Evidence for a Role of the Ubiquitin-Proteasome Pathway in ...

Original Article Evidence for a Role of the Ubiquitin-Proteasome Pathway in Pancreatic Islets Marıá D. Lo´pez-Avalos, Vale´rie F. Duvivier-Kali, Gang Xu, Susan Bonner-Weir, Arun Sharma, and Gordon C. Weir

The ubiquitin-proteasome pathway is crucial for protein turnover. Part of the pathway involves deubiquitination, which is carried out by cystein proteases known as ubiquitin COOH-terminal hydrolases. The isoform Uch-L1 was found to be present in large amounts in rat islets by immunostaining, Western blot analysis, and RT-PCR. Culturing islets in high glucose concentrations (16.7 mmol/l) for 24 h led to decreased gene expression. Exposure to chronic hyperglycemia following 90% partial pancreatectomy also led to reduced Uch-L1 expression. Expression of other members of the ubiquitin-proteasome pathway studied after culturing islets at high glucose concentrations revealed little change except for modest declines in parkin, human ubiquitin-conjugating enzyme 5 (UbcH5), and ␤-TRCP (transducin repeat– containing protein). With the pancreatectomy model, expression of polyubiquitin-B and c-Cbl were increased and E6-associated protein was reduced. Further insight about the proteasome pathway was obtained with the proteasome inhibitor lactacystin, which in short-term 2-h experiments enhanced glucose-induced insulin secretion. An important role for the ubiquitinproteasome pathways in ␤-cells is suggested by the findings that changes in glucose concentration influence expression of genes in the pathway and that blockade of the proteasome degradation machinery enhances glucose-stimulated insulin secretion. Diabetes 55:1223–1231, 2006

D

uring the past years, the ubiquitin-proteasome pathway has emerged as crucial machinery for protein turnover. It participates in the regulation of multiple cellular processes such as proliferation, differentiation, signal transduction, transcriptional regulation, and stress response (1,2). Ubiquitin is a small protein covalently linked to other

cellular proteins, thus targeting them for degradation in the proteasome (3,4). Ubiquitination has been considered a posttranslational modification such as phosphorylation (5,6). The ubiquitination reaction involves the sequential participation of three kinds of enzymes: a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme or ubiquitin-carrier enzyme (UCB or E2), and a ubiquitin protein ligase (E3) (1,2). The proteasome is a large multimeric enzymatic complex that includes several proteolytic activities (7). Protein degradation by the proteasome is ATP dependent and can be blocked by specific inhibitors (7). While the proteasome is the major protein degradation machinery, degradation occurs also in the lysosome. Other proteases, such as calpains and cathepsins, further contribute to the protein turnover. Important elements of the ubiquitination system are the deubiquitinating enzymes, which can remove ubiquitins from proteins, rescuing them from degradation or contributing to the regulatory function of the ubiquitin tag (8,9). The family of deubiquitinating enzymes, known as UCHs (ubiquitin COOH-terminal hydrolases) (10), include a few human isoenzymes (Uch-L1, L2, and L3) and some highly homologous proteins in other species (11,12). The UCH enzymes hydrolyze COOH-terminal esters and amides of ubiquitin. Their suggested physiological role is to hydrolyze small adducts of ubiquitin, thus generating free monomeric ubiquitin (13). Recent reports indicate that calpain proteases are involved in insulin secretion by ␤-cells and in insulin peripheral actions (14,15); there is some evidence of a relationship between the protease calpain-10 and type 2 diabetes (16). Moreover, the insulin-degrading enzyme, a peptidase involved in insulin cleavage, is inhibited by ubiquitin interaction (17). Also, the proteasome has been implicated in the interleukin-1␤–mediated suppression of islet function (18). ␤-Cells are particularly sensitive to hyperglycemia and oxidative stress (19), which triggers the activation of the ubiquitin-proteasome pathway, suggesting a potential importance of this pathway in ␤-cell dysfunction. In the present report, we demonstrate the expression of critical ubiquitin-proteasome pathway genes in pancreatic islets and the influence of glucose on their expression levels. In addition, the use of specific proteasome inhibitors provides data supporting the potential importance of the ubiquitin-proteasome pathway on glucose-stimulated insulin secretion.

From the Section on Islet Transplantation and Cell Biology, Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts. Address correspondence and reprint requests to Marıá D. Lo´pez-Avalos, PhD, Dpt. Biologıá Celular, Gene´tica y Fisiologıá, Facultad de Ciencias, Universidad de Ma´laga, Campus de Teatinos, Ma´laga 29071, Spain. E-mail: [email protected]. Received for publication 7 April 2005 and accepted in revised form 1 February 2006. M.D.L.-A. is currently affliated with the Departmento de Biologıá Celular, Gene´tica y Fisiologıá, Universidad de Ma´laga, Ma´laga, Spain; V.F.D.-K. is currently affiliated with Sanofi-Synthe´labo Recherche, Rueil-Malmaison, France; and G.X. is currently affiliated with LifeScan, Johnson & Johnson, Skillman, New Jersey. E6-AP, E6-associated protein; NF-␬B, nuclear factor-␬B; PKC, protein kinase C; PGP9.5, protein gene product 9.5; TRCP, transducin repeat– containing protein. DOI: 10.2337/db05-0450 © 2006 by the American Diabetes Association.

RESEARCH DESIGN AND METHODS

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Male Sprague-Dawley rats (Taconic Farms, Germantown, NY) weighing 90 –100 g were submitted to 90 or 60% pancreatectomy as previously described

DIABETES, VOL. 55, MAY 2006

1223

PROTEASOME PATHWAY IN PANCREATIC ISLETS

TABLE 1 Primers used for multiplex RT-PCR Multiplex group A (28 cycles)

Gene

Product Primer conc. size (bp) (nmol/l) Accession no.

