Exposure to gemfibrozil and atorvastatin affects ...

Comparative Biochemistry and Physiology, Part B 199 (2016) 87–96

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Exposure to gemfibrozil and atorvastatin affects cholesterol metabolism and steroid production in zebrafish (Danio rerio)☆ Aziz A. Al-Habsi 1, Andrey Massarsky 2, Thomas W. Moon ⁎ Department of Biology, Centre for Advanced Research in Environmental Genomics and the Collaborative Program in Chemical and Environmental Toxicology, University of Ottawa, Ottawa, ON, Canada

a r t i c l e

i n f o

Article history: Received 27 July 2015 Received in revised form 19 November 2015 Accepted 23 November 2015 Available online 25 November 2015 Keywords: Fibrate drugs Statin drugs Zebrafish Metabolism Pharmaceuticals Reproduction Rhabdomyolysis Stress

a b s t r a c t The commonly used lipid-lowering pharmaceuticals gemfibrozil (GEM) and atorvastatin (ATV) are detected in the aquatic environment; however, their potential effects on non-target fish species are yet to be fully understood. This study examined the effects of GEM and/or ATV on female and male adult zebrafish after a 30 d dietary exposure. The exposure led to changes in several biochemical parameters, including reduction in cholesterol, triglycerides, cortisol, testosterone, and estradiol. Changes in cholesterol and triglycerides were also associated with changes in transcript levels of key genes involved with cholesterol and lipid regulation, including SREBP2, HMGCR1, PPARα, and SREBP1. We also noted higher CYP3A65 and atrogin1 mRNA levels in drug-treated male fish. Sex differences were apparent in some of the examined parameters at both biochemical and molecular levels. This study supports these drugs affecting cholesterol metabolism and steroid production in adult zebrafish. We conclude that the reduction in cortisol may impair the ability of these fish to mount a suitable stress response, whereas the reduction of sex steroids may negatively affect reproduction. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Atherosclerosis is one of the leading causes of cardiovascular mortality and morbidity in North America (Choy et al., 2000; Boden et al., 2007), and several lipid-lowering pharmaceuticals are used in its treatment. Fibrates are a class of lipid-lowering pharmaceuticals that activate peroxisome proliferator-activated receptors (PPARs), primarily PPARα (Fig. 1A). The other PPAR-types are PPARγ, which is involved in adipogenesis, and PPARβ, whose role in lipid regulation is not fully understood (Bishop-Bailey, 2000). Activation of PPARα alters the expression of genes that regulate lipid metabolism (Mandard et al., 2004), which ultimately reduces plasma triglyceride levels and increases cholesterol content in high density lipoproteins (HDL) (Prindiville et al., 2011). Notably, HDL has an important protective role against cardiovascular disease; its protection is attributed to several mechanisms, including reverse cholesterol transport, improved endothelial function, and inhibition of LDL oxidation (Assmann and Gotto, 2004). The prescription

☆ Contribution to a special issue celebrating the work of Dr. Thomas W. Moon on the occasion of his retirement after 45 years in comparative biochemistry and physiology. ⁎ Corresponding author at: 30 Marie Curie, Ottawa, Ontario K1N 6N5, Canada. E-mail address: [email protected] (T.W. Moon). 1 Current address: Department of Biology, College of Science, Sultan Qaboos University, Al Khoudh, Muscat, Oman. 2 Current address: Nicholas School of the Environment, Duke University, Durham, North Carolina, USA.

http://dx.doi.org/10.1016/j.cbpb.2015.11.009 1096-4959/© 2015 Elsevier Inc. All rights reserved.

rates for fibrates continue to increase, with gemfibrozil (GEM) being amongst the more popular fibrates (Prindiville et al., 2011). Statins are another class of lipid-lowering drugs. In contrast to fibrates, statins specifically inhibit 3-hydroxy-3-methylglutaryl-CoA (HMG CoA) reductase (HMGCR; E.C. 1.1.1.34), an enzyme that converts HMG CoA to mevalonate, a cholesterol precursor (Fig. 1A). Statins compete with HMG CoA for the active site of the enzyme, altering its conformation and inhibiting its function, thereby decreasing cholesterol synthesis (Blumenthal, 2000). Prescription rates for statins continue to increase with atorvastatin (ATV, also known as Lipitor) being amongst the most prescribed statins in Canada (Cavallucci, 2007). It is noteworthy that statins have few known side effects, but cerivastatin (another statin drug) was voluntarily removed from the US market because of its association with an increased risk for rhabdomyolysis, or the destruction of muscle. Rhabdomyolysis due to cerivastatin was reported most frequently when used in high doses and particularly, when used in combination with GEM (SoRelle, 2001). Both fibrates and statins are detected in the aquatic environment. It was previously reported that Canadian wastewater treatment plant (WWTP) effluents contained detectable levels of fibrates and statins. The concentrations of GEM in surface waters and WWTP effluents were 1500 ng/L and 2100 ng/L, respectively (Metcalfe et al., 2004). ATV was the most prevalent statin, reaching concentrations of 15 ng/L in surface waters and 44 ng/L in WWTP effluents (Metcalfe et al., 2004). The presence of these pharmaceuticals in aquatic environments raises concerns regarding their effects on non-target species. This is

88

A.A. Al-Habsi et al. / Comparative Biochemistry and Physiology, Part B 199 (2016) 87–96

