Evaluation of PCR Based on Gene apxIVA Associated ... - Springer Link

CURRENT MICROBIOLOGY Vol. 48 (2004), pp. 189 –195 DOI: 10.1007/s00284-003-4162-x

Current Microbiology An International Journal © Springer-Verlag New York Inc. 2004

Evaluation of PCR Based on Gene apxIVA Associated with 16S rDNA Sequencing for the Identification of Actinobacillus pleuropneumoniae and Related Species Mateus Matiuzzi da Costa,1 Catia Silene Klein,4 Raquel Balestrin,1 Augusto Schrank,1,2 Itamar Antonio Piffer,4 Se´rgio Ceroni da Silva,1,3 Irene Silveira Schrank1,2 1

Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves, 9500, Pre´dio 43421, C.P. 15005, CEP 91501970, Porto Alegre, RS, Brazil 2 Departamento de Biologia Molecular e Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves, 9500, Pre´dio 43421, C.P. 15005, CEP 91501-970, Porto Alegre, RS, Brazil 3 Departamento de Patologia Clinica Veterina´ria, Faculdade de Veterina´ria, Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves, 9500, Pre´dio 43421, C.P. 15005, CEP 91501-970, Porto Alegre, RS, Brazil 4 Centro Nacional de Pesquisa de Suıńos e Aves, EMBRAPA, Parque, Estaçaõ Biolo´gica, PqEB s/no. Brasilia, DF-Brasil CEP 70770-901, Brazil Received: 23 May 2003 / Accepted: 23 June 2003

Abstract. The pleuropneumonia caused by Actinobacillus pleuropneumoniae (App) is one the most important swine respiratory diseases. Biochemical and serological tests are widely applied for App diagnosis and characterization. However, in some isolates, conflicting results are found. The present work focus on the characterization of 29 isolates biochemically classified as A. pleuropneumoniae, collected from swine in herds with or without a clinical history of pleuropneumonia. Sixteen isolates were from healthy swine, initially classified as nonserotypable A. pleuropneumoniae; they displayed differences in the molecular characterization patterns of App (genes cpx and apxI, II, and III). Those bacteria that could not be serotyped were submitted to rDNA 16S sequencing. All 29 isolates were analyzed by PCR for the presence of the apxIVA gene. Thirteen isolates (45%) were confirmed to be A. pleuropneumoniae by PCR, nine being from diseased animals (31%) and four from healthy animals (14%) with conclusive serotyping. The rDNA 16S sequencing was used to classify the other 16 isolates in related species other than A. pleuropneumoniae, resulting in eleven A. minor, three A. porcinus, and two Pasteurella sp. Because of conflicting results between biochemical tests and rDNA 16S sequencing, the biochemical characterization was repeated, and the new results were in agreement with the rDNA 16S sequencing data. Biochemical characterization proved to be efficient for the majority of the A. pleuropneumoniae isolates. Nevertheless, conventional tests can render conflicting results, and other methodologies, such as amplification of A. pleuropneumoniae specific apxIVA gene and rDNA 16S sequencing, are very useful for improved classification. We also observed a great variety in rDNA 16S sequences from different A. minor isolates.

The pleuropneumonia (PP), caused by Actinobacillus pleuropneumoniae (App), is one of the most important bacterial diseases of the swine respiratory tract, occuring widely in the pig-producing countries [11, 23, 26]. Its economic importance derives from the fact that its acute form causes fibrinous pleuritis, with hemorrhagic and necrotic lesions in the lungs, and pleural adhesions, reCorrespondence to: I.S. Schrank; email: [email protected]

sulting in high mortality. In chronic and subclinical states the morbidity is low, and the losses are mainly due to reduced growth rates and increased costs with medication and/or vaccination [26]. App is a Gram-negative, capnophilic cocobacillus belonging to the Pasteurellaceae family. These bacteria can be classified into two biotypes, according to the requirement for nicotinamide adenine dinucleotide (NAD). Biotype 1 strains are NAD-dependent, whereas