Forward primer

Reverse primer

␣-tubulin E6-AP UbcH5 ␤-TRCP

CTCGCATCCACTTCCCTC ACTGGTCCGGCTAGAGATG GTGACCCTCCAGCACAATG CCAACTGACATCACCCTC

ATGCCCTCACCCACGTAC GTGAGAGTCTCCCAAGTCACG GGGGTCATCTGGGTTTGG AGCCTGTCTCTGTACTGC

451 358 311 197

100 400 40 400

J00797 NM_011668 NM_031237 AF112979

Cyclophilin Parkin c-Cbl Nedd4

AACCCCACCGTGTTCTTC TCAGAAGCAGCCAGAGGTC AGGTGGTGCGGTTGTGTC AGGCTGTTCAGTCGCCTC

TGCCTTCTTTCACCTTCCC TCTGAGGTTGGGTGTGCTC GTCTCCTTGGAAGAGTCC GCACAGGAAGTGTAGGCTG

400 266 338 186

40 400 200 100

M19533 AF257234 X57111 U50842

␣-tubulin Uch-L1

CTCGCATCCACTTCCCTC AACCCCGAGATGCTGAAC

ATGCCCTCACCCACGTAC GGCTGCCTGAATGGCCTC

451 400

200 100

J00797 NM_017237

TGCCTTCTTTCACCTTCCC TCACAAAGATCTGCATGCC* TCACAAAGATCTGCATGCC*

400 280 310

40 40/120 100/120

M19533 D17296 D16554

B (28 cycles)

C (26 cycles) D (23 cycles)

Cyclophilin AACCCCACCGTGTTCTTC Poly-Ub A TTTGTGAGGACTGCAGCC Poly-Ub B TGTGAGGGTGTTTCGACG

*As polyubiquitin genes A and B are quite similar, the reverse primer is the same for both. The reverse primer concentration is higher to accommodate both forward primers in the same PCR. (20). In sham-operated rats, the pancreas was manipulated with no removal of tissue. Islets were isolated 2 or 4 weeks after surgery. All animal procedures were done according to the guidelines of the Joslin Diabetes Center Animal Care Committee. Islet isolation. Rat islets were isolated according to a previously described method (21). Pancreatic tissue was digested with collagenase (Liberase RI; Roche Diagnostics, Indianapolis, IN). Islets were separated by centrifugation through Histopaque-1077 gradient (Sigma Chemical, St. Louis, MO) and further purified by hand picking. Islets from pancreatectomy experiments were immediately used for RNA isolation (22). Islets used for in vitro experiments were kept overnight in RPMI-1640 medium (Life Technologies, Grand Island, NY), 10% FCS (Mediatech, Herndon, VA), glutamine (2 mmol/l; Life Technologies), penicillin (100 IU/ml), and streptomycin (100 ␮g/ml). Islet culture. The next day, islets were washed with RPMI-1640 containing 2.8 mmol/l glucose and then aliquoted (125–200 islets) and cultured in low (2.8 mmol/l) or high (16.7 mmol/l) glucose for 2 or 24 h. Four experiments with parallel low- and high-glucose incubations were performed, including in each experiment three to four replicates of each culture condition. For glucose-stimulated insulin secretion experiments, the islets were preincubated in low-glucose RPMI for 2 h, adding the proteasome inhibitors 10 ␮mol/l lactacystin or 20 ␮mol/l MG-132 (Calbiochem, La Jolla, CA). Islets were then transferred to low- or high-glucose RPMI, with the mentioned proteasome inhibitors, for incubation during 2 or 24 h. Several experiments with different rat islet isolations were performed, with three to six replicates for each experiment. Incubations were done in 24-well culture plates, with 125–200 islets in 1 ml media. Following the same scheme, three experiments were performed, incubating the islets in the presence or absence of 10 ␮mol/l lactacystin and 1 ␮mol/l Go¨6976 (protein kinase C [PKC] inhibitor; Calbiochem), 2 mmol/l EGTA, or 10 mmol/l arginine (Sigma). Three repetitions of each culture condition were performed in each experiment, using 50 islets/0.5 ml with glucose stimulation lasting 2 h. After the glucose stimulation, media were collected for insulin quantification. Islets were used for either RNA isolation or insulin extraction, the latter with acidic ethanol. Insulin levels were quantified by radioimmunoassay. RNA isolation and reverse transcription. Total RNA was isolated from samples of 125–200 rat islets using the Trizol reagent as indicated by the manufacturer (Life Technologies). To obtain cDNA, reverse transcription was done in a 25-␮l reaction containing 0.5 ␮g total RNA, 50 mmol/l Tris (pH 8.3), 75 mmol/l KCl, 3 mmol/l MgCl2, 10 mmol/l dithiotreitol, 40 units RNasin (Promega), 1 mmol/l each dNTPs, 50 ng random hexamers, and 200 units Superscript-II RNaseH⫺ reverse transcriptase (Life Technologies). The reverse transcription reaction consisted of 10 min at 25°C, 42 min at 60°C, and 10 min at 95°C. At the end, 50 ␮l water was added to obtain 75 ␮l of a cDNA solution containing 10 ␮g RNA equivalents in a 1.5-␮l volume. PCR amplification. A semiquantitative multiplex radioactive PCR was used for evaluation of the levels of several transcripts (Table 1). In each case, PCR conditions were optimized in terms of primer concentration, number of 1224