Fig. 1. (A) The modes of action of fibrate and statin drugs. Fibrates (e.g. GEM) mimic fatty acids (FA) and bind to PPARα, which then binds to retinoid X receptor (RXR) and together this heterodimer binds to peroxisome proliferator response elements (PPRE) in the promoter region of key genes involved in lipid metabolism; this occurs in the nucleus. Statins (e.g. ATV) compete with HMG CoA for the binding site on HMG CoA reductase thereby inhibiting its activity and reducing cholesterol synthesis; this occurs in endoplasmic reticulum. LogP values for GEM and ATV were calculated using Molinspiration.com online calculator. (B, C) The actions of GEM and ATV induce changes to counteract the decreasing concentrations of triglycerides and cholesterol: (B) GEM-driven reduction in triglycerides via PPARα activation increases the gene expression of sterol regulatory-element binding protein 1 (SREBP1) in order to facilitate lipid biogenesis. (C) ATV-driven reduction in cholesterol increases the gene expression of SREBP2 and its downstream targets – HMGCR and low-density lipoprotein receptor (LDLR) – in order to facilitate cholesterol biosynthesis. See text for further explanations.

especially relevant to teleost fishes where hypercholesterolemia is a normal condition in these vertebrates (Larsson and Fange, 1977). Fish and salmonids in particular, are susceptible to atherosclerotic lesions in coronary arteries, which are attributed not to hypercholesterolemia per se but to growth rate and sexual maturity (Saunders et al., 1992). In general, the plasma cholesterol concentration in most fish species is 2–6 times higher than that of mammals (Larsson and Fange, 1977; Babin and Vernier, 1989). The toxicity of GEM has been addressed in a few studies. GEM exposure (5–28 d; 0.38 μg/L-15 mg/L) induced embryonic malabsorption syndrome in zebrafish larvae (Raldúa et al., 2008), led to genotoxic damage in adult zebrafish (Rocco et al., 2010), reduced plasma testosterone levels, decreased hepatic PPARβ mRNA levels, and induced several antioxidant defense enzymes in male goldfish (Carassius auratus) (Mimeault et al., 2005, 2006). In addition, GEM (2–21 d; 1.5– 1500 μg/L) reduced plasma cholesterol levels, altered the abundance of genes involved with lipid metabolism and reduced fecundity, but did not appear to affect plasma triglycerides or sex steroid levels in fathead minnows (Pimephales promelas) (Skolness et al., 2012). Finally,

GEM exposure (15 d; intraperitoneal injection of 100 mg/kg) modified plasma lipoprotein levels, size, and composition, increased lipoprotein lipase gene expression, but did not appear to activate PPAR pathways (Prindiville et al., 2011). Several toxic effects of ATV are reported especially in zebrafish (Danio rerio) embryos. Exposure to ATV (24 h; ~ 6 mg/L) blocked primordial germ cell migration (Thorpe et al., 2004) and resulted in thicker yolk extension, kinked notochord, and midline unlooped hearts (D'Amico et al., 2007). In addition, ATV (48 h; 0.03–1 mg/L) affected blood vessel stability and induced hemorrhagic stroke (Gjini et al., 2011; Eisa-Beygi et al., 2013). Waterborne exposures to ATV (5–14 d; 0.2–10 μg/L) also induced genotoxic damage in adult zebrafish (Rocco et al., 2010) and upregulated the abundance of genes involved in membrane transport, oxidative stress response, and biotransformation in rainbow trout (Oncorhynchus mykiss) (Ellesat et al., 2012). Other statins are reported to induce the expression of atrogin1 (a biomarker of rhabdomyolysis) in skeletal muscle, and lead to sarcomere shortening, as reported for lovastatin exposures (12 h; ~0–4 mg/L) in zebrafish embryos (Hanai et al., 2007; Cao et al., 2009; Huang et al., 2011), and


decreased HMGCR activities and mRNA levels, as reported for cerivastatin exposure (24 h; intraperitoneal injection of 1.4 or 11.2 ng/g) in rainbow trout (Estey et al., 2008). The main objective of this study was to investigate the effects of a dietary exposure to GEM. GEM has been previously shown to bioconcentrate in goldfish (Mimeault et al., 2005), and more recently Ruhí et al. (2016) showed that GEM can bioaccumulate in biofilm and macroinvertebrates. Additionally, the study aims to compare the biochemical and molecular changes of GEM treatment to those of ATV treatment; thus, in addition to GEM, zebrafish were also exposed to ATV or a combination of both (G + A) for 30 days. It was hypothesized that exposing zebrafish to GEM and/or ATV will challenge their cholesterol/triglyceride balance (availability vs utilization) and impact the production of steroid hormones (i.e. cortisol, testosterone, and estradiol), since these hormones require cholesterol as a precursor (Westerfield, 2000). Furthermore, it was predicted that i) GEM-driven reduction in triglycerides via PPAR activation will increase the gene expression of sterol regulatory-element binding protein 1 (SREBP1), a transcription factor that is involved in lipid biogenesis (Fig. 1B), and ii) ATV-driven reduction in cholesterol will increase the gene expression of SREBP2, a transcription factor that increases the gene expression of HMGCR, and low-density lipoprotein receptor (LDLR) to increase cholesterol biosynthesis (Fig. 1C). Additionally, the transcript abundance of cytochrome P450 (CYP3A65) and atrogin1 was assessed. CYP3A is involved in the metabolism of various endogenous substrates and xenobiotics (Tseng et al., 2005), whereas atrogin1 has been previously used as a biomarker of rhabdomyolysis (Hanai et al., 2007). Finally, the tissue distribution of HMGCR was assessed as to the best of our knowledge this has not been reported previously for zebrafish. 2. Materials and methods 2.1. Animals Adult zebrafish (D. rerio) of mixed sex weighing 0.5–0.7 g were purchased from a local supplier (Big Al's Aquarium Services, Ottawa, ON) and maintained in holding tanks at 28 °C on a 14:10 h light–dark cycle in a flow-through system (Aquatic Habitats, Apopka, FL) supplied with aerated, dechloraminated City of Ottawa tap water. The fish were fed a commercial zebrafish diet (ZEIGLER™) at 1% body weight once a day until separated into experimental groups. All procedures used were approved by the University of Ottawa Animal Care Protocol Review Committee and conform to the guidelines of the Canadian Council for Animal Care for the use of animals in research and teaching. 2.2. Experimental set-up 2.2.1. Dietary exposure Stock solutions of GEM and ATV were prepared in 95% ethanol. The food was spread on aluminum trays and sprayed with ethanol (vehicle control), GEM (1600 μg/g food), ATV (53 μg/g food), or G + A. The food was air-dried and stored in glass vials. Since the fish were fed 1% body weight per day, these drug concentrations correspond to 16 μg/g fish for GEM and 0.53 μg/g fish for ATV, and represent human-equivalent doses for GEM (1200 mg/day; ~ 17 μg/g body weight) and for ATV (10–80 mg/day; ~0.14–1.14 μg/g body weight). Notably, the aforementioned GEM concentration is lower than that used by Prindiville et al. (2011), who administered GEM intraperitoneally to rainbow trout at a concentration of 100 μg per g of fish every three days (total exposure period was 15 d), and Velasco-Santamaría et al. (2011), who exposed zebrafish to bezafibrate at concentrations of ~ 34–1400 μg/g of fish via diet for a period of 7 or 21 d (the human dose of bezafibrate is 8.5 μg/g body weight). As for ATV, none of the previous studies utilized dietary or intraperitoneal exposure routes; however, Estey et al. (2008) administered intraperitoneally at a human-equivalent dose of cerivastatin for up to 24 h.

