JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2001, p. 1429–1435 0095-1137/01/$04.00⫹0 DOI: 10.1128/JCM.39.4.1429–1435.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved.
Vol. 39, No. 4
Evaluation of the NucliSens Basic Kit for Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in Genital Tract Specimens Using Nucleic Acid Sequence-Based Amplification of 16S rRNA J. B. MAHONY,1,2* X. SONG,2 S. CHONG,2 M. FAUGHT,2 T. SALONGA,2
AND
J. KAPALA3
1
Department of Pathology and Molecular Medicine, McMaster University, and Hamilton Regional Laboratory Medicine Program, St. Joseph’s Hospital,2 Hamilton, and GammaDynacare Medical Laboratories, Brampton,3 Ontario, Canada Received 21 September 2000/Returned for modification 29 November 2000/Accepted 24 January 2001
We evaluated a new RNA amplification and detection kit, the NucliSens Basic Kit (Organon Teknika), for the detection of Chlamydia trachomatis and Neisseria gonorrhoeae in genitourinary specimens. The Basic Kit provides an open platform for RNA amplification and detection and contains isolation reagents for nucleic acid extraction, nucleic acid sequence-based amplification (NASBA) reagents (enzymes and buffers), and a generic ruthenium-labeled probe for electrochemiluminescent (ECL) detection of amplified product. Using freshly purified and titrated stocks of C. trachomatis and N. gonorrhoeae and in vitro-generated RNA transcripts for sensitivity determinations, the Basic Kit detected 1 inclusion-forming unit of C. trachomatis, 1 CFU of N. gonorrhoeae, and 100 RNA molecules of 16S rRNA for both bacteria. The clinical performance of the Basic Kit was evaluated by testing a total of 250 specimens for N. gonorrhoeae by culture and NASBA and a total of 96 specimens for C. trachomatis by PCR and NASBA. The Basic Kit detected 139 of 142 N. gonorrhoeae culturepositive specimens and gave a negative result for 73 of 74 culture-negative specimens, for a sensitivity and specificity of 97.9 and 98.7%, respectively. For C. trachomatis, the Basic Kit detected 24 of 24 PCR-positive specimens and gave a negative result for 71 of 72 PCR-negative specimens, for a sensitivity and specificity of 100 and 98.6%, respectively. The Basic Kit also detected specimens containing both N. gonorrhoeae and C. trachomatis, using a multiplex NASBA assay using primers for both bacteria. The NucliSens Basic Kit offers a versatile platform for the development of sensitive RNA detection assays for sexually transmitted diseases. fication tests exist for N. gonorrhoeae (23), and some coamplification assays have been developed for C. trachomatis and N. gonorrhoeae. Despite the early successes of these commercial amplification tests, they are not without problems. The sensitivity of amplification assays can be reduced by the presence of amplification inhibitors in clinical specimens, and different assays may be affected differently by inhibitors (6, 16, 28). The utility of first-generation PCR and LCR assays has been limited by the number of specimens that can be tested in a single run. Batch sizes for both the Amplicor and LCx assays are limited by the small number of specimens that can be tested in a single run, 24 on two wheels for Amplicor and 22 on one carousel for LCx. The handling of a small number of specimens has hampered the installation of these tests in large-volume laboratories. Specimen extraction has also been problematic, and the need for automation for large-volume testing has resulted in the production of automated nucleic acid extractors and robotic pipetting stations. Front-end robotic extraction stations have therefore become the “holy grail” of diagnostic companies, especially for applications involving bloodborne viruses, for which large-volume testing is necessary for protection of the blood supply. We evaluated a new RNA amplification and detection kit, called the NucliSens Basic Kit, which uses isothermal nucleic acid sequence-based amplification (NASBA) for the detection of C. trachomatis and N. gonorrhoeae 16S rRNAs in clinical specimens. We compared the Basic Kit to PCR for C. tra-
Genitourinary tract infections are a major cause of morbidity in sexually active individuals worldwide, with an estimated 330 million new curable sexually transmitted diseases (STDs) diagnosed per year worldwide and between 5 and 12 million cases diagnosed annually in North America (1, 4, 11). The annual cost of treatment of chlamydial infections and their sequelae was estimated at $2.2 billion in 1990 for North America (29). Although the number of reported cases of Neisseria gonorrhoeae has declined substantially in many industrialized countries, this STD is still important worldwide, with an estimated 78 million new infections occurring annually (30). Over the past 15 years, the diagnosis of STDs has been largely dependent on traditional methods, such as culture, enzyme immunoassay, and direct fluorescent-antibody staining for Chlamydia trachomatis and culture for N. gonorrhoeae. In the last 5 years there have been major improvements in our ability to detect these STDs, first with the advent of nucleic acid amplification technologies and then with the introduction of testing noninvasively obtained urine specimens (5– 7, 9, 10, 17, 18, 22, 23, 25). Commercially available PCR, ligase chain reaction (LCR), and transcription-mediated amplification tests for C. trachomatis have been developed, and comparative studies have been reported (19, 25, 26). Fewer nucleic acid ampli* Corresponding author. Mailing address: Regional Virology and Chlamydiology Laboratory, St. Joseph’s Hospital, 50 Charlton Ave. East, Hamilton, Ontario, Canada L8N 4A6. Phone: (905) 521-6021. Fax: (905) 521-6083. E-mail:
[email protected]. 1429
1430
MAHONY ET AL.