cycles, and annealing temperature in order for the reaction to work within a linear range of amplification (22). Several genes along with an internal control (␣-tubulin or cyclophilin) were grouped for amplification in the same tube. Primers sequences, multiplex groups, and other PCR details are described in Table 1. The composition of the 25-␮l PCR was 1.5 mmol/l MgCl2, 200 ␮mol/l each dNTP, 40 – 400 nmol/l primers (Table 1), 1.5 ␮l cDNA, 2.5 units AmpliTaq-Gold DNA polymerase (Applied Biosystems, Foster City, CA), and 1.25 ␮Ci (3,000 Ci/mmol) ␣32P-dCTP (New England Nuclear, Boston, MA) in the GeneAmp PCR buffer provided with the enzyme. The PCR started with activation of the polymerase (10 min at 94°C). Cycles (Table 1) consisted of denaturing (1 min at 94°C), annealing (1 min at 58°C), and extension (1 min at 72°C). Five microliters of loading buffer were added, and a 10-␮l aliquot run in 6% polyacrylamide gel in Tris– boric acid–EDTA buffer. Dried gels were exposed to a Phosphorimager screen (Molecular Dynamics, Sunnyvale, CA) and the intensity of the bands quantified using the Image Quant software (Molecular Dynamics). The quantification of a particular band was expressed as a ratio with the corresponding internal control amplified in the same tube. Immunocytochemistry. Rat pancreata were fixed in 10% neutral formalin and embedded in paraffin. Sections, 5 ␮m each, were double stained using rabbit anti–protein gene product 9.5 (PGP9.5) (the isoform Uch-L1) 1:2,000 (Chemicon International, Temecula, CA) and guinea pig anti-insulin 1:200 (Linco Research, St. Charles, MO). PBS (pH 7.4) was used for all washes and antibody dilutions. Antigen retrieval was performed by microwaving the sections (1,000 W, 100% power, three times for 5 min) with 0.01 mol/l sodium citrate (pH 6.0). Nonspecific binding was blocked with 1.5% donkey serum. Primary antibodies were incubated overnight at 4°C. Anti– guinea pig IgG Texas-Red and anti-rabbit IgG fluorescein isothiocyanate diluted 1:200 (Jackson Immunoresearch, West Grove, PA) were incubated for 1 h at room temperature. Stained sections were mounted with 90% glycerol and 0.1 mol/l Dabco (Sigma). Images were captured with a Zeiss LSM 410 confocal microscope. Western blots. For protein extraction, rat tissues were homogenized in 80 mmol/l Tris-HCl (pH 6.8), 5% SDS, and the Complete cocktail of protease inhibitors (Roche, Mannheim, Germany). Protein concentration was estimated with bicinchoninic acid (Pierce, Rockford, IL). Twenty micrograms of protein aliquots were run in 12% SDS-PAGE and transferred onto polyvinylidine fluoride membrane (BioRad, Hercules, CA). The membrane was blocked for 2 h with 2% nonfat milk in TTBS (Tris-buffered saline with Tween: 0.9% NaCl, 100 mmol/l Tris [pH 7.5], 0.05% Tween 20), and anti-PGP9.5 1:2,000 (Chemicon International) was incubated for 1 h at room temperature. After washes with TTBS, anti-rabbit IgG– horseradish peroxidase 1:8,000 (Promega; Madison, WI) was incubated for 1 h at room temperature. The chemilunescent reaction was done with Reinassance ECL (Perkin Elmer, Boston, MA). Statistical analysis. Data are expressed as means ⫾ SE. The unpaired Student’s t test was used to compare gene expression levels in cultured islets exposed to low or high glucose and in islets isolated from pancreatectomized DIABETES, VOL. 55, MAY 2006

M.D. LO´PEZ-AVALOS AND ASSOCIATES

FIG. 1. Immunostaining of rat islets with antiPGP9.5/Uch-L1 (green) and anti-insulin (red). A and D: Insulin. B and E: PGP9.5. C and F: Merged. Insulin-positive cells in the core of the islets are costained with anti-PGP9.5. Stronger positive staining is also distinguished in mantle cells. Although the staining is mostly cytoplasmic, some positive nuclei can be seen.

or sham animals. Statistical significance for glucose-stimulated insulin secretion experiments was determined by ANOVA.

RESULTS

Expression of Uch-L1 in islets. Islet cells of the endocrine pancreas and neurons share many features, such as positive immunostaining with the neuroendocrine marker PGP9.5 (23–26), which has been identified as the isoform Uch-L1 (10). We studied the distribution of the Uch-L1 protein in paraffin sections of rat pancreas with an antiPGP9.5 antiserum. Strong anti-PGP9.5 staining was found only in endocrine islet cells, with no staining of the surrounding acinar tissue (Fig. 1). The staining was mostly cytoplasmic, although nuclear staining was also evident in some cells. Insulin-negative cells in the islet mantle were even more strongly stained than ␤-cells. To evaluate the level of expression of Uch-L1 in islets compared with other tissues, we performed Western blot and RT-PCR. The amount of the Uch-L1 protein in isolated islet extracts was similar to that in brain extracts (Fig. 2A). Testis extracts showed a less prominent band. No signal was detected in protein extracts from liver, kidney, spleen, heart, intestine, or pancreas. It is worth mentioning the absence of signal in total pancreas extracts compared with the strong band detected in isolated islets, which may result from dilution of endocrine-specific proteins within the whole organ extract. cDNA was prepared from total RNA extracted from different rat tissues to perform semiquantitative RT-PCR. Uch-L1 band was quantified and expressed relative to an internal control (␣-tubulin) and amplified in the same tube. The levels of Uch-L1 mRNA in brain, testis, and isolated islets were much higher than in liver, kidney, spleen, muscle, and pancreas (Fig. 2B), consistent with the protein levels determined by Western blot. Effect of glucose on Uch-L1 expression. Knowing the abundance of Uch-L1 in islets, attention was focused on the possible role of Uch-L1 on ␤-cell function. We determined the effect of glucose on Uch-L1 expression by RT-PCR in isolated cultured islets exposed to low (2.8 mmol/l) and high (16.7 mmol/l) glucose. Results of expression at basal 2.8 mmol/l glucose were designated as 100%. Uch-L1 expression did not change after 2-h exposure to DIABETES, VOL. 55, MAY 2006

high glucose (91 ⫾ 5%), but there was a significant decrease (54 ⫾ 6%) after 24-h exposure (Fig. 3A). To investigate the effect of chronic hyperglycemia in an in vivo system, we measured Uch-L1 mRNA levels in islets isolated from 90% pancreatectomized rats or from shamoperated animals. Plasma glucose measured in the fed state confirmed hyperglycemia in the pancreatectomy animals (251 ⫾ 24 vs. sham 78 ⫾ 2 mg/dl). Two weeks after surgery, the expression of Uch-L1 in islets from pancreatectomized rats was significantly reduced (60 ⫾ 9 vs. sham 100 ⫾ 8%) (Fig. 3B). Islets from animals 4 weeks after pancreatectomy still showed a reduced Uch-L1 expression

FIG. 2. Distribution of Uch-L1 transcript and protein in rat tissues. Using an anti-PGP9.5/Uch-L1 antibody, Western blot (A) shows the highest concentrations of Uch-L1 protein in brain (Br) and islets; a less intense band is detected in testis (Te). No bands were seen in liver (Li), kidney (Ki), spleen (Sp), heart (He), intestine (Int), or total pancreas (Pan). mRNA levels of Uch-L1 (B), measured by RT-PCR, were high in brain, testis, and islets but undetectable in liver, kidney, spleen, muscle, and total pancreas. 1225


FIG. 3. Influence of glucose on Uch-L1 expression in rat islets. A: Isolated islets were exposed to 2.8 or 16.7 mmol/l glucose for 2 or 24 h and then submitted to RT-PCR. Levels obtained in high glucose are expressed as a percentage of those found in low glucose. After 24 h in high glucose, the level of Uch-L1 mRNA was half of that found in islets at low glucose (n ⴝ 4 experiments, with 3– 4 replicates). B: Uch-L1 mRNA measured in islets from 90% pancreatectomized rats and shamoperated controls, 2 or 4 weeks after surgery. At both time points, the expression levels were significantly reduced in pancreatectomy islets. C: Same study performed with 60% pancreatectomized rats (4 weeks after pancreatectomy) resulted in a moderate but significant increase in Uch-L1 expression. Px, pancreatectomy. **P < 0.01, *P < 0.05.