89

Adult zebrafish were sexed and separated into stand-alone 10-L glass tanks (W × H × L: 21 cm × 23 cm × 35 cm) with ten male or female fish in each tank. Each treatment was duplicated; thus, 16 tanks were used in total (8 tanks for each sex). The fish were fed the aforementioned diet at 1% body weight once a day. The food was consumed within 5 min and no food remained at the bottom of the tank. The total fish mass was assessed weekly by weighing each tank and dividing by the number of fish per tank to get an average fish mass (see Fig. S1) and the amount of food was adjusted accordingly. At the end of the 30 d experiment, the fish were subjected to a standardized net stress (Ramsay et al., 2009), in order to assess their ability to elevate cortisol levels, and euthanized with an overdose of buffered tricaine methane sulfonate (4 g/L, MS 222). The fish were collected, dried in a Kimwipe and placed into individual 2 mL polypropylene microcentrifuge tubes. Several unstressed fish from each treatment were dissected to collect liver and brain samples for gene transcript abundance studies. All samples were frozen in liquid nitrogen and stored at −80 °C until analyzed. 2.2.2. HMGCR tissue distribution The tissue distribution of HMGCR1 and HMGCR2 was assessed in four naïve female adult zebrafish. Tissues (liver, gut, brain, gill, spleen, heart, gonad, and skeletal muscle) from two fish were removed and combined to ensure sufficient RNA quantity. The samples were frozen and stored as above until assessed using quantitative RT-PCR (see below). 2.3. Lipid extraction Whole-body lipid content was extracted using a modified Folch method (Folch et al., 1957). Briefly, individually frozen zebrafish were ground in liquid nitrogen with a mortar and pestle and homogenized for 30 s in 15 mL 2:1 chloroform/methanol (v/v) using a Polytron homogenizer (Kinematica, Luzern, Switzerland). An additional 5 ml chloroform/methanol was added and the mixture was incubated at room temperature for 30 min, with vortexing every 10 min. At the end of the incubation period 5 mL 2 M KCl buffered with 5 mM EDTA was added and the mixture was vortexed and the layers allowed to separate for 10 min. Once separated, the bottom organic layer was collected into a clean glass tube and evaporated to dryness under a stream of nitrogen gas. The lipid fraction was reconstituted in 1.0 mL ethylene glycol monomethyl ether and stored at −80 °C until analyzed. The extraction efficiency was verified by spiking zebrafish samples with appropriate radioactive isotopes (14C radioisotopes purchased from PerkinElmer); efficiencies were 84% for cholesterol, 77% for triglycerides, 83% for cortisol, 79% for testosterone, and 78% for estradiol. 2.4. Cholesterol and triglyceride assays Cholesterol and triglyceride contents were assessed using commercially available kits (C507-480 and T532-480, respectively; TECO Diagnostic, Anaheim, CA, USA). Briefly, 10 μL of lipid extract was added to 250 μL of corresponding color reagent and incubated at 37 °C for 10 min (cholesterol) or 5 min (triglycerides). Absorbance was read at 520 nm using a microplate spectrophotometer (SpectraMAX Plus 384; Molecular Devices, Sunnyvale, CA, USA). The concentration was calculated using an appropriate standard curve. 2.5. Cortisol, testosterone, and estradiol assays Cortisol content was estimated using a 125I radioimmunoassay (RIA) kit as per the manufacturer's protocol (MP Biomedicals, Orangeburg, NY, USA). Testosterone and estradiol concentrations were determined using enzyme immunoassay (EIA) kits (TEST-96 and ESTRA-96, respectively; TECO Diagnostic) as per the manufacturer's protocol.