190 biotype 2 strains are NAD-independent. The standard methods for diagnosis of App infection are based on culture and serology [9]. Serotyping is one of the most important tools used in epidemiological studies and control programs of swine pleuropneumonia. It is mainly based on serological variations of the capsular antigens. These differences are used to classify the bacteria in 14 serotypes [2, 7]. Recently, a 15th App serotype has been described among Australian isolates [1]. The phenotypic characterization of App is commonly based on hemolysis, CAMP test, and requirement for NAD, urease production, fermentation of manitol and ribose [10]. However, variations in the interpretation of these tests have been described [10, 19, 24]. App virulence is associated with several factors, such as capsule, outer major proteins, lipopolysaccharides (LPS), proteases, adhesins, and the RTX protein toxins. This family of toxins is widely spread among Gram-negative pathogenic bacteria [11, 24]. App serotypes vary in RTX (Apx I, II, and III) production, which have distinct cytotoxic and hemolytic effects. Recently, a new RTX toxin has been identified and characterized in App, designated ApxIV. This pore-forming toxin is expressed only in vivo and was suggested to be important for bacterial pathogenesis, although the mechanism is not completely understood [24, 25]. The apxIVA gene was found in all App serotypes and is absent in other related species of the Pasteurellaceae family and considered to be specific of App [5]. The family Pasteurellaceae comprises several species classified in three genera: Haemophilus, Actinobacillus, and Pasteurella. Taxonomic studies on this family are based on both phenotypic and molecular methods; however, many reports describe difficulties in classifying bacteria in this family [6]. On the basis of DNA-DNA hybridization and analysis of 16S rDNA gene sequences, three new species have been proposed: the Haemophilus taxon minor group has been reclassified into Actinobacillus minor, Actinobacillus porcinus, and Actinobacillus indolicus [20]. The species belonging to the taxon minor are differentiated from App mainly by the absence of hemolysis and reduced pathogenicity to swine [3, 15]. The biochemical characterization is pivotal for the classification of the species in the family Pasteurellaceae [15]. Klein et al. [17] have analyzed 127 bacterial isolates from swine respiratory tract samples, 64 being isolates from diseased animals and 63 isolates from healthy swine from herds with or without previous history of pleuropneumonia. In these analyses, 16 isolates (13%) displayed conflicting results between biochemical, serotyping, and molecular classification. According to Schaller et al. [25], the classification of App and related

CURRENT MICROBIOLOGY Vol. 48 (2004)

NAD-dependent bacteria from the respiratory tract by using biochemical and serological methods is complex, especially in herds free of PP. The authors refer to the difficulties presented by the subjective interpretation of the results, fastidious growth characteristics, and emerging of nontypable isolates. In addition, the occurrence of bacteria mimics the phenotypic and antigenic patterns of App claims for alternative methods to improve the swine pleuropneumonia diagnosis [6, 25]. Moreover, App carrier-swine are responsible for spreading the disease among herds and are a keystone in the control of the disease [4, 14]. In these carrier swine, in cases of subclinical infections, the agent is located at the tonsils, giving confusing results in the characterization by microbiological methods [19, 25]. For the control of pleuropneumonia, the development and application of rapid and sensitive App detection assays are necessary [24]. However, Schaller et al. [23] reported that from all currently standardized PCRbased methods, only the apxIVA gene amplification allows the precise identification of App Cho et al. [5] reported the presence of the apxIVA gene in App field isolates and suggested that it may be a very useful target to develop diagnostic tests and to produce antigens for serological tests as enzyme-linked immunosorbent assays (ELISA), as well as for the future development of swine pleuropneumonia vaccines. The analysis of hypervariable 16S rDNA gene sequences has been widely used in molecular taxonomic studies to differentiate related species [15]. In this work, we characterize field isolates of App by using PCR for the apxIVA gene and 16S rDNA sequencing to solve previous conflicting classification results. Materials and Methods Bacterial isolates and culture conditions. We have used the 13 serotypes of A. pleuropneumoniae as positive control and isolates from related species as negative control for the amplification of the apxIVA gene by PCR (Table 1). The 29 tested field isolates were from Centro Nacional de Pesquisa em Suıńos e Aves (CNPSA, EMBRAPA, Brazil) and were biochemically characterized by methods previously described [10, 16, 18]. Serotyping was performed by the immunodiffusion test (ID) as described by Nielsen and O’Connor [21]. Strains that resulted in unknown serotypes according to the ID test were subsequently serotyped by the passive hemagglutination test described previously [18]. The isolates were separated into two groups, one comprising nine isolates from pigs with PP and the other group composed of 20 isolates from tonsils of healthy animals from herds without either history of swine pleuropenumonia or previous App isolation. Four of these App isolates were serotyped and gave results in agreement with the molecular results from cpx and apx (I, II, and III) gene amplification [17]. The other 16 isolates were nonserotypable and presented some conflicting results between biochemical and molecular tests. The characteristics of these isolates are presented in Table 2. Samples were cultured in ovine blood agar (Oxoid, Basingstoke,