(74 ⫾ 3 vs. sham 100 ⫾ 6%). These data indicate a downregulation of the Uch-L1 gene after long-term highglucose exposure. With the aim of dissecting the effect of hyperglycemia from that of the islet growth triggered by partial pancreatectomy, we used the 60% pancreatectomy model, in which the reduction of islet mass does not lead to hyperglycemia (20,27). In contrast to the reduction of Uch-L1 expression seen in islets from 90% hyperglycemic pancreatectomized rats, islets obtained from 60% pancreatectomized rats 4 weeks after surgery showed a slight but significant increase in Uch-L1 expression (130 ⫾ 4 vs. sham 100 ⫾ 3%) (Fig. 3C). 1226

Expression of other ubiquitin-proteasome pathway genes in rat islets. The numerous proteins involved in the ubiquitin-proteasome pathway are widely expressed and play important roles in a variety of cellular processes. To examine whether the glucose effect on Uch-L1 extended to other proteins in this pathway, we selected an array of genes to evaluate the possible influence of glucose on their expression levels in islets. So far, there are no studies of ubiquitin-proteasome pathway genes in pancreatic islets. A list of selected genes with a brief description of their functions is presented in Table 2. Isolated rat islets were used for total RNA isolation and semiquantitative RT-PCR analyses. Expression levels of each gene are presented relative to a housekeeping control gene amplified in the same tube (Table 1). Results are expressed as a percentage of the expression of the gene in islets incubated in basal (2.8 mmol/l) glucose. We did not detect any major change in the mRNA levels of any of the genes studied after 2-h incubation, although some (parkin, E6-associated protein [E6-AP], and human ubiquitin-conjugating enzyme 5 [UbcH5]) showed a slight tendency to decrease (Fig. 4A). A longer incubation (24 h) revealed that high glucose produced a significant decrease in the mRNA levels of parkin (49 ⫾ 7%), UbcH5 (62 ⫾ 4%), and ␤-TRCP (transducin repeat– containing protein; 73 ⫾ 4%); the decrease in E6-AP did not reach statistical significance. The levels of the transcripts for c-Cbl, Nedd4, and the polyubiquitin genes A and B remained unchanged (Fig. 4B). To investigate the influence of glucose in islets exposed for longer periods of time, we moved to the 90% pancreatectomy model of chronic hyperglycemia. For pancreatectomy islets isolated 4 weeks after surgery, polyubiquitin-B and c-Cbl mRNA levels were significantly increased (133 ⫾ 9 and 131 ⫾ 9%, respectively), while E6-AP expression was decreased (59 ⫾ 9%) (Fig. 5). As occurred with cultured islets exposed to high glucose, parkin and UbcH5 showed a tendency to be downregulated in pancreatectomy islets (54 ⫾ 18 and 71 ⫾ 8% respectively), although the changes were not significant. Glucose-stimulated insulin secretion and proteasome pathway blockade. The results shown above indicate the presence in islets of various ubiquitin pathway components and suggest that there could be an interaction between the glucose metabolism and the ubiquitin-proteasome pathway. We then questioned whether this pathway could have some role in glucose-stimulated insulin secretion. For this purpose, we used two inhibitors of the proteasome, MG-132 and lactacystin. MG-132 belongs to the peptide aldehyde group of proteasome inhibitors. Its inhibition is reversible but also affects other proteolytic activities such as lysosomal cysteine proteases and calpains. Lactacystin, an antibiotic isolated from actinomycetes, is much more specific (although it can also inhibit cathepsin-A) and inhibits proteasomal degradation binding covalently and irreversibly to the proteasome complex (7). Rat islets were incubated in RPMI with 2.8 or 16.7 mmol/l glucose during 2 or 24 h. When required by the experimental condition, lactacystin (10 ␮mol/l) or MG-132 (20 ␮mol/l) were present during these time periods. After 2-h incubation (Fig. 6A), lactacystin significantly increased the insulin released at high glucose (812 ⫾ 44 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) compared with glucose-stimulated islets without lactacystin (547 ⫾ 53 pg 䡠 islet–1 䡠 ml–1 䡠 h–1). Similar increases were found in separate sets of experiments (Fig. 7). At basal glucose, insulin secretion in the presence of DIABETES, VOL. 55, MAY 2006


TABLE 2 Ubiquitination genes evaluated by RT-PCR in rat islets Gene

Function

E6-AP

Human papilloma virus E6-AP; E3 ubiquitin ligase E2 ubiquitin conjugating enzyme

UbcH5 ␤-TRCP Parkin

Member of F-box protein family; E3 ubiquitin ligase E3 ubiquitin ligase

Substrates

Comments

Tumor suppressor protein p53 p105 precursor of p50 subunit of NF-␬B; mediates E6-AP–dependent ubiquitination of p53 Phosphorylated I␬B␣ and ␤-catenin

c-Cbl

Tyrosine kinase–negative regulator; E3 ubiquitin ligase

Vesicle protein CDCrel-1, synphilin-1, ␣-synuclein, Pael-R Activated receptors for EGF, PDGF, CSF-1, etc.