J. CLIN. MICROBIOL. TABLE 1. Primers and probes for detection of N. gonorrhoeae and C. trachomatis
Organism
Probe
N. gonorrhoeae
NGP1 NGP2 Capture probe CTP1 CTP2 Capture probe
C. trachomatis
a
Sequencea
5⬘ 5⬘ 5⬘ 5⬘ 5⬘ 5⬘
AATTCTAATACGACTCACTATAGGGAGAGGCGGTCAATTTCACGCG 3⬘ GATGCAAGGTCGCATATGAGACTGCGTTCTGAACTGGGTG 3⬘ biotin-CAACTTGATTGCTTGGTAGC 3⬘ AATTCTAATACGACTCACTATAGGGAGACACATAGACTCTCCCTTAAC 3⬘ GATGCAAGGTCGCATATGAGAGCAATTGTTTCGGCAATTG 3⬘ biotin-GGCGATATTTGGGCATCCGAGTAACG 3⬘
Underlined sequences represent the T7 promoter sequence. Boldface sequences represent the complementary ECL probe sequence.
chomatis and to culture for N. gonorrhoeae, using genitourinary tract specimens. (These results were presented in part at the 39th Annual ICAAC meeting in San Francisco, CA, September 1999.) MATERIALS AND METHODS Specimens. Two hundred fifty randomly collected urethral or cervical swab specimens from 121 women and 129 men, submitted for culture of N. gonorrhoeae, were used in this study. Specimens were obtained from Gamma-Dynacare Medical Laboratories in Brampton, Ontario, and St. Joseph’s Hospital in Hamilton, Ontario, Canada. N. gonorrhoeae culture was performed using modified New York City medium (13). The plates were incubated for 48 h at 35°C in an atmosphere of 5% CO2–95% air. After incubation, the plates were examined for the presence of N. gonorrhoeae; presumptive positives were confirmed by oxidase testing (Vitek), Gram stain, and carbohydrate utilization assays (Quadferm; API). Following culture, the charcoal swabs were frozen at ⫺70°C and shipped to the Regional Virology and Chlamydiology Laboratory at St. Joseph’s Hospital for molecular testing, which was performed in a blinded fashion, without knowledge of culture results. Nucleic acid isolation. Nucleic acids were isolated from swab specimens and from laboratory strains of N. gonorrhoeae (ATCC 43069) and C. trachomatis (L1/LGV434) by using the isolation reagents, based on the method of Boom et al. (2), from the NucliSens Basic Kit (Organon Teknika, Boxtel, The Netherlands). Frozen charcoal swabs were thawed at room temperature and swirled in 1 ml of phosphate-buffered saline. The tubes were vortexed and left for 10 min to allow the charcoal to settle to the bottom; then 800 l of each supernatant was transferred to a fresh tube, and any remaining charcoal particles were allowed to settle. Finally, 700 l of supernatant was transferred to a tube containing 9 ml of guanidinium isothiocyanate (GuSCN)-based lysis buffer; this was followed by the addition of 50 l of activated silica. Silica particles carrying adsorbed nucleic acids were washed twice with 1 ml of GuSCN-based wash buffer, twice with 1 ml of 70% ethanol, and once with 1 ml of acetone. After the silica was dried at 56°C for 10 min, the nucleic acid was eluted in 50 l of elution buffer and stored at ⫺70°C prior to testing, which usually took place the next day. PCR. PCR amplifications of 16S rRNA gene fragments were performed as described previously (14, 15), with slight modifications. Primers for N. gonorrhoeae (reverse primer, 5⬘-GGCGGTCAATTTCACGCG; forward primer, 5⬘-A CTGCGTTCTGAACTGGGTG) amplified a 281-bp fragment, while primers for C. trachomatis (reverse, 5⬘-CACATAGACTCTCCCTTAAC; forward, 5⬘-AGC AATTGTTTCGGCAATTG) amplified a 205-bp fragment of the 16S rRNA gene. Oligonucleotides were synthesized at McMaster University’s Central Molecular Biology Facility. PCR was performed using AmpliTaq Gold (PerkinElmer, Branchburg, N.J.) in a total volume of 25 l containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 1 M each primer, 1.25 U of Taq polymerase, and 2.5 l of purified nucleic acid. Amplification consisted of denaturation for 10 min at 95°C followed by 30 cycles of amplification. Each cycle consisted of 30 s at 94°C, 30 s at 60°C (for N. gonorrhoeae) or 50°C (for C. trachomatis), and 1 min at 72°C. The final elongation step was extended for another 8 min. After amplification, the amplified DNA was analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. Positive and negative amplification controls and blank contamination controls were incorporated into each run. Cloning of C. trachomatis and N. gonorrhoeae 16S rRNA gene fragments. 16S rRNA gene fragments were cloned into the vector pGEM-T in order to generate in vitro-transcribed RNA. Briefly, C. trachomatis and N. gonorrhoeae DNAs were amplified by using oligonucleotide primers that targeted 16S rRNA gene fragments of 180 bp for C. trachomatis and and of 606 bp for N. gonorrhoeae. C. trachomatis primers were the same as those used for NASBA (CTP1 and CTP2) (Table 1) but without the T7 promoter sequence on the reverse primer. Primers