90


2.6. Total RNA isolation and cDNA synthesis Total RNA was isolated using TRIzol® reagent, following the manufacturer's instructions (Gibco BRL, Burlington, ON, Canada). The quantity and quality of RNA were assessed using a NanoDrop 2000 (ThermoScientific, USA) and the samples were stored at −80 °C. cDNA synthesis utilized DNase I-treated total RNA (1 μg), random oligo-dT primers (300 ng), and Superscript® II Reverse transcriptase (200 U); the reagents were purchased from Invitrogen (Burlington, ON, Canada). A standard curve for each primer set was constructed by pooling dilutions of cDNA of all samples (treated and control). In each run, a standard curve was used to calculate the relative mRNA abundance. 2.7. Quantitative RT-PCR Quantitative RT-PCR was performed using a MX3000P® Multiplex Quantitative PCR system (Stratagene, La Jolla, CA, USA). Dilutions of cDNA pooled from control and treated samples were used to construct a relative standard curve for each primer used. Only standard curves with slopes between − 3.2 and − 3.5 with R2 values ≥ 0.98 were used. Unless otherwise specified, all primers were designed with OligoPerfect™ Designer (Life Technologies). Primers for PPARα, PPARγ, and PPARβ were from Velasco-Santamaría et al. (2011), those for SREBP1 and SREBP2 were from Craig and Moon (2011), and those for CYP3A65 were from Lister et al. (2009). The primers used are presented in Table 1. Each PCR reaction contained 10 μL Brilliant III Ultrafast SYBR® Green QPCR Master Mix (Agilent), 15 nM ROX reference dye, 500 nM gene-specific primers (forward and reverse), and 10 ng first-strand cDNA template, in a 20 μL reaction volume. The thermal cycling parameters were 3 min initial denaturation step at 95 °C, followed by 40 cycles of 95 °C for 20 s, and 60 °C for 20 s. Data were analyzed using the MX3000P Software Package. All samples were normalized to the abundance of the housekeeping gene elongation factor 1α (EF1α), which did not change significantly across treatments. 2.8. Statistical analysis The data are presented as means and standard errors of the mean (SEM). Statistical analyses were conducted using SigmaPlot™ 11.0 (SPSS Corporation, Chicago, IL, USA). Two-way analysis of variance (ANOVA) with post-hoc Tukey (biochemical data) or Student–

Newman–Keuls (transcript abundance data) methods were used to test for significance. The two independent variables were sex (female/ male) and treatment (control/GEM/ATV/G + A). A P-value ≤ 0.05 was considered significant. 3. Results 3.1. Dietary exposure 3.1.1. Cholesterol and triglycerides Whole-body cholesterol contents were significantly reduced in both female and male drug-treated fish (Fig. 2A). GEM exposure reduced cholesterol concentrations in females and males by 15% and 19%, respectively (Table 2). ATV exposure also reduced cholesterol concentrations, and in females this reduction was greater than in males (24% vs 13%, respectively). G + A (GEM + ATV) treatment reduced cholesterol concentrations in females and males by 13% and 15%, respectively. GEM treatment was less effective than ATV in reducing cholesterol contents in females, whereas in males no significant differences were observed between GEM and ATV. Whole-body triglyceride contents were significantly and differentially affected in drug-treated fish (Fig. 2B). A significant reduction in whole-body triglyceride was noted in all female drug-treated fish, but no significant differences were detected across the three drug treatments. GEM, ATV, and G + A decreased triglycerides by 34%, 37%, and 30%, respectively (Table 2). The male fish exhibited a very different pattern from that of females; whole-body triglyceride content was significantly reduced by 19% in GEM-treated fish, but significantly elevated in ATV- and G + A-treated fish by 33% and 43%, respectively (Table 2). Triglyceride content in females was significantly higher in control and GEM-treated fish compared to males; however, ATV- and G + A-treated females had significantly lower triglycerides than their male counterparts. 3.1.2. Cortisol, testosterone, and estradiol Whole-body cortisol contents were differentially affected in female and male drug-treated fish (Fig. 3A). In females, GEM treatment did not significantly affect cortisol despite a 26% reduction; however, ATV and G + A treatments significantly reduced cortisol by 71% and 65%, respectively (Table 2). In males, cortisol values in drug-treated fish were not significantly different from the control despite a 19–31% reduction,

Table 1 Primers used to quantify mRNA levels in the liver, brain, and muscle of zebrafish. Gene

Accession no.

Sequence (5′–3′)

Amplicon size (bp)

EF1α

AY422992

245

PPARα

NM_001161333

PPARγ

DQ839547

PPARβ

AF342937

SREBP1

NM_001105129

SREBP2

NM_001089466

HMGCR1

NM_001079977

HMGCR2

NM_001014292

LDLR

NM_001030283

CYP3A65

NM_001037438

Atrogin1

NM_200917

F: CAAACATGGGCTGGTTCAAG R: AGTGGTTACATTGGCAGGG F: CATCTTGCCTTGCAGACATT R: CACGCTCACTTTTCATTTCAC F: GGTTTCATTACGGCGTTCAC R: TGGTTCACGTCACTGGAGAA F: GCGTAAGCTAGTCGCAGGTC R: TGCACCAGAGAGTCCATGTC F: GACACTTCTCTGGACACTCTG R: ATCGAACAGCCCAAACTCC F: GAGATAAAGTGGACCCCATCG R: CAGAAACTCCAGAACCCCAG F: CCAAGAGGATTGAGCCTGAC R: GATCCGGAGACCATTTCTGA F: GTACATCCGCTTTCAGTCTCAG R: AACACCTCTTTGACCACTCG F: GCCAGCAAGGCCTGCAAAGC R: CTTCAGGCGGGGGATGACGC F: CTTCGGCACCATGCTGAGAT R: AGATACCCCAGATCCGTCCATA F: GTCAGTCTGGGTCAAGTGTG R: AAGAGGATGTGGCAGTGTG