Nedd4

E3 ubiquitin ligase

ENaC (epithelial sodium channel)

Uch-L1

Member of UCH family of deubiquitinating enzymes Polyubiquitin Pro-protein containing tandem A and B repeats of ubiquitin

Unknown —

lactacystin (259 ⫾ 56 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) was not significantly different from that found with control islets (191 ⫾ 35 pg 䡠 islet–1 䡠 ml–1 䡠 h–1). In contrast, MG-132 did not increase the glucose-stimulated secretion (411 ⫾ 96 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) (Fig. 6A). We checked the viability of

Mutations can lead to Angleman syndrome Participates in NF-␬B activation Participates in NF-␬B activation Mutations lead to juvenile Parkinson´s disease Mediates receptor tyrosine kinase downregulation and signaling termination Mutations cause Liddle’s syndrome (a form of inherited hypertension) Mutations lead to Parkinson´s disease Upregulated in response to stress

References 42 44 2, 6 40, 41 45, 46

3 9, 36 31

the islets after the incubation and found that MG-132 was causing some cell death, while lactacystin exerted no visible adverse effect on islet viability (results not shown). Therefore, we decided to continue the study using only the more specific, less damaging agent lactacystin. When we

FIG. 4. RT-PCR quantification of ubiquitination gene transcripts in rat islets exposed to 2.8 or 16.7 mmol/l glucose for 2 h (A) or 24 h (B). Quantification of each gene is relative to an internal control gene amplified in the same tube. For each gene, 100% was assigned to the expression level in islets at 2.8 mmol/l glucose. After 24-h culture in high glucose, parkin, UbcH5, and ␤-TRCP expression was reduced. n ⴝ 4 experiments, with 3– 4 replicates. **P < 0.01, *P < 0.05. DIABETES, VOL. 55, MAY 2006

1227


FIG. 5. Quantification of ubiquitination gene transcripts in rat islets from 90% pancreatectomized (Px) animals and sham-operated controls. Islets isolated 4 weeks after surgery were processed for RT-PCR. For every gene, the quantified levels in sham islets were adjusted to 100%. Expression of polyubiquitin-B and c-Cbl was increased in pancreatectomy islets. Only E6-AP showed a significant decrease in expression in pancreatectomy islets. n ⴝ 4 animals. *P < 0.05.

prolonged the incubation period to 24 h (Fig. 6C), the basal insulin secretion in the absence of lactacystin was 118 ⫾ 11 pg 䡠 islet–1 䡠 ml–1 䡠 h–1, and glucose stimulated secretion up to 733 ⫾ 147 pg 䡠 islet–1 䡠 ml–1 䡠 h–1. In the presence of lactacystin, the basal insulin secretion was unaffected (96 ⫾ 12 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) but glucose-stimulated secretion decreased to about half (360 ⫾ 59 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) compared with that of control (733 ⫾ 147 pg 䡠 islet–1 䡠 ml–1 䡠 h–1). To check the possibility that lactacystin was causing depletion of insulin stores due to a toxic effect on ␤-cells, we measured the insulin content of the islets and found no difference between control (15.2 ⫾ 2.3 ng/islet) and lactacystin-treated (13.8 ⫾ 1.0 ng/islet) islets (Fig. 6B).

To determine which element of the insulin secretory machinery was affected by lactacystin, we performed glucose stimulation in the presence of the PKC inhibitor Go¨6976, the Ca2⫹ chelator EGTA, and the secretagogue amino acid arginine (Fig. 7). As previously observed, lactacystin increased the insulin secretion in glucosestimulated islets (741 ⫾ 88 vs. control 405 ⫾ 126 pg 䡠 islet–1 䡠 ml–1 䡠 h–1), but there was no significant difference when the stimulation was performed in the presence of Go¨6976 (891 ⫾ 90 pg 䡠 islet–1 䡠 ml–1 䡠 h–1). Likewise, EGTA (2 mmol/l) abolished glucose-stimulated insulin secretion in both lactacystin-treated (149 ⫾ 37 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) and control (190 ⫾ 105 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) islets. Moreover, using arginine (10 mmol/l) instead of glucose as

FIG. 6. Glucose-stimulated insulin release from rat islets during 2 h (A) or 24 h (C) in the presence of the proteasome inhibitors lactacystin (10 ␮mol/l) and MG-132 (20 ␮mol/l). Glucose stimulates insulin secretion in both control and lactacystin-treated islets but not in MG-132– treated islets. Under high-glucose exposure, lactacystin further enhances the secretion of insulin (A). The insulin content in islets after 2-h exposure to lactacystin was unchanged (B). After 24 h (C), lactacystin decreased the secretion of insulin. The number of independent experiments is specified in the figure, with 3– 6 replicates of each condition. ***P < 0.001, **P < 0.01, *P < 0.05. 1228



FIG. 7. Glucose-stimulated insulin secretion from rat islets in the presence of 10 ␮mol/l lactacystin and the PKC inhibitor Go¨6976 (1 ␮mol/l), the Ca2ⴙ chelator EGTA (2 mmol/l) (A), or the amino acid arginine (Arg) (10 mmol/l) (B). Stimulation of 50 islets/0.5 ml was performed for 2 h. While lactacystin enhancement of insulin release was not affected by Go¨6976, it was completely abolished by EGTA. When insulin secretion was stimulated with arginine instead of glucose (B), lactacystin did not increase insulin release. n ⴝ 3 experiments, with 3 replicates. **P < 0.01, *P < 0.05.

stimulus for insulin release (Fig. 7B), lactacystin did not increase secretion (315 ⫾ 57 pg 䡠 islet–1 䡠 ml–1 䡠 h–1) compared with control islets without lactacystin (316 ⫾ 61 pg 䡠 islet–1 䡠 ml–1 䡠 h–1). DISCUSSION