for N. gonorrhoeae were 5⬘-CTGTTGCCAATATCGGCGGC-3⬘ (forward) and 5⬘-ACAGCCATGCAGCACCTGTG-3⬘ (reverse). PCR was performed in 50-l reaction volumes consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 0.6 M each primer, and 1 U of AmpliTaq Gold polymerase (Perkin-Elmer; Roche Molecular Systems, Branchburg, N.J.) and a thermal cycling program of 1 min at 95°C, 1 min at 56°C, and 2 min at 72°C for 40 cycles. Amplified fragments were resolved by 2% agarose gel electrophoresis and visualized by staining with ethidium bromide. Single bands for C. trachomatis and N. gonorrhoeae were excised and eluted from the gel by using the GeneClean II DNA gel purification system (Bio101, La Jolla, Calif.) according to the manufacturer’s instructions. Cloning of the fragments was carried out with the pGEM-T cloning vector system (Promega Corp., Madison, Wis.) according to the manufacturer’s instructions. The vectors containing the 16S rRNA genes of C. trachomatis and N. gonorrhoeae were designated CT180-pGEM and NG606-pGEM, respectively. Generation of in vitro transcripts. In vitro-transcribed C. trachomatis and N. gonorrhoeae 16S rRNAs were synthesized using a CT180-pGEM or NG606pGEM clone that generated sense(⫹)RNA for C. trachomatis and N. gonorrhoeae, respectively, by standard protocols. One microgram of linearized CT180pGEM or NG606-pGEM was used as a template for in vitro transcription in a 100-l reaction volume containing 20 mM MgCl2, 40 mM Tris-HCl (pH 8.1), 1 mM spermidine, 0.01% Triton X-100, 20 mM dithiothreitol, 4 mM each nucleoside triphosphate (Amersham Pharmacia Biotech, Arlington Heights, Ill.), and 50 U of T7 RNA polymerase (United States Biochemical Corp., Cleveland, Ohio). Reactions were allowed to proceed for 4 h at 37°C prior to addition of 1 U of RQ1 RNase-free DNase to degrade the DNA template. RNA transcripts were purified by two rounds of phenol-chloroform-isoamyl alcohol (24:1:1 [vol/ vol/vol]) extraction followed by one chloroform extraction and precipitation with 2.5 volumes of absolute ethanol and 0.1 volume of 3 M sodium acetate (pH 5.2). Purified RNA transcripts suspended in RNase-free distilled water were quantified by spectrophotometry and visualized by formaldehyde-formamide (2.4 M) agarose gel electrophoresis, after which ethidium bromide staining was performed in order to verify the sizes and integrity of the transcripts. NASBA. NASBA was performed, as described in the Basic Kit application manual, by the method of Kievits et al. (12) with some modifications (24). Primers and probes specific for N. gonorrhoeae or C. trachomatis 16S rRNA were synthesized and purified by high-performance liquid chromatography (Central Facility, Institute for Molecular Biology and Biotechnology, McMaster University) (Table 1). The primers for NASBA targeted the same region of the 16S rRNA as did the PCR primers for both bacteria. P1 primers contained the T7 promoter sequences plus a sequence complementary to the target RNA, and P2 primers contained a sequence identical to the target RNA plus a 5⬘ electrochemiluminescent (ECL) tag (20 nucleotides [nt] in length) as a detector molecule. Target RNA was amplified by NASBA using the amplification reagents in the NucliSens Basic Kit (Organon Teknika). NASBA reactions were performed in a total volume of 20 l containing 5 l of purified nucleic acid, 5 l of enzyme mix, and 10 l of amplification mix, prepared as described in the NucliSens Basic Kit manual. Enzyme mixtures contained T7 RNA polymerase, avian myeloblastosis virus reverse transcriptase, RNase H, and bovine serum albumin and were added to the reaction after heat denaturation of the target RNA (5 min at 65°C). The reaction mixtures were then incubated for 90 min at 41°C. N. gonorrhoeae primers amplified a 280-nt product corresponding to N. gonorrhoeae 16S rRNA gene positions 631 to 885 (255 nt plus 5 nt of T7 sequence plus the 20-nt ECL sequence) according to Rossau et al. (21) (Fig. 1). C. trachomatis primers amplified a 205-nt product corresponding to C. trachomatis 16S rRNA gene positions 66 to 245 (180 nt plus the T7 sequence plus the ECL sequence) according to Pudjiatmoko et al. (20) (Fig. 1). After amplification, a 20-fold dilution of the amplification product was made by adding 5 l of the reaction product to 95 l of detection diluent. The rest of
VOL. 39, 2001
DETECTION OF STDs WITH NucliSens
1431
