ANIMAL BIOTECHNOLOGY 2017, VOL. 28, NO. 4, 248–252 http://dx.doi.org/10.1080/10495398.2016.1268620
EvaGreen-based Multiplex Real-time PCR Assay for Rapid Differentiation of Wild-Type and Glycoprotein E-Deleted Bovine Herpesvirus-1 Strains Sachin S. Pawara
, Chetan D. Meshrama, Niraj K. Singhb, Mohini Sainic, B. P. Mishraa and Praveen K. Guptaa
a
Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar, India; bSchool of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India; cDivision of Biochemistry, Indian Veterinary Research Institute, Izatnagar, India ABSTRACT
KEYWORDS
Bovine herpesvirus-1 (BoHV-1) is an important viral pathogen causing significant economic losses to the cattle industry. Glycoprotein E-deleted marker vaccines form the basis for BoHV-1 control programs widely, wherein detection and differentiation of wild-type and gE-deleted vaccine strains is of crucial importance for proper disease management. In the present study, we report an EvaGreen-based multiplex real-time polymerase chain reaction (EGRT-PCR) assay for rapid differentiation of wild-type and glycoprotein E-deleted strains of BoHV-1. The EGRT-PCR assay could simultaneously detect two viral genes (glycoprotein B and E) and an internal positive control gene (bovine growth hormone- bGH), in a single-tube reaction. The analytical sensitivity of the EGRT-PCR assay was as little as 10 copies of the BoHV-1 DNA per reaction. The modified real-time PCR assay could successfully differentiate wild-type and gE-deleted BoHV-1 strains based on gene specific melting temperatures (Tm) peaks. Our results have shown that the EGRT-PCR developed in this study might prove to be a promising tool in disease management by enabling rapid differentiation of wild-type and gE-deleted strains of BoHV-1.
Bovine herpesvirus-1; differentiation; EvaGreen; wild-type
Bovine herpesvirus-1 (BoHV-1) is an economically important viral pathogen affecting domestic and wild cattle. BoHV-1 infection is distributed worldwide causing different syndromes such as infectious bovine rhinotracheitis (IBR), and infectious pustular vulvovaginitis (IPV) in cows and infectious balanoposthitis (IBP) in bulls (1, 2). BoHV-1 eradication in several European countries has been attributed to the use of gE-deleted marker vaccines enabling differentiation of naturally infected from vaccinated cattle and many countries are implementing BoHV-1 control programs based on gE-deleted marker vaccines (2, 3). The gE-deleted BoHV-1 strains have the ability to establish latency and can reactivate from latency and re-excrete similar to wild-type BoHV-1 (4). Hence, it is essential to monitor the re-excretion and spread of live gE-deleted virus in the field, especially for the diseased cattle succumbed to the disease. For determining the cause of disease and implementing protective measures against wild-type BoHV-1 infection, it is crucial to have a diagnostic method for rapid differentiation of vaccinated or reactivated marker vaccine virus from infection with a BoHV-1 field virus (5). Conventional PCR and probe based real-time PCR assays for the differentiation of wild-type and
gE-deleted BoHV-1 has been reported earlier (5–7). However, conventional PCR assays suffers from low sensitivities and probe based real-time assays are expensive, time-consuming, and have high potential false-negative rates attributed to sequence variability within probe-binding site (8, 9). On the contrary, EvaGreen, a double stranded DNA (dsDNA) binding dye, is simple, less costly and yield results comparable to that of TaqMan probe. In addition, EvaGreen dye is less inhibitory for PCR amplification, less likely to cause nonspecific amplification and is more suitable for multiplex real-time PCR assays as compared to commonly used SYBR Green I dye (8–11). In this study, we report the application of an EvaGreen based multiplex real-time PCR assay for rapid differentiation of wild-type from gE-deleted BoHV-1 strains. The Indian isolate of BoHV-1 (isolate No. 216) previously characterized (12, 13) and gE-deleted BoHV-1 (partial gE deletion) constructed in our laboratory (data not published), were used as reference wild-type and reference marker vaccine virus (14), respectively. The Madin Darby bovine kidney (MDBK) cell line used to bulk propagate both the BoHV-1 strains was procured from National Centre for Cell Science (NCCS), Pune, India. For evaluating the assay, semen
CONTACT Sachin S. Pawar