Because of the known importance of the ubiquitin-proteasome pathway, it is not surprising that this pathway could play a central role in ␤-cell physiology. Uch-L1 expression is highly restricted to the central and peripheral nervous system and dispersed neuroendocrine cells (23–25) but is present in other locations as well, including testis (24,28). It has been used as a marker for neuroendocrine tumors (29). In a mouse model of tumorigenesis, Power et al. (30) showed an increase in PGP9.5 staining in hyperplastic and neoplastic ␤-cells but no staining in normal islets, while other authors (26) report PGP9.5 in normal islets and duct cells during development and regeneration. Here we demonstrate the expression of Uch-L1 in islets by immnostaining, Western blot, and RT-PCR and show that the level of expression is as high as in brain. Furthermore, immunocytochemistry served to locate the protein in both ␤- and non–␤-cells, with seemingly higher expression in islet non–␤-cells. The decrease observed in Uch-L1 expression in islets exposed to high glucose either in tissue culture (shortterm exposure) or in 90% pancreatectomized rats (chronic exposure) indicates a regulation depending on the physiologic status of the endocrine cells. In the 90% pancreatectomy model, a similar decrease of other key ␤-cell genes has been previously reported (22). In contrast, in 60% pancreatectomized rats, which do not become hyperglycemic, we observed a slight increase in Uch-L1 expression. The 60% pancreatectomy is a model of ␤-cell adaptation and growth (27); Uch-L1 overexpression could be related to such processes, as its expression has been reported in pancreas development and regeneration (26) and in neoplastic ␤-cells (30). Several human neurodegenerative diseases are characterized by the formation of inclusion bodies in the brain, which frequently contain both ubiquitin and Uch-L1 (31). It has been suggested that under a continuous stress, the proteasome pathway in neurons would be saturated and unable to dispose of defective proteins, resulting in their accumulation and formation of plaques (32). Similarly, in type 2 diabetes, some islets contain amyloid deposits that may contribute to ␤-cell destruction (33). Interestingly, in DIABETES, VOL. 55, MAY 2006

insulinomas, the amyloid deposits are also ubiquitin positive (34). The gad mouse, which carries a mutation in the Uch-L1 gene, suffers from axonal dystrophy (35), but no description of its glycemic status has been reported. Furthermore, a few cases of familial Parkinson’s disease are due to mutations in the Uch-L1 gene (36). The results obtained with Uch-L1 prompted us to investigate other ubiquitin-proteasome pathway genes in islets. Although none of these genes were previously reported to be expressed in islets, some of them are quite ubiquitous (c-Cbl and ␤-TRCP), while others are more tissue specific (parkin is mostly expressed in certain brain areas) (37). The polyubiquitin genes are rapidly activated in stress situations. In our experiments, their expression levels did not change in cultured islets, a situation reported not to activate antioxidant genes (38), but they were upregulated in islets from 90% pancreatectomized animals, a hyperglycemic situation associated with an islet stress response (19,39). Similarly to Uch-L1, parkin was initially discovered as a gene linked to some forms of Parkinson’s disease (40); it is an E3 ubiquitin ligase (41) mostly expressed in the nervous system. E6-AP is also an E3 ubiquitin ligase that is mutated in another neurological disorder, the Angleman syndrome (42). The ubiquitin-proteasome pathway is crucial in regulating the activation of the transcription factor complex nuclear factor-␬B (NF-␬B). The ubiquitinating enzymes UbcH5 and ␤-TRCP are directly involved in NF-␬B activation (6,43,44). NF-␬B is activated in pancreatic islets during chronic hyperglycemia after 90% pancreatectomy (19). We observed no change of UbcH5 and ␤-TRCP levels in 90% pancreatectomy; the relationship between this finding and the NF-␬B activation is unclear. Thus, we find that four genes (Uch-L1, parkin, E6-AP, and UbcH5) of the ubiquitin-proteasome pathway, with regulatory functions of different cellular processes, are expressed in islets and downregulated after high-glucose exposure, suggesting a role of this pathway in islet physiology and more specifically in the hyperglycemia-associated stress response. The c-Cbl protein (E3 ligase) (45) promotes ubiquitination and internalization of activated receptor tyrosine kinases, thus terminating signaling (46). We found a modest increase in the expression of c-Cbl in islets exposed to high glucose, indicating that it could influence insulin signaling pathways in ␤-cells. Apart from our gene expression studies, we also investigated the effect of proteasome inhibitors on glucose1229


stimulated insulin secretion. In short-term experiments (2 h), the proteasome inhibitor lactacystin enhanced glucosestimulated insulin secretion. The opposite effect was obtained in long-term experiments (24 h), which we attribute to the toxicity of the agent, as the proteasome is implicated in a huge variety of processes. Some recent studies using several protease inhibitors report a similar enhancement of insulin release from islets in short-term experiments (14) but a suppression of insulin release after 48-h exposure of islets to inhibitors (15). The authors concluded that calpains are responsible for these effects, playing a role in insulin secretion and action and participating in the pathophysiology of type 2 diabetes. Lactacystin is one of the most specific proteasome inhibitors (although it has also some cathepsin activity) (7). Therefore, we suggest that the increased insulin secretion observed in our experiments is related to the proteasome inactivation. Kalbe et al. (47) also observed an increase in insulin secretion from fetal islets exposed to lactacystin. However, another recent report (48) demonstrates that lactacystin decreases insulin release from islets exposed to high glucose without affecting the total insulin content. The same work shows that lactacystin decreases insulin synthesis and favors its degradation. Despite the opposite results regarding insulin release at high glucose found by these authors versus ours, all these data clearly point toward a role of the proteasome pathway in the regulation of insulin turnover and release by islets. In Alzheimer’s disease, an increase in the maturation and secretion of the ␤-amyloid precursor was found in cells exposed to lactacystin, suggesting that the proteasome pathway is responsible for maintaining levels of presenilins 1 and 2, which are involved in the maturation of the ␤-amyloid precursor protein (49). Interestingly, the ubiquitin-proteasome pathway also has a regulatory role in the endocytic pathway and in vesicle biogenesis and trafficking (4,50). In an attempt to determine which element of the insulin secretion was affected by lactacystin, we used a PKC inhibitor, a Ca2⫹ chelator, and the secretagogue arginine. PKC modulates the glucose-stimulated insulin secretion by islets (51). Interestingly, activators of PKC trigger its ubiquitination and degradation by the proteasome, thus serving as a downregulation mechanism (52). In spite of these potential relationships, our results indicate that the lactacystin enhancement of insulin release is not directly related to PKC. Moreover, the lactacystin effect is Ca2⫹ dependent, as it was abolished in the presence of EGTA, and is linked to glucose stimulation but not arginine stimulation of secretion. This work presents novel evidence for a potentially important role of the ubiquitin-proteasome pathway in islets. We find that blockade of the proteasome degradation machinery enhances glucose-stimulated insulin secretion. As this and other studies show, the proteasome seems to participate in insulin secretion and turnover. The effect of glucose on the expression of certain genes of this pathway raises questions of their involvement in the ␤-cell adaptation and decompensation found in different stages of diabetes. We hope these results lead to future studies aimed to elucidate the regulatory function of the ubiquitinproteasome pathway in pancreatic islet cells. 1230