FIG. 1. Relative positions of NASBA primers and probes specific for N. gonorrhoeae and C. trachomatis. Nucleotide sequences for N. gonorrhoeae and C. trachomatis are from Rossau et al. (21) and Pudjiatmoko et al. (20), respectively. The antisense P1 primers for both N. gonorrhoeae and C. trachomatis (NGP1 and CTP1, respectively) include the T7 promoter sequence at the 5⬘ end. The sense P2 primers contain sequence complimentary to the ECL universal detector probe. the amplification product was stored at ⫺20°C. Subsequently, 5 l of diluted amplification product was incubated for 30 min at 41°C with 20 l of a hybridization mixture containing a biotinylated, target-specific capture probe coupled to streptavidin-coated magnetic beads and a ruthenium-labeled generic ECL probe complementary to the amplified ECL sequence. An aliquot of the detection diluent was incubated with the hybridization mixture to serve as a negative control. During incubation, tubes were vortexed every 10 min to keep the beads in suspension. Following the incubation, 300 l of assay buffer was added to each tube and the tubes were read in a NucliSens Reader (model I100-2000; Organon Teknika). A reference solution was included with each run for instrument quality control purposes and to compare ECL signals among runs. The cutoff for positivity was selected as the mean of 10 negatives plus 3 standard deviations, which varied from run to run but averaged between 200 and 500 relative light units (RLU) for N. gonorrhoeae and C. trachomatis, respectively. Northern blotting. Northern blot analysis was performed as described previously, using a fluorescein-labeled oligonucleotide probe (24).
RESULTS We evaluated the NucliSens Basic Kit for its ability to detect C. trachomatis and N. gonorrhoeae in genitourinary tract specimens by developing separate NASBA assays for C. trachomatis and N. gonorrhoeae 16S rRNAs and determining (i) the analytical sensitivity for each assay with in vitro transcripts and pretitrated bacterial stocks and (ii) the clinical performance by comparing the results obtained using the Basic Kit to those obtained by culture for N. gonorrhoeae and by PCR for trachomatis. The Basic Kit contains all the reagents, with the exception of probes and primers, necessary for performing NASBA, including reagents for RNA extraction, amplification, and ECL detection. RNA is first extracted with the isolation reagents by the Boom method, using GuSCN and silica, and then amplified by isothermal NASBA and detected by ECL using a biotinylated capture probe immobilized on streptavidin magnetic beads and a generic detector probe. ECL readouts in
RLU are provided by the NucliSens Reader. Target-specific primers for each NASBA, including a P1 primer containing a 5⬘-terminal T7 polymerase promoter sequence and a P2 primer containing a 5⬘-terminal ECL sequence complimentary to the ruthenium-labeled detector probe, as well as a biotinylated capture probe were synthesized separately, as shown in Table 1. The locations of the primers and probes for amplification of N. gonorrhoeae and C. trachomatis 16S rRNAs are shown in Fig. 1. The sizes of the amplified N. gonorrheae and C. trachomatis RNAs were 280 and 205 nt, respectively. Both NASBA assays, for C. trachomatis and for N. gonorrhoeae, were optimized for KCl concentration. For C. trachomatis, the level of amplified product increased as the concentration of KCl was increased from 50 to 90 mM and then decreased at 100 mM KCl (Fig. 2). For N. gonorrhoeae, however, amplification was strongest at 90 mM KCl and there was less of a difference between the amplifications at 70 (the standard concentration for NASBA) and 100 mM than for C. trachomatis. The analytical sensitivity of NASBA was determined by testing serial dilutions of freshly prepared stock cultures of C. trachomatis and N. gonorrhoeae and by testing in vitro-generated transcripts. Aliquots of freshly prepared stocks were titrated to determine the number of viable C. trachomatis (in inclusionforming units [IFU] per milliliter) and N. gonorrhoeae (in CFU per milliliter) organisms and then were used for extraction of total nucleic acids with the Basic Kit guanidinium/silica extraction protocol, which extracts both DNA and RNA. Serial dilutions of nucleic acids were then tested by PCR and NASBA. RNA products were analyzed in parallel by ECL using the
1432
MAHONY ET AL.
J. CLIN. MICROBIOL.
FIG. 2. Optimal KCl concentration for NASBA amplification of N. gonorrhoeae and C. trachomatis 16S rRNAs. NT, no template; PC, positive control.
