cells were incubated in serum-free medium (SF) with or without insulin (Ins) for 24 or 48 h. Leptin secreted in the medium was measured using a chicken leptin-specific radioimmunoassay. Results are expressed as mean ± SEM (n = 6).
FIGURE 4. Amplification of leptin receptor mRNA in Leghorn male hepatoma (LMH) cells by PCR using two pairs of primers (Rec1 and Rec2). Sizes of the amplified DNA fragments and those of the standard molecular weight (MW) are given on the left and right, respectively.
amplified RT-PCR product was sequenced and showed 100% homology to the chicken leptin receptor. Real-time PCR efficiency (E) in the exponential phase was calculated by performing calibration curves (Figures 5A,B). According to the equation E = 10[−1/slope] (Pfaffl, 2001), mean PCR efficiency (n = 3) was equal to 1.90. To confirm the precision and reproducibility of real-time PCR, intra and interassay variations were evaluated and found to be 0.84 and 1.83%, respectively. The expression of leptin receptor mRNA was measured in cells treated for 24 h with insulin, dexamethasone, or
FIGURE 5. Real-time PCR for chicken leptin receptor cDNA. (A) Triplicate amplification plots of 10-fold serial dilutions of recombinant chicken leptin receptor cDNA [from 5 × 105 down to five single-stranded (ss) cDNA molecules]. The horizontal line in the amplification plots represents the threshold selected in the linear region of the plot above the baseline noise. (B) Standard curve; Ct = threshold cycle. (C) Agarose (2.5%) gel electrophoresis of real-time reverse transcription (RT)-PCR products derived from recombinant DNA (receptor DNA) and Leghorn male hepatoma (LMH) cell total RNA. M = molecular weight marker (200, 400, 600, 800, and 1,000 bp). (D) Dissociation curve, the vertical line determines the melting temperature of the real-time RT-PCR product at 76.4°C.
LEPTIN AND ITS RECEPTOR IN LMH CELLS
FIGURE 6. Hormonal regulation of expression of leptin receptor mRNA evaluated by real-time reverse transcription (RT)-PCR and normalized with 18S ribosomal RNA. Leghorn male hepatoma (LMH) cells were cultured for 24 h in serum-free (SF) medium and then treated for 24 h with 100 nM insulin (Ins), 100 nM chicken leptin (Lep), 100 nM dexamethasone (Dexa), or 50 nM triiodothyronine (T3). Results are expressed as mean ± SEM (n = 6); *P < 0.05.
T3. Leptin receptor mRNA expression levels were normalized with 18S ribosomal RNA. Figure 6 shows that insulin and recombinant chicken leptin induced a significant decrease in expression of leptin receptor mRNA, whereas dexamethasone and T3 had no effect. The effects of insulin and leptin on leptin receptor expression were not significantly different.
DISCUSSION We have shown in the present study that leptin and its receptor mRNA are expressed in a chicken hepatoma cell line, i.e., LMH cells. Moreover, we demonstrated that leptin is expressed and secreted by these cells. Leptin expression by LMH cells confirms previous findings showing the expression of leptin in the chicken liver and hypothesizing that such expression may be related to the key role played by the liver in lipid metabolism and lipogenesis in avian species (Simon et al., 1991; Taouis et al., 1993). To our knowledge, the hepatic expression of leptin has not previously been described in mammals, and results obtained in vitro published to date have concerned the expression and secretion of leptin by 3T3 L1 adipocytes and other mammalian primary cultured adipocytes (MacDougald et al., 1995). In contrast to mammalian cellular models, the expression and secretion of leptin by LMH cells are not regulated by insulin. These findings contrast with results obtained in vivo following 4 d of treatment with porcine insulin that led to upregulation of liver leptin expression (Ashwell et al., 1999; Richards et al., 1999). The effect of insulin on leptin expression in mammals is still a matter of controversy. Some authors have shown a direct effect of insulin on leptin expression (Gettys et al., 1996; Russell et al., 1998), whereas others
1577