ACKNOWLEDGMENTS

This study was supported by grants from the National Institutes of Health (DK35449 to G.C.W.), the Juvenile Diabetes Research Foundation, the Diabetes Research and Wellness Foundation, and an important group of private donors. Help was also provided by the Islet Core of the Juvenile Diabetes Research Foundation Center for Islet Transplantation at Harvard Medical School and the Joslin Diabetes and Endocrinology Research Center, supported by the National Institutes of Health (P30 DK36836-16). M.D.L.-A. was a recipient of a Mentor-Based Fellowship from The American Diabetes Association. V.F.D.-K. was supported by a research fellowship from the Juvenile Diabetes Research Foundation. REFERENCES 1. Hershko A, Ciechanover A: The ubiquitin system. Annu Rev Biochem 67:425– 479, 1998 2. Weissman AM: Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2:169 –178, 2001 3. Hicke L: Gettin’ down with ubiquitin: turning off cell-surface receptors, transporters and channels. Trends Cell Biol 9:107–112, 1999 4. Strous GJ, Govers R: The ubiquitin-proteasome system and endocytosis. J Cell Sci 112:1417–1423, 1999 5. Koepp DM, Harper JW, Elledge SJ: How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 97:431– 434, 1999 6. Laney JD, Hochstrasser M: Substrate targeting in the ubiquitin system. Cell 97:427– 430, 1999 7. Lee DH, Goldberg AL: Proteasome inhibitors: valuable new tools for cell biologists. Trends Cell Biol 8:397– 403, 1998 8. Lam YA, Xu W, DeMartino GN, Cohen RE: Editing of ubiquitin conjugates by an isopeptidase in the 26S proteasome. Nature 385:737–740, 1997 9. Wilkinson KD: Ubiquitination and deubiquitination: targeting of proteins for degradation by the proteasome. Semin Cell Dev Biol 11:141–148, 2000 10. Wilkinson KD, Lee KM, Deshpande S, Duerksen-Hughes P, Boss JM, Pohl J: The neuron-specific protein PGP 9.5 is a ubiquitin carboxyl-terminal hydrolase. Science 246:670 – 673, 1989 11. Jentsch S: A pseudogene for a novel ubiquitin C-terminal hydrolase of S. cerevisiae. Nucleic Acid Res 19:1147, 1991 12. Zhang N, Wilkinson K, Bownes M: Cloning and analysis of expression of a ubiquitin carboxyl terminal hydrolase expressed during oogenesis in Drosophila melanogaster. Dev Biol 157:214 –223, 1993 13. Larsen CN, Krantz BA, Wilkinson KD: Substrate specificity of deubiquitinating enzymes: ubiquitin C-terminal hydrolases. Biochemistry 37:3358 – 3368, 1998 14. Sreenan SK, Zhou Y-P, Otani K, Hansen PA, Currie KPM, Pan C-Y, Lee J-P, Ostrega DM, Pugh W, Horikawa Y, Cox NJ, Hanis CL, Burant CF, Fox AP, Bell GI, Polonsky KS: Calpains play a role in insulin secretion and action. Diabetes 50:2013–2020, 2001 15. Zhou YP, Sreenan S, Pan CY, Currie KP, Bindokas VP, Horikawa Y, Lee JP, Ostrega D, Ahmed N, Baldwin AC, Cox NJ, Fox AP, Miller RJ, Bell GI, Polonsky KS: A 48-hour exposure of pancreatic islets to calpain inhibitors impairs mitochondrial fuel metabolism and the exocytosis of insulin. Metabolism 52:528 –534, 2003 16. Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PE, del Bosque-Plata L, Oda Y, Yoshiuchi I, Colilla S, Polonsky KS, Wei S, Concannon P, Iwasaki N, Schulze J, Baier LJ, Bogardus C, Groop L, Boerwinkle E, Hanis CL, Bell GI: Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet 26:163–175, 2000 17. Saric T, Muller D, Seitz HJ, Pavelic K: Non-covalent interaction of ubiquitin with insulin-degrading enzyme. Mol Cell Endocrinol 204:11–20, 2003 18. Sternesjo J, Karlsen AE, Sandler S: Involvement of the proteasome in IL-1beta induced suppression of islets of Langerhans in the rat. Ups J Med Sci 108:37–50, 2003 19. Laybutt DR, Kaneto H, Hasenkamp W, Grey S, Jonas J-C, Sgroi DC, Groff A, Ferran C, Bonner-Weir S, Sharma A, Weir GC: Increased expression of antioxidant and antiapoptotic genes in islets that may contribute to ␤-cell survival during chronic hyperglycemia. Diabetes 51:413– 423, 2002 20. Leahy JL, Bonner-Weir S, Weir GC: Minimal chronic hyperglycemia is a critical determinant of impaired insulin secretion after an incomplete pancreatectomy. J Clin Invest 81:1407–1414, 1988 21. Gotoh M, Maki T, Satomi S, Porter J, Bonner-Weir S, O’Hara CJ, Monaco DIABETES, VOL. 55, MAY 2006