Basic Kit and by Northern blot analysis. For N. gonorrhoeae, the PCR reached an endpoint at a dilution of 10⫺4 while the NASBA reached an endpoint at 10⫺5 with both ECL and Northern blot detection (Fig. 3). For C. trachomatis, NASBA with Northern blot detection reached an endpoint at a dilution of 10⫺5 while ECL and PCR reached endpoints at dilutions of 10⫺7 and 10⫺5, respectively (Fig. 4). Based on the infectious titers of freshly prepared bacterial stock cultures, NASBA could detect 1 IFU of C. trachomatis and 1 CFU of N. gonorrhoeae. The sensitivity of each NASBA was further determined by using serial dilutions of in vitro-generated transcripts; both assays consistently detected 100 copies of 16S rRNA, and occasionally 10 copies were detectable (data not shown). The Basic Kit was further evaluated by testing clinical specimens collected from symptomatic individuals. Two hundred and sixteen swab specimens, including 142 culture-positive swab samples and 74 culture-negative swab specimens collected from 121 women and 129 men, were tested for N. gonorrhoeae by culture and by NASBA using the Basic Kit. The Basic Kit detected 139 of 142 culture-positive swabs and was negative for 73 of 74 culture-negative swabs, for a sensitivity and specificity of 97.9 and 98.7%, respectively (Table 2). The four discordant specimens were tested by PCR; one of the three culture-positive, Basic Kit-negative specimens and one culture-negative, Basic Kit-positive specimen was positive by PCR. Ninety-six genital swab specimens collected for detection of N. gonorrohoea were randomly selected and tested for C. trachomatis DNA by PCR and for 16S rRNA by using the Basic Kit. C. trachomatis DNA was detected in 24 of 96 swab samples by PCR. The Basic Kit detected all 24 PCR-positive specimens and gave negative results for 71 of 72 PCR-negative specimens, for a sensitivity and specificity of 100 and 98.6%, respectively (Table 2). The Basic Kit was next evaluated for its ability to detect both C. trachomatis and N. gonorrhoeae in the same specimen. Four swabs positive for C. trachomatis, four swabs positive for N. gonorrhoeae, and four swabs spiked with C. trachomatis and N. gonorrhoeae to simulate dually positive specimens were
tested with the Basic Kit, using a multiplex NASBA assay with primers for both organisms. Amplification products were then tested independently with C. trachomatis- and N. gonorrhoeaespecific probes. Specimens 1 to 4 were positive for C. trachomatis and had signals ranging from 36,000 to 70,000 RLU using the C. trachomatis-specific probe and ⬍300 RLU using the N. gonorrhoeae-specific probe (Fig. 5). Specimens 5 to 8 were
FIG. 3. Sensitivity of NASBA and PCR for detecting N. gonorrhoeae. Serial dilutions of N. gonorrhoeae nucleic acid (extracted by the Boom silica method) were amplified by NASBA and PCR. Aliquots of NASBA reaction products were analyzed for a specific product by hybridization with a biotinylated capture probe and a ruthenium-labeled detector probe followed by ECL detection in the NucliSens Reader. PCR products were analyzed by agarose gel electrophoresis. NT, no template.
VOL. 39, 2001
DETECTION OF STDs WITH NucliSens
1433
TABLE 2. Performance of NucliSens Basic Kit for the detection of N. gonorrhoeae and C. trachomatis in genitourinary tract swab specimensa Pathogen
% Sensitivityb
% Specificityc
N. gonorrhoeae C. trachomatis
97.9 (139/142) 100 (24/24)
98.7 (73/74) 98.6 (71/72)
a For N. gonorrhoeae, 216 swab specimens (142 culture positive, 74 culture negative) were tested by culture and by NASBA using the NucliSens Basic Kit; culture was used as the reference standard. For C. trachomatis, 96 swab samples (24 PCR positive, 72 PCR negative) were tested by PCR and NASBA; PCR was used as the reference standard to calculate sensitivity and specificity. b Number NASBA positive/number culture or PCR positive. c Number NASBA negative/number culture or PCR negative.
FIG. 4. Sensitivity of NASBA and PCR for detecting C. trachomatis. Serial dilutions of C. trachomatis nucleic acid were amplified by NASBA and PCR. NASBA products were detected by ECL using the Basic Kit and by Northern blot analysis. PCR products were analyzed by agarose gel electrophoresis. NT, no template.
N. gonorrhoeae positive and had signals of 29,000 to 154,000 RLU using the N. gonorrhoeae probe and ⬍300 using the C. trachomatis probe. Specimens 9 to 12 were positive for both organisms and had mean RLU values of 4,799 for C. trachomatis and 74,434 for N. gonorrhoeae.