have reported no effect of insulin (Halleux et al., 1998; Bradley and Cheatham, 1999). It has been reported in mammals that an increase in plasma leptin levels was only evident with prolonged hyperinsulinemia (Boden et al., 1997), whereas acute hyperinsulinemia had no effect (Dagogo-Jack et al., 1996; Pratley et al., 1996). To our knowledge an acute effect has not yet been reported in the chicken, and it is possible that the in vivo regulation of leptin secretion by insulin may require other hormonal factors. However, despite the fact that LMH cells express insulin receptors and are highly sensitive to insulin for amino acid uptake (Taouis et al., 1993, 1995), the phenomenon of absence of effect of insulin on LMH cells has also been observed on insulin-like growth factor (IGF)binding protein secretion. LMH cells secrete an IGF-binding protein in the culture medium, but its secretion is not influenced by any of the potential regulators of IGFbinding protein secretion (including insulin) that have been characterized in primary hepatocyte culture or in hepatoma cell lines from different species including chickens (Lewitt and Baxter, 1991; Duclos et al., 1994). In a different context, a similar absence of sensitivity of LMH cells compared with primary hepatocyte culture has been demonstrated for fibronectin. LMH cells constitutively secreted high levels of fibronectin and failed to differentiate the presence of fibronectin enhancing factor (Lynagh et al., 2000). The events involved in the regulation of biological actions of many hormones (including leptin) in target tissue probably include regulation of their receptors. With specific leptin receptor real-time RT-PCR, we demonstrated in this study that insulin and leptin were able to downregulate the expression of chicken leptin receptor mRNA. Downregulation of leptin receptor by homologous and heterologous signals has previously been demonstrated. Rat testis exposure to human recombinant leptin in vitro and stimulation with human chorionic gonadotropin (hCG) and folliculo-stimulating hormone (FSH) in vitro downregulate the leptin receptor similarly to treatment of the adrenal gland with human recombinant leptin and adrenocorticotropin hormone (ACTH) (Tena-Sempere et al., 2000, 2001). It has been proposed that in this way gonadotropins regulate leptin action in the control of testicular steroidogenesis, and ACTH, the major corticosterone stimulator, limits leptin-induced inhibition of corticosterone secretion. Insulin and leptin have opposite effects on lipogenesis in mammals, with insulin activating and leptin inhibiting lipogenesis (Kersten, 2001). The involvement of insulin in the stimulation of lipogenesis in chickens has also been fully documented (Simon, 1989), but the direct role of leptin in the regulation of lipogenesis has not been reported to date. However it is tempting to propose that insulin counteracts the action of leptin in the liver by at least partially downregulating the leptin receptor. This report is the first, to our knowledge, to demonstrate downregulation of the leptin receptor by its own ligand in the chicken. A ligand-induced decrease in the number of cell surface receptors has been proposed as a
1578
CASSY ET AL.
mechanism whereby leptin desensitizes its own response in mammals (Barr et al., 1999; Uotani et al., 1999). This desensitization of the leptin receptor may involve a ligand-induced leptin internalization mechanism and also downregulation by leptin of its own receptor mRNA level (Tena-Sempere et al., 2000). Such a mechanism has also been proposed for the desensitization of other receptors such as the gonadotropin receptor (Tena-Sempere and Huhtaniemi, 1999). In conclusion, LMH cells express leptin and the long form of the leptin receptor. We demonstrated using realtime RT-PCR that leptin and insulin downregulate the expression of leptin receptor mRNA. These results suggest that insulin may counteract leptin action at the hepatic level by repressing expression of the leptin receptor. The mechanisms underlying this downregulation require further investigation. Finally, we demonstrated that, as in mammals, chicken leptin is probably able to desensitize its own response by decreasing expression of its receptor mRNA.
ACKNOWLEDGMENTS Recombinant chicken leptin was a generous gift of Arieh Gertler (Hebrew University, Rehovot, Israel).