81 250 204 135 134 207 233 120 86 233


91

Fig. 2. Whole-body cholesterol and triglyceride contents in female and male adult zebrafish. (A) Cholesterol content after a 30 d dietary exposure to GEM (16 μg/g), ATV (0.53 μg/g), or G + A; (B) triglyceride content after a dietary exposure. Data are presented as Means + SEM (n = 10 fish per treatment). Different letters denote significant differences between treatments; an asterisk denotes significant differences between females and males within the same treatment (P b 0.05; two-way ANOVA with a Tukey's post-hoc test).

depending on treatment. A sex difference was noted, such that ATVtreated males showed significantly higher cortisol concentrations compared to females. Whole-body testosterone contents were significantly reduced by 56–65% in all drug-treated female fish with no significant differences across the three drug treatments (Fig. 3B; Table 2). The testosterone content in males was unaffected, and all drug-treated males had significantly higher testosterone than their female counterparts. Whole-body estradiol was significantly reduced in all drug-treated females (17–22% reduction, depending on treatment) and males (13– 24% reduction, depending on treatment) (Fig. 3C; Table 2). A significant sex difference was noted for G + A-treated fish with males having lower estradiol levels than females.

3.1.3. Transcript abundance Liver transcription factors linked to lipid regulation were assessed. PPARα mRNA abundance was significantly elevated in drug-treated female fish compared to control (Fig. 4A). Interestingly, GEM treatment was less effective than ATV treatment, but more effective than G + A treatment in inducing PPARα in females. In males, no significant differences were detected; in fact, male PPARα transcripts seemed refractory to these drugs. PPARγ mRNA abundance was significantly elevated in both female and male fish by all 3 drug treatments (Fig. 4B). In females, GEM treatment was less effective than ATV or G + A treatments, whereas in males no significant differences were noted across drug-treated fish. Moreover, GEM treatment was more effective in males than in

Table 2 Summary of the effects of GEM, ATV, and G + A on biochemical parameters. Percent change (%) from the control group values is presented. The values that were reported as significantly different from the control group (as per Figs. 2 and 3) are marked with asterisks (*). GEM

ATV

G+A

Females Cholesterol Triglycerides Cortisol Testosterone Estradiol

−15* −34* −26 −61* −17*

−24* −37* −71* −56* −22*

−13* −30* −65* −65* −17*

Males Cholesterol Triglycerides Cortisol Testosterone Estradiol

−19* −19* −19 −8 −13*

−13* +33* −31 +4 −24*

−15* +43* −27 +7 −23*

females in inducing PPARγ. No significant differences were observed in PPARβ mRNA abundance despite a trend for higher abundance in G + A-treated fish (Fig. S2A). Concurrent with the increase in PPARα mRNA levels, the transcript abundance of SREBP1 also increased (Fig. 4C). In females, all drugtreated fish displayed higher transcript abundance; however, only ATV and G + A treatments resulted in a significant increase. Higher SREBP1 mRNA levels were also observed in male fish even in the absence of significant changes in PPARα, although only the ATV-treated fish differed significantly from the control fish. Moreover, the reduction of whole-body cholesterol contents coincided with an increase in liver SREBP2 mRNA transcript abundance in drug-treated fish (Fig. 4D). In females, GEM treatment was less effective than ATV or G + A treatments in inducing SREBP2, whereas in males no significant differences were detected across the drug treatments. There were no sex-dependent differences in SREBP2. Although GEM treatment significantly reduced cholesterol and increased liver SREBP2, it did not significantly affect liver HMGCR1 in either females or males (Fig. 4E). In contrast, exposure to ATV and G + A resulted in higher HMGCR1 in both females and males. Similar trends were observed for liver HMGCR2 mRNA abundance; however, significant differences were only noted for ATV-treated females and ATV- and G + A-treated males (Fig. 4F). Moreover, the increase in HMGCR2 in G + A-treated males was significantly higher than their female counterparts. Brain HMGCR mRNA abundance was also assessed. HMGCR1 mRNA abundance was significantly elevated in ATV- and G + A-, but not GEMtreated female fish (Fig. S3A). HMGCR2 mRNA abundance was increased but not significantly in ATV- and G + A-treated females (Fig. S3B). There were no significant differences observed in either transcript in males. Significant sex differences were detected only in HMGCR1 mRNA levels in ATV- and G + A- treated fish, with males having lower transcript abundance than females. No significant differences were noted for liver LDLR mRNA levels despite a trend for higher levels in all drug-treated females and males (Fig. S2B). The transcript abundance of CYP3A65 and atrogin1 was also assessed. Transcript abundance of liver CYP3A65 was elevated in drug-treated fish, but only significantly in males treated with GEM or ATV (Fig. 5A). Skeletal muscle atrogin1 mRNA abundance was generally elevated; however, significant differences were only detected in males, such that GEM and G + A treatments resulted in significantly higher atrogin1 mRNA than control, but significantly lower levels than ATVtreated fish (Fig. 5B). Drug-treated males had significantly higher atrogin1 mRNA levels than their female counterparts.

92


Fig. 3. Whole-body content of cortisol, testosterone, and estradiol in female and male adult zebrafish exposed to GEM and/or ATV. See Fig. 2 legend for details.