extract RNA from a variety of clinical specimens, including genital swab samples, whole blood or peripheral blood mononuclear cells, nasopharyngeal swab specimens, cultured cells, and brain tissue. Following amplification, a specific product is detected by using a ruthenium-labeled generic probe which binds to the complimentary ECL tag of the antisense RNA product. The NucliSens Reader provides readouts in RLU which can be easily used for establishing cutoffs for qualitative assays or for quantitation of RNA analytes (8, 24). NASBA with the Basic Kit was easy to perform and offered some advantages over PCR. NASBA involves an isothermal reaction but does not require a thermal cycler. The amplification conditions for NASBA are generally constant, and optimization of conditions for each new assay can be simpler than optimization of PCR. The concentrations of enzymes and
DISCUSSION We evaluated the NucliSens Basic Kit for the detection of C. trachomatis and N. gonorrohoeae 16S rRNAs in genital tract specimens. Under optimal conditions of amplification, the Basic Kit consistently detected 100 molecules of 16S rRNA for each bacterium and 1 IFU of C. trachomatis and 1 CFU of N. gonorrhoeae. For gentital swab specimens, the Basic Kit had a sensitivity comparable to that of culture for detecting N. gonorrhoeae and equivalent to that of PCR for detecting C. trachomatis (Table 2). The specificity of the Basic Kit for detecting either C. trachomatis or N. gonorrhoeae in genital swab samples exceeded 98.5%. Using a multiplex NASBA assay, the Basic Kit was able to detect both bacteria when they were present in the same clinical specimen. The Basic Kit provides an open platform for RNA amplification and detection and includes all reagents necessary for detecting RNA by NASBA with the exception of specific primers and probes. The kit includes reagents for RNA extraction, enzymes and buffers for amplification, and a generic probe for detection in the NucliSens Reader. RNA extraction is performed using the well-established Boom method of GuSCN stabilization followed by adsorption to and elution from silica. The Basic Kit software installed in the Reader enables the user to enter different cutoff levels, which allows validation for various specimen types. We have used these isolation reagents to
FIG. 5. Detection of C. trachomatis and N. gonorrhoeae in genital swab specimens by NASBA and ECL detection with the Basic Kit. Twelve specimens—four positive for N. gonorrhoeae (NG1 to NG4), four positive for C. trachomatis (CT1 to CT4), and four positive for both N. gonorrhoeae and C. trachomatis (NG-CT1 through NG-CT4)— and four controls (NT, no template; NGPC, N. gonorrhoeae positive; CTPC, C. trachomatis positive; and NG-CTPC, N. gonorrhoeae and C. trachomatis positive) were amplified and probed separately with a C. trachomatis-specific probe and an N. gonorrhoeae-specific probe. Dotted line represents cutoffs of positivity. y-axis, RLU.
1434
MAHONY ET AL.
primers used for NASBA are standardized and do not differ from assay to assay. For PCR, the optimal annealing conditions, including temperature and primer concentration, must by determined to prevent nonspecific priming events. Because NASBA uses an isothermal amplification at 41°C, the optimal annealing temperature for primers does not have to be determined emperically. Nonspecific annealing of primers to the target nucleic acid is controlled for at the detection level by using a specific capture probe for ECL. The only variable that has to be optimized with NASBA is the KCl concentration, and this is easily done in a single experiment using a KCl concentration range of 50 to 120 mM. Most targets will have optimal KCl concentrations between 70 and 90 mM. In our hands, NASBA for both C. trachomatis and N. gonorrhoeae had an optimal KCl concentration of 90 mM, which facilitated coamplification of both targets in a multiplex format using both sets of NASBA primers. We have used PCR primers for NASBA on several occasions with good results by simply adding the T7 promoter sequence to one primer. This was the case in the present study, in which the same primers were used for both PCR and NASBA for both C. trachomatis and N. gonorrhoeae. The Basic Kit assays for C. trachomatis and N. gonorrhoeae had excellent analytical sensitivity and clinical performance. As mentioned above, both assays detected one viable bacterial cell. This may be an underestimation of the sensitivity since chlamydial counts determined by immunofluorescent staining with a monoclonal antibody often exceed IFU counts due to the presence of nonviable bacteria; furthermore, nonviable cells contain 16S rRNA. The Basic Kit detected 100 molecules of 16S rRNA, and in some experiments a sensitivity of 10 copies was achieved. In the only other published report on NASBA for C. trachomatis, Morre´ et al. compared the sensitivities of three different targets of amplification. The cryptic plasmid and omp1 targets had a detection limit of 1 IFU of C. trachomatis, while NASBA for 16S rRNA was 10-fold more sensitive than either the plasmid or the omp1 assay and 10-fold more sensitive than PCR (17). In their hands, NASBA detected 10 to 100 molecules of 16S rRNA, which is the same sensitivity that we obtained. A level of sensitivity of one bacterium for NASBA compares favorably with that of other amplification methods, including PCR and LCR (14). Based on results obtained with 216 genital swab specimens, the Basic Kit had sensitivities of 97.9% for N. gonorrhoeae and 100% for C. trachomatis. Several studies evaluating commercially available PCR, LCR, and transcription-mediated amplification tests for C. trachomatis reported sensitivities between 90 and 98% when an expanded reference standard was used (3, 6, 7, 9, 10). Using the Basic Kit, we were able to detect C. trachomatis and N. gonorrhoeae with similar sensitivities. The Basic Kit also detected C. trachomatis and N. gonorrhoeae present in the same specimen with the use of a multiplex NASBA employing two sets of primers. Recently developed coamplification assays employing PCR and LCR have been evaluated for the detection of both organisms. Commercially available coamplification assays have been evaluated in symptomatic men and women with moderate to high prevalence of C. trachomatis infection who attended a sexually transmitted disease clinic, and these assays have performed with good sensitivity and specificity (3, 10, 27). We have used the Basic Kit to detect bacteria other than