REFERENCES Ashwell, C. M., S. M. Czerwinski, D. M. Brocht, and J. P. McMurtry. 1999. Hormonal regulation of leptin expression in broiler chickens. Am. J. Physiol. 276:R226–232. Bado, A., S. Levasseur, S. Attoub, S. Kermorgant, J. P. Laigneau, M. N. Bortoluzzi, L. Moizo, T. Lehy, M. Guerre-Millo, Y. Le Marchand-Brustel, and M. J. Lewin. 1998. The stomach is a source of leptin. Nature 394:790–793. Barr, V. A., K. Lane, and S. I. Taylor. 1999. Subcellular localization and internalization of the four human leptin receptor isoforms. J. Biol. Chem. 274:21416–21424. Benomar, Y., N. Rideau, S. Crochet, M. Derouet, and M. Taouis. 2003. Leptin fully suppresses acetylcholine-induced insulin secretion and is reversed by tolbutamide in isolated perfused chicken pancreas. Horm. Metab. Res. 35:81–85. Boden, G., X. Chen, J. W. Kolaczynski, and M. Polansky. 1997. Effects of prolonged hyperinsulinemia on serum leptin in normal human subjects. J. Clin. Invest. 100:1107–1113. Bradley, R. L., and B. Cheatham. 1999. Regulation of ob gene expression and leptin secretion by insulin and dexamethasone in rat adipocytes. Diabetes 48:272–278. Cohen, S. M., J. G. Werrmann, and M. R. Tota. 1998. 13C NMR study of the effects of leptin treatment on kinetics of hepatic intermediary metabolism. Proc. Natl. Acad. Sci. USA 95:7385–7390. Dagogo-Jack, S., C. Fanelli, D. Paramore, J. Brothers, and M. Landt. 1996. Plasma leptin and insulin relationships in obese and nonobese humans. Diabetes 45:696–698. Denbow, D. M., S. Meade, A. Robertson, J. P. McMurtry, M. Richards, and C. Ashwell. 2000. Leptin-induced decrease in food intake in chickens. Physiol. Behav. 69:359–362. Dridi, S., N. Raver, E. E. Gussakovsky, M. Derouet, M. Picard, A. Gertler, and M. Taouis. 2000a. Biological activities of recombinant chicken leptin C4S analog compared with unmodified leptins. Am. J. Physiol. Endocrinol. Metab. 279:E116– 123. Dridi, S., J. Williams, V. Bruggema, M. Onagbesan, N. Raver, E. Decuypere, J. Djiane, A. Gertler, and M. Taouis. 2000b. A
chicken leptin-specific radioimmunoassay. Domest. Anim. Endocrinol. 18:325–335. Duclos, M. J., B. Chevalier, and J. Simon. 1994. Preferential binding of insulin-like growth factors to a binding protein rather than to receptors on chicken hepatoma cell (LMH) membranes. Growth Regul. 4:155–163. Elmquist, J. K., C. F. Elias, and C. B. Saper. 1999. From lesions to leptin: hypothalamic control of food intake and body weight. Neuron 22:221–232. Friedman, J. M., and J. L. Halaas. 1998. Leptin and the regulation of body weight in mammals. Nature 395:763–770. Gettys, T. W., P. J. Harkness, and P. M. Watson. 1996. The beta 3-adrenergic receptor inhibits insulin-stimulated leptin secretion from isolated rat adipocytes. Endocrinology 137:4054–4057. Halleux, C. M., I. Servais, B. A. Reul, R. Detry, and S. M. Brichard. 1998. Multihormonal control of ob gene expression and leptin secretion from cultured human visceral adipose tissue: increased responsiveness to glucocorticoids in obesity. J. Clin. Endocrinol. Metab. 83:902–910. Horev, G., P. Einat, T. Aharoni, Y. Eshdat, and M. FriedmanEinat. 2000. Molecular cloning and properties of the chicken leptin-receptor (CLEPR) gene. Mol. Cell. Endocrinol. 162:95–106. Kawaguchi, T., K. Nomura, Y. Hirayama, and T. Kitagawa. 1987. Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer Res. 47:4460–4464. Kersten, S. 2001. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2:282–286. Lewitt, M. S., and R. C. Baxter. 1991. Insulin-like growth factorbinding protein-1: A role in glucose counterregulation? Mol. Cell. Endocrinol. 79:C147–152. Lynagh, G. R., R. A. Collins, and P. Kaiser. 2000. Development and use of monoclonal antibodies to chicken fibronectin to show that the chicken hepatocellular carcinoma cell line, LMH, constitutively expresses fibronectin. Res. Vet. Sci. 68:147–152. MacDougald, O. A., C. S. Hwang, H. Fan, and M. D. Lane. 1995. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes. Proc. Natl. Acad. Sci. USA 92:9034–9037. Masuzaki, H., Y. Ogawa, N. Sagawa, K. Hosoda, T. Matsumoto, H. Mise, H. Nishimura, Y. Yoshimasa, I. Tanaka, T. Mori, and K. Nakao. 1997. Nonadipose tissue production of leptin: Leptin as a novel placenta-derived hormone in humans. Nat. Med. 3:1029–1033. Ohkubo, T., M. Tanaka, and K. Nakashima. 2000. Structure and tissue distribution of chicken leptin receptor (cOb-R) mRNA. Biochim. Biophys. Acta 1491:303–308. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:E45– E45. Pratley, R. E., M. Nicolson, C. Bogardus, and E. Ravussin. 1996. Effects of acute hyperinsulinemia on plasma leptin concentrations in insulin-sensitive and insulin-resistant Pima Indians. J. Clin. Endocrinol. Metab. 81:4418–4421. Raver, N., M. Taouis, S. Dridi, M. Derouet, J. Simon, B. Robinzon, J. Djiane, and A. Gertler. 1998. Large-scale preparation of biologically active recombinant chicken obese protein (leptin). Protein Expr. Purif. 14:403–408. Richards, M. P., C. M. Ashwell, and J. P. McMurtry. 1999. Analysis of leptin gene expression in chickens using reverse transcription polymerase chain reaction and capillary electrophoresis with laser-induced fluorescence detection. J. Chromatogr. A 853:321–335. Russell, C. D., R. N. Petersen, S. P. Rao, M. R. Ricci, A. Prasad, Y. Zhang, R. E. Brolin, and S. K. Fried. 1998. Leptin expression in adipose tissue from obese humans: depot-specific regulation by insulin and dexamethasone. Am. J. Physiol. 275:E507–515.
LEPTIN AND ITS RECEPTOR IN LMH CELLS Simon, J. 1989. Chicken as a useful species for the comprehension of insulin action. Crit. Rev. Poult. Biol. 2:121–148. Simon, J., B. Chevalier, M. Derouet, and B. Leclercq. 1991. Normal number and kinase activity of insulin receptors in liver of genetically fat chickens. J. Nutr. 121:379–385. Taouis, M., J. W. Chen, C. Daviaud, J. Dupont, M. Derouet, and J. Simon. 1998. Cloning the chicken leptin gene. Gene 208:239–242. Taouis, M., M. Derouet, J. P. Caffin, A. Chavanieu, and J. Simon. 1993. Insulin receptor and insulin sensitivity in a chicken hepatoma cell line. Mol. Cell. Endocrinol. 96:113–123. Taouis, M., M. Derouet, J. P. Caffin, and J. Simon. 1994. Increased insulin receptor number and insulin responsiveness in a chicken hepatoma cell line. J. Endocrinol. 140:119–124. Taouis, M., D. Deville de Periere, D. Hillaire-Buys, M. Derouet, R. Gross, J. Simon, and G. Ribes. 1995. Biological activity of immunoreactive insulin-like activity extracted from rat submandibular gland. Am. J. Physiol. 269:E277–282.
1579
Tena-Sempere, M., and I. Huhtaniemi. 1999. Gonadotropin receptors. Pages 165–200 in Molecular Biology in Reproductive Medecine. B. Fauser, A. Rutherford, J. Strauss, and A. Van Steirteghem, ed. Parthenon Publishing, New York. Tena-Sempere, M., L. Pinilla, L. C. Gonzalez, F. F. Casanueva, C. Dieguez, and E. Aguilar. 2000. Homologous and heterologous down-regulation of leptin receptor messenger ribonucleic acid in rat adrenal gland. J. Endocrinol. 167:479–486. Tena-Sempere, M., L. Pinilla, F. P. Zhang, L. C. Gonzalez, I. Huhtaniemi, F. F. Casanuea, C. Dieguez, and E. Aguilar. 2001. Developmental and hormonal regulation of leptin receptor (Ob-R) messenger ribonucleic acid expression in rat testis. Biol. Reprod. 64:634–643. Uotani, S., C. Bjorbaek, J. Tornoe, and J. S. Flier. 1999. Functional properties of leptin receptor isoforms: internalization and degradation of leptin and ligand-induced receptor downregulation. Diabetes 48:279–286. Zhang, Y., R. Proenca, M. Maffei, M. Barone, L. Leopold, and J. M. Friedman. 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432.