3.2. Tissue distribution of HMGCR1 and HMGCR2

4. Discussion

Thorpe et al. (2004) established that zebrafish HMGCR1 transcripts are acquired at 4 days post fertilization and that HMGCR2 is a maternal transcript that is present in 4-cell stage embryos. HMGCR1 transcripts in adult zebrafish were detected in most tissues examined, except spleen, gonads, and skeletal muscle (Fig. 6). Liver and gut had the largest abundance followed by brain and heart. HMGCR2 expression was detected in all tissues examined. There were differences between tissues, with liver and gut transcript levels well below those observed in the brain and gonads.

This study examined the effects of GEM and/or ATV on female and male adult zebrafish. The fish were subjected to a 30 d dietary exposure. The exposure resulted in several biochemical changes, supporting the ability of both GEM and ATV to cross the gut epithelia. Moreover, the transcript abundance of key genes involved with cholesterol and lipid regulation was affected in drug-treated fish. Lastly, sex differences were evident in some of the examined parameters on both biochemical and molecular levels, suggesting that females and males may respond differently to these environmental pollutants.

Fig. 4. Relative transcript abundance of PPARα (A), PPARγ (B), SREBP1 (C), SREBP2 (D), HMGCR1 (E), and HMGCR2 (F) in the liver of female and male adult zebrafish after a 30 d dietary exposure to GEM and/or ATV. Data are presented as Means + SEM (n = 5 fish per treatment). Different letters denote significant differences between treatments; an asterisk denotes significant differences between females and males within the same treatment (P b 0.05; two-way ANOVA with a SNK post-hoc test).


93

Fig. 5. Relative transcript abundance of CYP3A65 (A) and atrogin1 (B) in the liver of female and male adult zebrafish after a 30 d dietary exposure to GEM and/or ATV. See Fig. 4 legend for details.

As noted above, GEM belongs to the fibrate class of lipid-lowering pharmaceuticals that activate PPARs and ultimately reduce plasma triglyceride levels and increase cholesterol content in HDL. The current study showed that GEM exposure in zebrafish reduced whole-body cholesterol and triglyceride contents in females and males. The wholebody cholesterol concentrations in females and males were similar under control conditions and GEM treatment reduced cholesterol concentrations to a similar extent in both sexes. In contrast, a GEMdependent decrease in triglycerides was much more prominent in females, which had higher triglyceride under control conditions compared to males. These results are consistent with a previous study, reporting that a dietary exposure to bezafibrate (another fibrate drug) resulted in reduced plasma cholesterol after 7 and 21 d of exposure, but triglycerides were not assessed (Velasco-Santamaría et al., 2011). ATV, which belongs to the statin family of lipid lowering pharmaceuticals that reduce cholesterol synthesis by inhibiting HMGCR was also able to reduce cholesterol content. Interestingly, ATV treatment was more effective in females than males. Also, ATV differentially affected triglycerides — there was a significant reduction in females, whereas in males a significant increase was observed. Elevation of triglyceride was reported in a previous study that examined fluvastatin (another statin drug) treatment in human subjects (Marz et al., 2001). Moreover, in vitro evidence from HepG2 cells treated with three different statins

Fig. 6. Tissue distribution of HMGCR1 and HMGCR2 in female adult zebrafish. Data are presented as Means + SEM (n = 2 fish).

(including ATV) also noted an increase in triglyceride levels (Scharnagl et al., 2001). It seems that female zebrafish are more prone to the effect of ATV than the males when it comes to triglyceride content, possibly due to the importance of these components for egg production. Furthermore, we hypothesized that a reduction in whole-body cholesterol content could decrease steroid production, resulting in lower cortisol, testosterone, and estradiol concentrations. Despite a trend for lower cortisol, exposure to GEM did not significantly reduce wholebody cortisol concentrations in either females or males. In contrast, ATV treatment did significantly reduce cortisol concentrations in females, but not males. Given that cortisol was assessed in fish that were subjected to stress, the reduced cortisol content suggests that the stress response in zebrafish could be impeded by ATV. Moreover, both GEM and ATV equally decreased whole-body testosterone content in females, but not males. GEM and ATV treatments also resulted in significantly lower whole-body estradiol contents. The reduction of cortisol and sex steroids could be related to the reduction of cholesterol; however, our results suggest that the relationship between cholesterol and steroid hormone synthesis is much more complex. We show that the cholesterol concentrations were decreased in all drug-treated fish, but the concentrations of cortisol, testosterone, and estradiol were not reduced in all drug-treated fish. In fact, the changes in steroid hormones were drug- and sex-dependent. This discrepancy is worthy of future research to better understand the potential environmental risks associated with fibrates and statins. Studies looking at the effects of GEM/ATV on these parameters are scarce. In fact, Velasco-Santamaría et al. (2011) was the only study that examined 11-ketotestosterone (11KT) in male zebrafish fed bezafibrate, and reported a significant reduction. It is noteworthy that estradiol concentrations in male zebrafish were only ~11% lower than in females. A precise explanation for these high values in males is not known. To the best of our knowledge, Fuzzen et al. (2011) was the only published study that compared whole-body estradiol concentrations in male and female zebrafish. The Fuzzen et al. study reported estradiol concentrations of ~ 200 and 1500 pg/g fish in unstressed and ~400 and 1200 pg/g fish in stressed males and females, respectively. In fact, an independent study in our lab (unpublished data) using the same analysis showed that whole-body estradiol concentrations in unstressed males and females were ~ 550 and 2200 pg/g whereas in stressed fish estradiol concentrations were ~ 700 and 2500 pg/g fish, respectively. All zebrafish in the present study were stressed prior to sacrifice, suggesting that stress could potentially increase estradiol concentrations in males. A more detailed assessment of estradiol concentrations and estradiol production in male and female zebrafish should be carried out in future studies.