[email protected] ICAR-National Institute of Abiotic Stress Management, Malegaon, Baramati 413115 Pune, Maharashtra, India. Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/labt. © 2017 Taylor & Francis
ANIMAL BIOTECHNOLOGY
samples (n ¼ 15) from breeding bulls (not vaccinated earlier) were collected randomly from different breeding bull stations and confirmed as BoHV-1 positive using the TaqMan probe based real-time PCR reported earlier (2). All animals used in this study were handled during semen sampling according to the International Guiding Principles. Total genomic DNA was extracted from BoHV-1 infected cell culture supernatants and bovine semen using the QIAamp DNA Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s protocol. Primers were designed for amplifying conserved regions of BoHV-1, gB and gE genes, and the bovine growth hormone (bGH) gene as an internal positive control (IPC) (Table 1). For simultaneous detection of the all three targets in a single-tube, a multiplex real-time PCR assay was optimized using SsoFast EvaGreen Supermix (Biorad Laboratories, USA). The optimum concentration of the reaction components was optimized for highest fluorescence intensity (dRn) and lowest cycle threshold (CT) for target genes detection including IPC. All the optimization experiments were performed using the Mx3005P QPCR system (Agilent Technologies, USA). The assay was performed in 20 µL reaction volume and the optimized reaction mixture consisted of the following components: 2x Sso Fast EvaGreen Supermix, 2.5 pmol of each primer (gB F/R, gE F/R and bGH F/R) and 1 µL of template DNA. Amplification condition constituted of, initial denaturing step at 98°C for 2 minutes followed by 40 cycles of 5 seconds at 98°C and 20 seconds at 60°C. At the end of each reaction, melt curve analysis (MCA) was performed by single cycle of denaturation at 95°C for 1 minute, annealing at 60°C for 30 seconds followed by increase in temperature to 95°C at the rate of 0.2°C/s. The results were analyzed using melting curve analysis tools of the MxPro qPCR software Version 4.10 (Agilent, USA). To construct the gB and gE plasmid standards for generating standard curve, the PCR amplified products from BoHV-1 gB and gE genes were cloned separately into the pJET1.2 vector using CloneJET PCR Cloning
Table 1.
b
Kit (ThermoFisher Scientific, USA) according to the manufacturer’s instructions. The recombinant plasmids were linearized with HindIII and plasmid copy numbers were determined as described earlier (15). The plasmid standards were used to generate standard curve to determine analytical sensitivity and amplification efficiency. The analytical sensitivity was determined by limiting dilution assay using ten-fold serially diluted plasmid standards (108 to 100 copies/ reaction), wherein the sensitivity was defined as the lowest dilution of plasmid standard that could be amplified in real-time PCR reaction. The assay could detect as little as 10 copies of BoHV-1 gB and gE genes, respectively. The standard curve for BoHV-1 gene targets demonstrated linear regression relationship with coefficient of determination (R2) of 0.997 and a slope of y ¼ 3.292x þ 38.6 corresponding to the amplification efficiency of 101.3% for gB gene (Fig. 1a) and (R2) of 0.997, slope of y ¼ 3.712x þ 36.12 and amplification efficiency of 86% for gE gene (Fig. 1b); indicating optimum PCR efficiency with good correlation between CT values and template concentrations. The specificity of the assay was established by performing melt curve analysis of the real-time PCR amplified products (Fig. 2). The specificity was also evaluated by testing DNA extracted from bovine kidney cells and bovine semen to detect any nonspecific amplification. There was no amplification when total genomic DNA isolated from bovine kidney cells (MDBK) and bovine semen were used as negative controls indicating the specificity of the developed assay. The practical applicability of the developed EGRTPCR assay was evaluated by testing BoHV-1 positive bovine semen samples (n ¼ 15) and BoHV-1 negative semen samples (n ¼ 15) that were spiked with gEdeleted marker vaccine virus (20 TCID50/per tube). The assay was carried out using gB F/R primer pair and TaqMan probe (Table 1). The thermal conditions used were: initial denaturation at 95°C for 2 minutes and 45 cycles of 95°C for 15 seconds and 60°C for 45 seconds. TaqMan probe based real-time PCR assay
Details of the primers used in this study.