191

M. Matiuzzi da Costa et al.: Characterization of App by PCR and rDNA Sequencing Table 1. Reference strains Species A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. minor A. suis Haemophilus parassuis Pasteurella multocida Bordetella bronchiseptica a b

Serotype

Strain

Source or Reference

1 2 3 4 5a 5b 6 7 8 9 10 11 12 – – – – –

4074 1536 1421 M62 K17 L20 Femo SCI-A WF83 SCI-A F384 F60 13039 56153 1096 Field strain Field strain Field strain Field strain Field strain

Rossa Ross Ross ATCC 33378 ATCC 33377 Ross Petersenb Petersen Petersen Petersen Ross Ross Ross EMBRAPA CNPSA EMBRAPA CNPSA EMBRAPA CNPSA EMBRAPA CNPSA EMBRAPA CNPSA

Richard Ross, Iowa University. Ruth Petersen, Intervet, Denmark.

England) with a perpendicular streak of S. aureus. Representative colonies were transferred to Columbia Agar (Oxoid, Basingstoke, England) supplemented with 50 ␮g mL⫺1 of NAD (Sigma Chemical Co.) and 5% bovine serum. The plates were incubated at 37°C for 18 h under microaerophilic conditions. Genomic DNA extraction and PCR. Total genomic DNA was extracted from all samples as described by Ostaaijen et al. [22]. Isolates of A. pleuropneumoniae were characterized by amplification of the apxIVA gene by using the primers APXIV-Up (5⬘ GACGTAACTCGGTGATTGAT) and ExAPXIV-Do (5⬘GAATTCACCTGAGTGCTCACCACC). For the 16S rDNA sequencing, universal primers for Actinobacillus sp. 16S-up (5⬘CACGGAGTTAGCCGGTGCTT) and 16S-do (5⬘AGTGGCGGACGGGTGAGTAA) were used. The PCR reactions were performed as follows: 25 ␮L of reaction containing 100 ng of the DNA template, primers (30 pmol of each), Taq buffer (10 mM Tris, 50 mM KCl, 2.5 mM MgCl2), 200 ␮M of dNTPs, 1 unit of Taq DNA polymerase (CenbiotEnzimas, UFRGS). Amplification was performed for 35 cycles, 45 s at 94°C, 1 min at 65°C, and 45 s at 72°C for the apxIVA gene, and 45 s at 94°C, 45 s at 70°C, and 1 min at 72°C for amplification of 16S rDNA, and the last cycle was followed by an additional 10-min extension at 72°C. After amplification, 7 ␮L was subjected to electrophoresis for 30 min at 100 V in 1.5% agarose gels stained with ethidium bromide. Amplified bands were visualized and photographed under UV illumination. The PCR fragment identities were confirm by sequencing and Southern blot (ECL kit, Amersham Pharmacia) techniques. DNA sequencing and analysis. The amplified PCR products were sequenced with an automated DNA sequencer MEGABACE 1000 and Dynamic ET Dye Terminator Cycle Sequencing Kit (Amersham Pharmacia Biotech). The sequences were aligned by using the Clustal X [27] program and were compared with those present in GenBank.

Results and Discussion Swine pleuropneumonia is one of the most important respiratory diseases in swine breeding herds around the