94


Mechanistically, we predicted that GEM treatment would decrease triglycerides via PPAR activation, increasing the gene expression of SREBP1 to increase lipid biogenesis. We show that PPARα mRNA transcript levels were elevated in both GEM- and ATV-treated females, but not males, which correlates with the more pronounced reduction in triglyceride levels noted in females. PPARγ mRNA transcript abundance was significantly up-regulated in both male and female zebrafish in all treatment groups. The effect of GEM in males was more pronounced than in females. Interestingly, females were more sensitive to ATV treatment than GEM treatment. No significant effects were observed for PPARβ. It is noteworthy that in zebrafish PPARα is predominantly expressed in the liver, kidney, and pancreas, where it controls fatty acid metabolism (Ibabe et al., 2002). For instance, in response to endogenous fatty acids or exogenous synthetic ligands (such as statins and fibrates), PPARα activates fatty acid catabolism through promoting triglyceride breakdown and fatty acid β-oxidation by inducing the expressions of acyl-CoA oxidase and carnitine palmitoyl transferase-1A (van Raalte et al., 2004; Wang and Wong, 2010). In contrast, zebrafish PPARγ is highly abundant in the adipose tissues, intestine, kidney, and liver, and triggers cellular differentiation, promotes lipid storage, and modulates the action of insulin (Ibabe et al., 2002, 2005). Previous studies showed that GEM was unable to affect PPARα or PPARγ, but PPARβ mRNA abundance was significantly reduced in male goldfish treated with GEM (Mimeault et al., 2006). In contrast, bezafibrate was reported to increase PPARβ, whereas PPARγ was unaffected in male zebrafish after a 21 d exposure (Velasco-Santamaría et al., 2011). Although ATV effects on PPARs were not previously reported in fish, statins have been reported to up-regulate PPARα in human HepG2 hepatoma cells (Martin et al., 2001) and mice peritoneal macrophages (Paumelle et al., 2006). In addition, SREBP1 mRNA abundance was assessed. GEM did not significantly increase SREBP1 in either females or males despite trends for increased mRNA levels. ATV significantly elevated SREBP1 in both females and males. Interestingly, G + A treatment in females resulted in SREBP1 levels similar to ATV-alone, whereas in males G + A treatment resembled SREBP1 levels of GEM treatment. SREBP1 activates transcription of genes involved in fatty acid and triglyceride synthesis, such as the genes encoding acetyl-CoA carboxylase and fatty acid synthase (Passeri et al., 2009). The lack of a significant SREBP1 increase by GEM suggests that the decrease in triglyceride contents was likely insufficient to induce lipid biogenesis. Also, the elevation of SREBP1 mRNA levels in ATV-treated males was unexpected, since whole-body triglyceride content was actually elevated in this group. We also predicted that ATV-driven reduction in cholesterol would increase gene expression of HMGCR and LDLR via the induction of SREBP2. Although both GEM and ATV treatments significantly reduced cholesterol, only ATV treatment significantly increased liver HMGCR1 and HMGCR2 in females and males. The largest elevation was observed in HMGCR1 levels in fish fed ATV or the combination of G + A with increases exceeding 30–50 fold compared with the control fish. HMGCR2 transcripts were up-regulated only about 3–6 fold. These results are consistent with the results from the HMGCR tissue distribution, where HMGCR1 transcripts were highest in liver and HMGCR2 was poorly expressed in the liver but highest in the heart compared to the rest of the tissues, suggesting that HMGCR1 is more liver-specific where cholesterol and lipoproteins are synthesized as previously noted in mammals (D'Amico et al., 2007) and the rainbow trout (Estey et al., 2008). The precise roles of the two HMGCR forms are not clear, although a study examining the two HMGCR isoforms in humans reported that the HMGCR2 protein responded to a range of statins less effectively than HMGCR1 (Karthik et al., 2012). Moreover, ATV is lipophilic and like other statins – depending on their lipophilicity – is known to cross the blood brain barrier (Cibickova, 2011). Brain HMGCR1 mRNA transcript levels were significantly up-regulated in female zebrafish treated with ATV or G + A compared with the control, but levels were not affected in GEM-treated fish.