Method
Primer name
EvaGreen real-time PCR
gB-F gB-R gE-F gE-R bGH-F bGH-R gBF gBR Probe
TaqMan real-time PCR
a
249
Genomic position
Sequence (5′-3′)
Length (bp)
56230 to 56249a 56312 to 56331a 122072 to 122089a 122222 to 122239a 1124–1144b 1238–1258b 57499–57519a 57595–57575a 57525–57545a
TGTGAACTGCATCGTGGAAG CCGTAAAAGGGCGACATGTA ACTCAACGGGCGACAAAG CCAACTGCGTCTCCTCGT AAGAGTTTGTAAGCTCCCGAG CCCTAACCACATCCCTACTTG TGTGGACCTAAACCTCACGGT GTAGTCGAGCAGACCCGTGTC FAM-AGGACCGCGAGTTCTTGCCGC-TAMRA
20 20 18 18 21 21 21 21 21
BoHV-1glycoprotein B and E genes, genomic position derived from BoHV type 1.1 (accession number AJ004801.1). Bovine growth hormone gene (bGH), genomic position derived from Bos Taurus (accession number M57764.1).
250
S. S. PAWAR ET AL.
Figure 1. Standard curve generated from the cycle threshold (CT) values obtained against the serially diluted plasmid standards (copy number) and the coefficient of determination (R2) along with the equation of regression curve (Y) were calculated. (a) Standard curve for gB gene; (b) standard curve for gE gene.
recommended by OIE as a prescribed test for International trade (2) was taken as gold standard test and employed on all the samples to confirm BoHV-1. The results were analyzed using MxPro qPCR software Version 4.10 (Stratagene, USA). When wild-type BoHV-1 DNA was used as template, three melting (Tm) curve peaks were obtained after MCA. The Tm curve peaks for BoHV-1 gB and gE genes were observed at 86.16 � 0.20 and 93.1 � 0.26°C, respectively while, the Tm curve peak for IPC was distinctly observed at 82.98 � 0.25°C (Fig. 2a); indicating successful amplification of all the three targets simultaneously in a single tube. With gE-deleted virus DNA, only two Tm curve peaks were obtained at 86.16 � 0.2°C and 82.98 � 0.25°C corresponding to gB gene and IPC, respectively (Fig. 2b). The absence of Tm peak for BoHV-1 gE indicated the absence of gE gene confirmed the virus as gE-deleted BoHV-1 strain. The virus could be detected and differentiated in all the samples by EGRT-PCR indicating good correlation of the
developed assay with TaqMan probe based real-time PCR assay. The ability of gE-deleted BoHV-1 to establish latency and reactivate from latency makes it essential to monitor the re-excretion and spread of live gE-deleted virus. It is always desired to have a rapid diagnostic method for differentiation of vaccinated or reactivated marker vaccine virus from wild-type BoHV-1 for determination of the cause of the disease and implementation of protective measures. Nucleic acid based detection methods are now being accepted as molecular diagnostic tools due to their sensitivity, specificity, rapidity, and ease of performance, (16, 17). OIE recommends PCR and TaqMan probe based real-time PCR as tests for detection of BoHV-1. However, lower sensitivity of the conventional PCR assays and high potential false-negative rates and the cost involved in TaqMan based assays limits their use as routine laboratory test. In the present study, EvaGreen, a dsDNA binding fluorescence dye was used for rapid
ANIMAL BIOTECHNOLOGY
251
Figure 2. The melting curve analysis of amplified products after EvaGreen based real-time PCR. The multiple Tm curves in the plots represent the replicates. (a) Wild-type BoHV-1 generated three distinct Tm peaks each for BoHV-1 gB, gE and bGH (IPC). (b) gE-deleted BoHV-1 marker vaccine generated two Tm peaks representing BoHV-1 gB and bGH (IPC). (c) Agarose gel electrophoresis of amplified products; Lane 1, gB; Lane 2, gE; Lane 3, bGH; Lane M, λ DNA/EcoRIþHindIII marker.
differentiation of wild-type and gE-deleted strains of BoHV-1. The inclusion of MCA in the EGRT-PCR assay enabled the identification and differentiation of BoHV-1 genes based on their melting temperature
profiles. Use of internal positive control (IPC) in the real-time PCR assay has been recommended by others for detection of viruses other than BoHV-1 (18, 19). The inclusion of IPC in the assay has been reported to
252
S. S. PAWAR ET AL.
avoid false negative results due to the presence of PCR inhibitors present in variety of sample types (20). In conclusion, the present study reports development of an EvaGreen based multiplex real-time PCR assay for the rapid differentiation of wild-type and gE-deleted strains of BoHV-1. The assay can be a promising tool in monitoring disease scenario and to devise appropriate disease management strategies for proper herd management in the regions where gE-deleted marker vaccines are utilized in BoHV-1 control programs.