world. For determining the epidemiological aspects and to monitor prophylactic programs, the precise characterization of the etiologic agent is required [23]. The standard methods to detect A. pleuropneumoniae infection are culture and serology [5]. According to Hennessy et al. [13] and Schaller et al. [25], the wide variability of the results from biochemical tests, difficulties in serotyping and the occurrence of bacteria that mimic the phenotypic and antigenic patterns impose the necessity of new, rapid and sensitive methods to solve doubts on the classification of App. The PCR results for the apxIVA gene amplification among the 29 isolates analyzed are listed in Table 2. The specific 388-bp amplicon was detected in all App serotypes analyzed and was absent in all related species, emphasizing the specificity of the technique (Fig. 1A and B). Moreover, the nine samples taken from infected swine and four serotypable bacteria isolated from apparently healthy animals were confirmed by amplification of the apxIVA gene. These results are in agreement with previous reports [25] and emphasize the applicability of the amplification of apxIVA gene to detect and characterize App. Cho et al. [5] reported the presence of the ApxIV toxin in App field isolates and its absence in related bacteria belonging to the Pasteurellaceae family. The authors suggest that the presence of the ApxIV toxin is highly specific to App and can be used to establish detection methods for this bacterium. All 16 isolates classified as App and presenting conflicting results between biochemical and molecular characterization were nega-

192


Table 2. Biochemical, serological, and molecular characteristics of field isolates previously characterized as A. pleuropneumoniae

Strains

CAMP test

Hemolysis

Urease

Serotype

apxIA

apxIIA

apxIIIA

apxIVA

cpx

Classification based on 16S rDNA sequencing

6635a 6636a 6740a 6744a 6747a 6791a 6804a 6825a 7258a 6876 6974 6975 7011 6898 6952 6957 6979 6983 6985 6991 6993 7000 7024 7045 7001 7008 7009 6951 6981

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫹ ⫺

3 3 5b 5b 7 3 7 11 1 7 7 7 12 NTb NT NT NT NT NT NT NT NT NT NT NT NT NT NT NT

⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

⫹ ⫹ ⫺ ⫺ ⫺ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. pleuropneumoniae A. minor A. minor A. minor A. minor A. minor A. minor A. minor A. minor A. minor A. minor A. minor A. porcinus A. porcinus A. porcinus Pasteurella spp. Pasteurella spp.

PCR amplification

a b

Strains isolated from diseased animals. NT: nonserotypable.

Fig. 1. Amplification of apxIV gene by PCR. Amplification results represent samples from App serotypes (S1 to S12) of biotype and related species. neg- negative control; M, reference PCR product with 417pb.

tive for the amplification of the apxIVA gene, not supporting the previous App biochemical classification.

Many taxonomic studies have emphasized the difficulties in the classification of the family Pasteurellaceae [6, 12, 15]. The 16S rDNA sequence analysis can be used

M. Matiuzzi da Costa et al.: Characterization of App by PCR and rDNA Sequencing

193

Fig. 2. Phylogenetic relationship among Actinobacillus species based on 16S rDNA genes. Multiple sequence alignment of the 16S rDNA partial genes from strains analyzed in this work and A. pleuropneumoniae, A. indolicus, A. porcinus, and A. minor. Multiple alignment was done by the CLUSTAL program and used to construct the tree by the Neighbour Joining method. Bacterial strains are represented by their accession number on GenBank.

as a very important tool to elucidate the taxonomic complexity of this family. In the present study, the 16S rDNA sequencing approach allowed us to classify the 16 field isolates that could not be serotyped and that presented difficulties in the molecular characterization (based on amplification of the cpx, apxI, II, and III genes by PCR) into related species (Table 2). From 10 hemolytic isolates, with negative CAMP test and no PCR amplification for either apx or cpx genes, six were classified as A. minor, three as A. porcinus, and one as Pasteurella sp. using 16S rDNA sequencing. The remaining six hemolytic isolates, with positive CAMP test and no detectable apx and cpx gene products by PCR (exception to isolate 6979, which was positive for amplification of the apxIIA gene) were reclassified among NAD-dependent bacteria from the swine respiratory tract other than App (Table 2). These isolates were negative for apxIVA gene amplification and were characterized, by 16S rDNA sequencing, as A. minor (five isolates) and Pasteurella sp. (one isolate).

To elucidate the difference between the phenotypic (hemolysis and/or positive CAMP test) and molecular patterns (amplification of apx and cpx genes, and 16S rDNA sequencing) the biochemical characterization was repeated (data not shown). The results confirmed the 16S rDNA sequencing classification. Taken all together, our results are in agreement with those reported by Kielstein et al. [15] showing that the biochemical characterization was in agreement with the 16S rDNA sequencing. However, these authors did not apply this methodology to sort out the classification of isolates with conflicting biochemical and molecular patterns. Schaller et al. [25] analyzed field isolates with App biochemical pattern and atypical results for Apx toxins detected by PCR, including some with the apxIIA gene (as isolate 6979 from our study) and reclassified these bacteria in other species of the family Pasteurellaceae based on 16S rDNA sequencing data. Recently, Gottschlk et al. [8] have analyzed two Actinobacillus isolates biochemically and antigenically classified as A. pleuropneumoniae capable of producing