AP: Reproducible high yield of rat islets by stationary in vitro digestion following pancreatic ductal or portal venous collagenase injection. Transplantation 43:725–730, 1987 22. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J Biol Chem 274:14112–14121, 1999 23. Day IN, Thompson RJ: Molecular cloning of cDNA coding for human PGP 9.5 protein: a novel cytoplasmic marker for neurones and neuroendocrine cells. FEBS Lett 210:157–160, 1987 24. Kajimoto Y, Hashimoto T, Shirai Y, Nishino N, Kuno T, Tanaka C: cDNA cloning and tissue distribution of a rat ubiquitin carboxyl-terminal hydrolase PGP9.5. J Biochem (Tokyo) 112:28 –32, 1992 25. Thompson RJ, Doran JF, Jackson P, Dhillon AP, Rode J: PGP 9.5: a new marker for vertebrate neurons and neuroendocrine cells. Brain Res 278:224 –228, 1983 26. Yokoyama-Hayashi K, Takahashi T, Kakita A, Yamashina S: Expression of PGP9.5 in ductal cells of the rat pancreas during development and regeneration: can it be a marker for pancreatic progenitor cells? Endocr J 49:61–74, 2002 27. Liu YQ, Nevin PW, Leahy JL: Beta-cell adaptation in 60% pancreatectomy rats that preserves normoinsulinemia and normoglycemia. Am J Physiol Endocrinol Metab 279:E68 –E73, 2000 28. Wilson PO, Barber PC, Hamid QA, Power BF, Dhillon AP, Rode J, Day IN, Thompson RJ, Polak JM: The immunolocalization of protein gene product 9.5 using rabbit polyclonal and mouse monoclonal antibodies. Br J Exp Pathol 69:91–104, 1988 29. Rode J, Dhillon AP, Doran JF, Jackson P, Thompson RJ: PGP 9.5, a new marker for human neuroendocrine tumours. Histopathology 9:147–158, 1985 30. Power RF, Holm R, Bishop AE, Varndell IM, Alpert S, Hanahan D, Polak JM: Transgenic mouse model: a new approach for the investigation of endocrine pancreatic B-cell growth. Gut 28:121–129, 1987 31. Lowe J, McDermott H, Landon M, Mayer RJ, Wilkinson KD: Ubiquitin carboxyl-terminal hydrolase (PGP 9.5) is selectively present in ubiquitinated inclusion bodies characteristic of human neurodegenerative diseases. J Pathol 161:153–160, 1990 32. Alves-Rodrigues A, Gregori L, Figueiredo-Pereira ME: Ubiquitin, cellular inclusions and their role in neurodegeneration. Trends Neurosci 21:516 – 520, 1998 33. Hull RL, Westermark GT, Westermark P, Kahn SE: Islet amyloid: a critical entity in the pathogenesis of type 2 diabetes. J Clin Endocrinol Metab 89:3629 –3643, 2004 34. O’Brien TD, Butler AE, Roche PC, Johnson KH, Butler PC: Islet amyloid polypeptide in human insulinomas: evidence for intracellular amyloidogenesis. Diabetes 43:329 –336, 1994 35. Saigoh K, Wang YL, Suh JG, Yamanishi T, Sakai Y, Kiyosawa H, Harada T, Ichihara N, Wakana S, Kikuchi T, Wada K: Intragenic deletion in the gene encoding ubiquitin carboxy-terminal hydrolase in gad mice. Nat Genet 23:47–51, 1999


36. Leroy E, Boyer R, Auburger G, Leube B, Ulm G, Mezey E, Harta G, Brownstein MJ, Jonnalagada S, Chernova T, Dehejia A, Lavedan C, Gasser T, Steinbach PJ, Wilkinson KD, Polymeropoulos MH: The ubiquitin pathway in Parkinson’s disease. Nature 395:451– 452, 1998 37. Huynh DP, Dy M, Nguyen D, Kiehl TR, Pulst SM: Differential expression and tissue distribution of parkin isoforms during mouse development. Brain Res Dev Brain Res 130:173–181, 2001 38. Tiedge M, Lortz S, Drinkgern J, Lenzen S: Relation between antioxidant enzyme gene expression and antioxidative defense status of insulinproducing cells. Diabetes 46:1733–1742, 1997 39. Ihara Y, Toyokuni S, Uchida K, Odaka H, Tanaka T, Ikeda H, Hiai H, Seino Y, Yamada Y: Hyperglycemia causes oxidative stress in pancreatic ␤-cells of GK rats, a model of type 2 diabetes. Diabetes 48:927–932, 1999 40. Haass C, Kahle PJ: Neuroscience: parkin and its substrates. Science 293:224 –225, 2001 41. Shimura H, Hattori N, Kubo S, Mizuno Y, Asakawa S, Minoshima S, Shimizu N, Iwai K, Chiba T, Tanaka K, Suzuki T: Familial Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nat Genet 25:302–305, 2000 42. Matsuura T, Sutcliffe JS, Fang P, Galjaard RJ, Jiang YH, Benton CS, Rommens JM, Beaudet AL: De novo truncating mutations in E6-AP ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet 15:74 –77, 1997 43. Palombella VJ, Rando OJ, Goldberg AL, Maniatis T: The ubiquitin-proteasome pathway is required for processing the NF- kappa B1 precursor protein and the activation of NF-kappa B. Cell 78:773–785, 1994 44. Scheffner M, Huibregtse JM, Howley PM: Identification of a human ubiquitin-conjugating enzyme that mediates the E6-AP-dependent ubiquitination of p53. Proc Natl Acad Sci U S A 91:8797– 8801, 1994 45. Joazeiro CA, Wing SS, Huang H, Leverson JD, Hunter T, Liu YC: The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase. Science 286:309 –312, 1999 46. Thien CB, Langdon WY: Cbl: many adaptations to regulate protein tyrosine kinases. Nat Rev Mol Cell Biol 2:294 –307, 2001 47. Kalbe L, Leunda A, Sparre T, Meulemans C, Ahn MT, Orntoft T, Kruhoffer M, Reusens B, Nerup J, Remacle C: Nutritional regulation of proteases involved in fetal rat insulin secretion and islet cell proliferation. Br J Nutr 93:309 –316, 2005 48. Kitiphongspattana K, Mathews CE, Leiter EH, Gaskins HR: Proteasome inhibition alters glucose-stimulated (pro)insulin secretion and turnover in pancreatic {beta}-cells. J Biol Chem 280:15727–15734, 2005 49. Checler F, da Costa CA, Ancolio K, Chevallier N, Lopez-Perez E, Marambaud P: Role of the proteasome in Alzheimer’s disease. Biochim Biophys Acta 1502:133–138, 2000 50. Hicke L: A new ticket for entry into budding vesicles-ubiquitin. Cell 106:527–530, 2001 51. Henquin JC: Cell biology of insulin secretion. In Joslin Diabetes Mellitus. Kahn CR, Weir GC, Eds. Philadelphia, Lea & Febiger, 1994 52. Lu Z, Liu D, Hornia A, Devonish W, Pagano M, Foster DA: Activation of protein kinase C triggers its ubiquitination and degradation. Mol Cell Biol 18:839 – 845, 1998

1231