J. CLIN. MICROBIOL.
C. trachomatis and N. gonorrhoeae such as Chlamydia pneumoniae and Mycoplasma pneumoniae, as well as viruses such as human papillomavirus. We have used NASBA to both detect and quantitate C. trachomatis 16S rRNA (24) in clinical specimens and C. pneumoniae ompA mRNA levels during the chlamydial replication cycle (8). Quantitation of ompA and hsp60 mRNAs by using the Basic Kit platform may provide a useful molecular tool for studying latent chlamydial infections in those with chronic diseases. In summary, the NucliSens Basic Kit offers a convenient platform for the development of sensitive assays for detection of sexually transmitted infections by such organisms as C. trachomatis and N. gonorrhoeae. The excellent sensitivity and specificity obtainable with the Basic Kit assays and the availability of over 60 different assay protocols on the Basic Kit website indicate that this kit is suitable for widespread usage in both research and clinical settings. ACKNOWLEDGMENTS We thank Organon Teknika for providing Basic Kits for this study. We are grateful to Pierre van Aarle for advice on the design of probes and primers for NASBA amplification. REFERENCES 1. Anonymous. 1994. A new approach to STD control and AIDS prevention, p. 13–15. In Global AIDS News—Newsletter of the World Health Organization Global Program on AIDS, no. 4. World Health Organization, Geneva, Switzerland. 2. Boom, R., C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheimvan Dillen, and J. van der Noordaa. 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495–503. 3. Carroll, K. C., W. E. Aldeen, M. Morrison, R. Anderson, D. Lee, and S. Mottice. 1998. Evaluation of the Abbott LCx ligase chain reaction assay for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in urine and genital swab specimens from a sexually transmitted disease clinic population. J. Clin. Microbiol. 36:1630–1633. 4. Centers for Disease Control and Prevention. 1993. Recommendations for the prevention and management of Chlamydia trachomatis infections. Morbid. Mortal. Weekly Rep. 42:1–9. 5. Chernesky, M. A., D. Jang, H. Lee, J. D. Burezak, H. Hu, J. Sellors, S. J. Tomazic-Allen, and J. B. Mahony. 1994. Diagnosis of Chlamydia trachomatis infections in men and women by testing first-void urine by ligase chain reaction. J. Clin. Microbiol. 32:2682–2685. 6. Chernesky, M. A., D. Jang, J. Sellors, K. Luinstra, S. Chong, S. Castriciano, and J. B. Mahony. 1997. Urinary inhibitors of polymerase chain reaction and ligase chain reaction and testing of multiple specimens may contribute to lower assay sensitivities for diagnosing Chlamydia trachomatis infected women. Mol. Cell. Probes 11:243–249. 7. Chernesky, M. A., S. Chong, D. Jang, K. Luinstra, J. Sellors, and J. B. Mahony. 1997. Ability of commercial ligase chain reaction and PCR assays to diagnose Chlamydia trachomatis infections in men by testing first-void urine. J. Clin. Microbiol. 35:982–984. 8. Coombes, B., and J. B. Mahony. 2000. Nucleic acid sequence based amplification (NASBA) of Chlamydia pneumoniae major outer membrane protein (ompA) mRNA with bioluminescent detection. Comb. Chem. High Throughput Screen. 3:273–286. 9. Crotchfelt, K. A., L. E. Welsh, D. DeBonville, M. Rosenstraus, and T. C. Quinn. 1997. Detection of Neisseria gonorrhoeae and Chlamydia trachomatis in genitourinary specimens from men and women by a coamplification PCR assay. J. Clin. Microbiol. 35:1536– 1540. 10. Crotchfelt, K. A., B. Pare, C. Gaydos, and T. C. Quinn. 1998. Detection of Chlamydia trachomatis by the Gen-Probe AMPLIFIED Chlamydia Trachomatis Assay (AMP CT) in urine specimens from men and women and endocervical specimens from women. J. Clin. Microbiol. 36:391–394. 11. De Schryver, A., and A. Meheus. 1990. Epidemiology of sexually transmitted diseases: the global picture. Bull. W. H. O. 68:639–654. 12. Kievits, T., B. van Gemen, D. van Strijp, R. Schukkink, M. Dircks, H. Adriaanse, L. Malek, R. Sooknanan, and P. Lens. 1991. NASBATM isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J. Virol. Methods 35:273–286. 13. Landis, S. J., I. O. Stewart, M. A. Chernesky, J. B. Mahony, A. I. Cunningham, M. N. Grenier-Landis, and W. E. Seidelman. 1988. Value of the gramstained urethral smear in the management of men with urethritis. Sex. Transm. Dis. 15:78–84.