Acknowledgements We sincerely thank ICAR and Indian Veterinary Research Institute (IVRI) for providing necessary facilities to carry out this work.
ORCID Sachin S. Pawar 5106
http://orcid.org/0000-0002-4685-
Funding This study was supported by a project under the National Fund for Basic, Strategic, and Frontier Application Research in Agriculture (NFBSFARA), the Indian Council of Agricultural Research (ICAR), Government of India.
References 1. Gibbs EP, Rweyemamu MM. Bovine herpesviruses, part 1. Vet Bull 1977; 47:317–343. 2. Infectious bovine rhinotracheitis/infectious pustular vulvovaginitis. OIE Terrestrial Manual 2010; Chapter 2.4.13:1–17. 3. VanOirschot JT, Kaashoek MJ, Maris-Veldhuis MA, Weerdmeester K, Rijsewijk FAM. An enzyme linked immunosorbent assay to detect antibodies against glycoprotein gE of bovine herpesvirus 1 allows differentiation between infected and vaccinated cattle. J Virol Methods 1997; 67:23–34. 4. Straub OC. Experience with two BHV-1 marker vaccines, In: Proceedings of 19th Buiatrics Congress 1996; 1:39–41. 5. Wernike K, Hoffmann B, Kalthoff D, Konig P, Beer M. Development and validation of a multiplex real-time PCR assay for the rapid detection and differentiation of wild-type and glycoprotein E-negative vaccine strains of Bovine herpesvirus type 1. J Virol Methods 2011; 174:77–84.
6. Fuchs M, Hubert P, Detterer J, Rziha HJ. Detection of bovine herpesvirus type 1 in blood from naturally infected cattle by using a sensitive PCR that discriminates between wild- type virus and virus lacking glycoprotein E. J Clin Microbiol 1999; 37:2498–2507. 7. Schynts F, Baranowski E, Lemaire M, Thiry EA. Specific PCR to differentiate between gE negative vaccine and wildtype bovine herpesvirus type 1 strains. Vet Microbiol 1999; 66:187–195. 8. Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 2002; 29:23–39. 9. Papin JF, Vahrson W, Dittmer DP. SYBR green-based real-time quantitative PCR assay for detection of West Nile Virus circumvents false-negative results due to strain variability. J Clin Microbiol 2004; 42:1511–1518. 10. Bustin SA. Absolute quantification of mRNA using realtime reverse transcription polymerase chain reaction assays. J Mol Endocrino 2000; 25:169–193. 11. Cheng J, Jiang Y, Rao O, et al. Development of a single-tube multiplex real-time PCR for detection and identification of five pathogenic targets by using melting-curve analysis with EvaGreen. Arch Virol 2013; 158:379–386. 12. Mehrotra ML, Rajya BS, Kumar S. IBR keratoconjunctivitis in calves. Indian J Vet Pathol 1976; 1:70–73. 13. Gupta PK, Rai A. Restriction enzyme analysis of bovine herpesvirus-1 DNA from an Indian isolate. Biochem Mol Biol Int 1993; 29:889–898. 14. Pawar SS, Meshram CD, Singh NK, Saini M, Mishra BP, Gupta PK. Loop-Mediated Isothermal Amplification for Rapid Detection and Differentiation of Wild-Type Bovine Herpesvirus-1 and Glycoprotein E-Deleted Marker Vaccine Strain. Anim Biotechnol 2015; 26:268–272. 15. Lee C, Kim J, Shin SC, Hwang S. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. J Biotech 2006; 123:273–280. 16. Mackay M. Real-time PCR in the microbiology laboratory. Clin Microbiol Infec 2004; 10:190–212. 17. Espy MJ, Uhl JR, Sloan LM, et al. Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clin Microbiol Rev 2006; 19:165–256. 18. Hoorfar J, Malorny B, Abdulmawjood A, Cook N, Wagner M, Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J Clin Microbiol 2004; 42:1863–1868. 19. Amer HM, Almajhdi FN. Development of a SYBR Green I based real-time RT-PCR assay for detection and quantification of bovine coronavirus. Mol Cell Probe 2011; 25:101–107. 20. Van der Oirschot JH, Straver PJ, vanLieshout JAH, Quak J, Westenbrink F, vanExsel ACA. A subclinical infection of bulls with bovine herpesvirus type 1 at an artificial insemination centre. Vet Rec 1993; 132:32–35.