194 ApxII toxin, but results with PCR tests revealed the absence of apxIV toxin gene. These authors are proposing to classify these non-pathogenic Actinobacillus isolates as a novel species. From 16S rDNA sequence alignment, all isolates classified as A. porcinus showed the highest similarity with the A. porcinus sequences found in GenBank (Fig. 2). In contrast, the isolates classified as A. minor displayed a large variability in the region of the 16S rDNA sequences analyzed (Fig. 2). Previous studies have shown the large variability in seroptyping and analysis of 16S rDNA sequences among A. minor isolates [12, 15]. The genotypic and phenotypic variabilities among A. minor, A. porcinus, and A. indolicus probably reflect differences in bacterial virulence [15]. However, Chiers et al. [3] argued in favor of low or no pathogenicity in gnotobiotic swine experimentally infected with A. minor, A. porcinus, and A. indolicus. Our results suggest that despite the wide use and importance of the conventional biochemical tests, difficulties in classification frequently occur in some isolates, especially in relation to serotyping and the presence of apx or cpx genes. For such isolates, molecular methods such as amplification of the apxIVA gene and 16S rDNA sequencing are alternative and reliable methods to classify App. We also found a wide variability in the 16S rDNA sequences from A. minor.


7. 8.

9.

10.

11.

12.

13.

14.

15.

ACKNOWLEDGMENTS

16.

This work was supported by grants from FAPERGS (Fundaç a˜ o de Amparo a` Pesquisa do Estado do Rio Grande do Sul). M. Matiuzzi da Costa was a receiver of a scholarship from CAPES (Coordenadoria de Aperfeiç oamento de Pessoal de Ensino Superior), and R. Balestrin from CNPq (Conselho Nacional de Desenvolvimento Cientifico e Tecnolo´ gico).

17. 18.

Literature Cited 1. Backall PJ, Klaasen HLBM, van den Bosch H, Kuhnert P, Frey J (2002) Proposal of a new serovar of Actinobacillus pleuropneumoniae: Serovar 15. Vet Microbiol 84:47–52 2. Beck M, van den Bosch JF, Jongenelen IMCA, Loeffen PLW, Nielsen R, Nicolet J, Frey J (1994) RTX toxin genotypes and phenotypes in Actinobacillus pleuropneumoniae field strains. J Clin Microbiol 32:2749 –2754 3. Chiers K, Haesebrouck F, Mateusen B, Van Overbere I, Ducatelle R (2001) Pathogenicity of A. minor, A. indolicus and A. porcinus strains for gnotobiotic piglets. J Vet Med B 48:127–131 4. Chiers K, Donne´ E, Van Overbeke I, Ducatelle R, Haesebrouck F (2002) Actinobacillus pleuropneumoniae infections in closed swine herds: Infection patterns and serological profiles. Vet Microbiol 85:343–352 5. Cho W, Chae C (2001) Genotypic prevalence of apxIV in Actinobacillus pleuropneumoniae field isolates. J Vet Diag Invest 13:175–177 6. Dewhirst FE, Paster BJ, Olsen I, Fraser GJ (1993) Phylogeny of the Pasteurellaceae as determined by comparison of 16S ribo-

19.

20.

21.

22.

23.