VOL. 39, 2001 14. Mahony, J. B., K. E. Luinstra, M. Tyndall, J. W. Sellors, J. Krepel, and M. Chernesky. 1995. Multiplex PCR for detection of Chlamyia trachomatis and Neisseria gonorrhoeae in genitourinary specimens. J. Clin. Microbiol. 33: 3049–3053. 15. Mahony, J. B., D. Jang, S. Chong, K. Luinstra, J. Sellors, M. Tyndall, and M. Chernesky. 1997. Detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, and Mycoplasma genitalium in first-void urine specimens by multiplex polymerase chain reaction. Mol. Diagn. 2:161– 168. 16. Mahony, J. B., S. Chong, D. Jang, K. Luinstra, M. Faught, D. Dalby, J. Sellors, and M. Chernesky. 1998. Urine specimens from pregnant and nonpregnant women inhibitory to amplification of Chlamydia trachomatis nucleic acid by PCR, ligase chain reaction, and transcription-mediated amplification: identification of urinary substances associated with inhibition and removal of inhibitory activity. J. Clin. Microbiol. 36:3122–3126. 17. Morre´, S. A., P. Sillekens, M. V. Jacobs, P. van Aarle, S. de Blok, B. van Gemen, J. M. M. Walboomers, C. J. L. M. Meijer, and A. J. C. van den Brule. 1996. RNA amplification by nucleic acid sequence-based amplification with an internal standard enables reliable detection of Chlamydia trachomatis in cervical scrapings and urine samples. J. Clin. Microbiol. 34:3108–3114. 18. Morre´, S. A., P. T. Sillekens, M. V. Jacobs, S. de Blok, J. M. Ossewaarde, P. van Aarle, B. van Gemen, J. M. Walboomers, C. J. Meijer, and A. J. van den Brule. 1998. Monitoring of Chlamydia trachomatis infections after antibiotic treatment using RNA detection by nucleic acid sequence based amplification. Mol. Pathol. 51:149–154. 19. Pasternack, R., P. Vuorinen, T. Pitka ¨ja ¨rvi, M. Koskela, and A. Miettinen. 1997. Comparison of manual Amplicor PCR, Cobas Amplicor PCR, and LCx assays for detection of Chlamydia trachomatis infection in women by using urine specimens. J. Clin. Microbiol. 35:402–405. 20. Pudjiatmoko, H. Fukushi, Y. Ochiai, T. Yamaguchi, and K. Hirai. 1997. Phylogenetic analysis of the genus Chlamydia based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47:425– 431. 21. Rossau, R., L. Heyndrickx, and H. Van Heuverswyn. 1988. Nucleotide se-
DETECTION OF STDs WITH NucliSens
22. 23.
24. 25.
26.
27.
28.
29. 30.
1435
quence of a 16S ribosomal RNA gene from Neisseria gonorrhoeae. Nucleic Acids Res. 16:6227–6232. Schachter, J., W. E. Stamm, T. C. Quinn, W. W. Andrews, J. D. Burczak, and H. H. Lee. 1994. Ligase chain reaction to detect Chlamydia trachomatis infection of the cervix. J. Clin. Microbiol. 32:2540–2543. Smith, K. R., S. Ching, H. Lee, Y. Ohhashi, H.-Y. Hu, H. C. Fisher III, and E. W. Hook III. 1995. Evaluation of ligase chain reaction for use with urine for identification of Neisseria gonorrhoeae in females attending a sexually transmitted disease clinic. J. Clin. Microbiol. 33:455–457. Song, X., B. Coombes, and J. B. Mahony. 2000. Quantitation of Chlamydia trachomatis 16S rRNA using NASBA amplification and a bioluminescent microtitre plate assay. Comb. Chem. High Throughput Screen. 3:341–351. Stary, A., E. Schuh, M. Kerschbaumer, B. Go¨tz, and H. Lee. 1998. Performance of transcription-mediated amplification and ligase chain reaction assays for detection of chlamydial infection in urogenital samples obtained by invasive and noninvasive methods. J. Clin. Microbiol. 36:2666–2670. Steingrimsson, O., K. Jonsdottir, J. H. Olafsson, S. M. Karlsson, R. Palsdottir, and S. Davidsson. 1998. Comparison of Roche Cobas Amplicor and Abbott LCx for the rapid detection of Chlamydia trachomatis in specimens from high-risk patients. Sex. Transm. Dis. 25:44–48. Van Der Pol, B., T. C. Quinn, C. A. Gaydos, K. Crotchfelt, J. Schachter, J. Moncada, D. Jungkind, D. H. Martin, B. Turner, C. Peyton, and R. B. Jones. 2000. Multicenter evaluation of the AMPLICOR and automated COBAS AMPLICOR CT/NG tests for detection of Chlamydia trachomatis. J. Clin. Microbiol. 38:1105–1112. Verkooyen, R. P., A. Luijendijk, W. M. Huisman, W. H. F. Goessens, J. A. J. W. Kluytmans, J. H. van Rijsoort-Vos, and H. A. Verbrugh. 1996. Detection of PCR inhibitors in cervical specimens by using the AMPLICOR Chlamydia trachomatis assay. J. Clin. Microbiol. 34:3072–3074. Washington, A. E., R. E. Johnson, and L. L. Sanders. 1987. Chlamydia trachomatis infections in the United States: what are they costing us? JAMA 257:2070–2072. World Health Organization. 1995. World Health Organization: bridging the gaps. World Health Organization, Geneva, Switzerland.