somal ribonucleic acid sequences. Int J Med Microbiol Virol Parasitol Infect Dis 279:35– 44 Frey J (1995) Virulence in Actinobacillus pleuropneumoniae and RTX toxins. Trends Microbiol 3:257–261 Gottschalk M, Broes A, Mittal KR, Kobisch M, Kuhnert P, Lebrun A, Frey J (2003) Non-pathogenic Actinobacillus isolates antigenically and biochemically similar to Actinobacillus pleuropneumoniae: A novel species? Vet Microbiol 92:87–101 Gram T, Ahrens P, Nielsen JP (1996) Evaluation of a PCR for detection of Actinobacillus pleuropneumoniae in mixed bacterial cultures from tonsils. Vet Microbiol 51:95–104 Gutierrez CB, Tascon RI, Barbosa JIR, Gonzalez OR, Vasquez JA, Ferri EFR (1993) Characterization of V factor-dependent organisms of the family Pasteurellaceae isolated from porcine pneumonic lungs in Spain. Comp Immunol Microbiol Infect Dis 16:123– 130 Haesebrouck F, Chiers K, van Overbeke I, Ducatelle R (1997) Actinobacillus pleuropneumoniae infections in pigs: The role of virulence factors in pathogenesis and protection. Vet Microbiol 58:239 –249 Hampson DJ, Blackall PJ, Woodward JM, Lymbery AJ (1993) Genetic analysis of Actinobacillus pleuropneumoniae, and comparison with Haemophilus spp. taxon “Minor group” and taxon C. Int J Med Microbiol Virol Parasitol Infect Dis 279:83–91 Hennessy KJ, Iandolo JJ, Fenwick BW (1993) Serotype identification of Actinobacillus pleuropneumoniae by arbitrarily primed polymerase chain reaction. J Clin Microbiol 31:1155–1159 Jobert JL, Savoye C, Cariolet R, Kolbisch M, Madec F (2000) Experimental transmission of Actinobacillus pleuropneumoniae to pigs. Can J Vet Res 64:21–26 Kielstein P, Wuthe H-H, Angen Ø, Mutters R, Ahrens P (2001) Phenotypic and genetic characterization of NAD-dependent Pasteurellaceae from the respiratory tract of pigs and their possible pathogenetic importance. Vet Microbiol 81:243–255 Kilian M, Frederiksen W (1981) Identification tables for the Haemophilus-Pasteurella-Actinobacillus group. In: Kilian M, Frederiksen W, Biberstein EL (eds) Haemophilus-Pasteurella-Actinobacillus. London: Academic Press, pp 281–290 Klein CS (2003) Detection of A. pleuropneumoniae in field isolates from healthy and diseased swine. Curr Microbiol 46:443– 447 Mittal KR, Higgins R, Larivie´ re S (1983) Detection of typespecific antigens in the lungs of Haemophilus pleuropneumoniaeinfected pigs by coagglutination test. J Clin Microbiol 18:1355– 1357 Moller K, Kilian M (1990) V factor-dependent members of the Family Pasteurellaceae in the porcine upper respiratory tract. J Clin Microbiol 28:2711–2716 Moller K, Fussing V, Grimont PAD, Paster BJ, Dewhirst FE, Kilian M (1996) Actinobacillus minor sp. nov., Actinobacillus porcinus sp. nov., and Actinobacillus indolicus sp. nov., three new V factor-dependent species from the respiratory tract of pigs. Int J Syst Bacteriol 46:951–956 Nielsen R, O’Connor PJ (1984) Serological characterization of 8 Haemophilus pleuropneumoniae strains and proposal of a new serotype 8. Acta Vet Scand 25:96 –106 Ostaaijen JV, Frey J, Rosendal S, MacInnes JI (1997) Actinobacillus suis strains isolated from healthy and diseased swine are clonal and carry apxI CABDvar.suis and apxII CAvar.suis toxin genes. J Clin Microbiol 35:1131–1137 Schaller A, Kuhn R, Kuhnert P, Nicolet J, Anderson TJ, MacInnes JI, Segers RPAM, Frey J (1999) Characterization of apxIVA, a new RTX determinant of Actinobacillus pleuropneumoniae. Microbiology 145:2105–2116

M. Matiuzzi da Costa et al.: Characterization of App by PCR and rDNA Sequencing 24. Schaller A, Kuhnert P, de la Puente-Redondo VA, Nicolet J, Frey J (2000) Apx toxins in Pasteurellaceae species from animals. Vet Microbiol 74:365–376 25. Schaller A, Djordjevic SP, Eamens GJ, Forbes WA, Kuhn R, Kuhnert P, Gottschalk M, Nicolet J, Frey J (2001) Identification and detection of Actinobacillus pleuropneumoniae by PCR based on the gene apxIVA. Vet Microbiol 79:47– 62

195

26. Taylor DJ (1999) Actinobacillus pleuropneumoniae. In: Straw SE, D’allaires S, Mengelng WL, Taylor DJ (eds) Diseases of swine. Ames, IA: Iowa State University Press, pp 343–354 27. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustaIX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24:4876 – 4882