Brain HMGCR2 transcript abundance also increased in the females treated with ATV and the G + A combination, but not significantly. Brain HMGCR1 and HMGCR2 expression levels in male zebrafish were not significantly changed compared with the control. The significance of these 2 forms in the fish brain is also unknown, but the mammalian brain contains the most cholesterol of all body organs and HMG CoA is found in glial cells and is important for cholesterol homeostasis (Suzuki et al., 2010). Furthermore, the present study demonstrates that the changes in HMGCRs mRNA transcript abundance in the liver of ATV-exposed zebrafish are correlated with the changes in the levels of SREBP2. In mammals, hepatic SREBP2 is regulated in a complex fashion (Wang et al., 1994; Sakai et al., 1996; Brown et al., 2002; Sun et al., 2007), but cholesterol content is an important regulating factor (Horton et al., 2002). Ultimately, SREBP2 regulates the transcription of HMGCR and LDLR, key proteins in cholesterol biosynthesis and uptake, respectively (Yokoyama et al., 1993). When cells are loaded with cholesterol, SREBP2 translocation and processing is blocked and cholesterol synthesis declines (Sun et al., 2007). The results reported herein support the involvement of zebrafish HMGCRs in cholesterol biosynthesis in the liver and its regulation by SREBP at the transcriptional level, as demonstrated in mammals. In addition, the mRNA levels of CYP3A65 and atrogin1 were assessed. Liver CYP3A65 mRNA abundance was significantly elevated in male GEM- or ATV-treated zebrafish. In female zebrafish, liver CYP3A65 was elevated but not statistically compared with the control. Liver CYP3A in mammals is involved in the metabolism of endogenous substrates and xenobiotics, and CYP3A65 transcripts are induced by polybrominated biphenyls in zebrafish (Tseng et al., 2005). However, there is a lack of information regarding the impact that pharmaceuticals have on liver function. Zebrafish exposed to different fluoxetine concentrations did not show changes in CYP3A65 mRNA transcripts, but there was a reduction of CYP3A65 mRNA transcripts in zebrafish exposed to 10 ng/L ethinylestradiol (EE2) (Lister et al., 2009). In the present study, CYP3A65 mRNA abundance in male livers was significantly upregulated as opposed to that of females, suggesting that the CYP3A65 in males is more sensitive to pharmaceuticals than in females. Sexually dimorphic rates of metabolism are reported for a killifish (Fundulus heteroclitus), where Hegelund and Celander (2003) found that CYP3A mRNA and protein levels were 2.5-fold higher in male killifish compared to females. This is in agreement with the finding in the current study with zebrafish. Even though CYP regulation in fish is not completely understood, CYPs are often under hormonal control and differences between males and females are commonly reported (Gray et al., 1991; Andersson and Forlin, 1992). Moreover, these differences can be more apparent during breeding seasons (Devaux et al., 1998). Atrogin1 mRNA abundance was significantly elevated in all drugtreated males, but not females. Atrogin1 mRNA levels in males treated with ATV were approximately 10-fold higher compared with the control, indicating that the impact of the drug is more significant in the males as opposed to the females. Statin treatments induced marked induction of atrogin1 expression in human skeletal muscle, cultured muscle cells, and zebrafish (Hanai et al., 2007); the authors demonstrated that, in the absence of atrogin1, cells and animals are resistant to the toxic effects of statins, which led them to conclude that atrogin1 mediates part of the effects of statins on muscle damage (Hanai et al., 2007). In conclusion, this study supports a role of lipid/cholesterol lowering drugs on cholesterol metabolism, lipid regulation, and steroid production in zebrafish. Overall, the reduction in cholesterol was associated with changes in mRNA transcript abundance of key genes involved with cholesterol synthesis, as well as reduced cortisol and sex steroids, suggesting that the stress response and reproduction could be adversely affected. The reduction in triglyceride was associated with changes in mRNA levels of key genes involved with lipid regulation, suggesting that lipid metabolism could be impeded by exposure to GEM and/or ATV. This study also suggested that the wellbeing of the male fish was


affected as these fish showed signs of skeletal muscle breakdown, which is an indication of rhabdomyolysis. Finally, the sex differences that were noted at least for some of the parameters indicate that females and males respond differently to these environmental pollutants. Acknowledgments The authors would like to acknowledge grants to TWM from NSERC (Natural Sciences and Engineering Research Council of Canada) (006944) and Pfizer Pharmaceutical, and to AAA and AM from the University of Ottawa. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbpb.2015.11.009. References Andersson, T., Forlin, L., 1992. Regulation of the cytochrome P450 enzyme system in fish. Aquat. Toxicol. 24, 1–19. Assmann, G., Gotto, A.M., 2004. HDL cholesterol and protective factors in atherosclerosis. Circulation 109 (III-8-III-14). Babin, P.J., Vernier, J.-M., 1989. Plasma lipoproteins in fish. J. Lipid Res. 30, 467–490. Bishop-Bailey, D., 2000. Peroxisome proliferator-activated receptors in the cardiovascular system. Br. J. Pharmacol. 129, 823–834. Blumenthal, R.S., 2000. Statins: effective antiatherosclerotic therapy. Am. Heart J. 139, 577–583. Boden, W.E., O'Rourke, R.A., Teo, K.K., Hartigan, P.M., Maron, D.J., Kostuk, W., Knudtson, M., Dada, M., Casperson, P., Harris, C.L., Spertus, J.A., Shaw, L., Chaitman, B.R., Mancini, G.B., Berman, D.S., Gau, G., Weintraub, W.S., 2007. The evolving pattern of symptomatic coronary artery disease in the United States and Canada: baseline characteristics of the Clinical Outcomes Utilizing Revascularization and Aggressive Drug Evaluation (COURAGE) trial. Am. J. Cardiol. 99, 208–212. Brown, A.J., Sun, L., Feramisco, J.D., Brown, M.S., Goldstein, J.L., 2002. Cholesterol addition to ER membranes alters conformation of SCAP, the SREBP escort protein that regulates cholesterol metabolism. Mol. Cell 10, 237–245. Cao, P.R., Hanai, J., Tanksale, P., Imamura, S., Sukhatme, V.P., Lecker, S.H., 2009. Statininduced muscle damage and atrogin-1 induction is the result of a geranylgeranylation defect. FASEB J. 23, 2844–2854. Cavallucci, S., 2007. Top 200: what's topping the charts in prescription drugs this year. Pharmacy Practice, Canadian Health Network (Available from: http://www. imshealth.com/vgn/images/portal/cit_40000873/13/31/8286270612-TOP200-07final.pdf). Choy, P.C., Mymin, D., Zhu, Q., Dakshinamurti, K., O.K., 2000. Atherosclerosis risk factors: the possible role of homocysteine. Mol. Cell. Biochem. 207, 143–148. Cibickova, L., 2011. Statins and their influence on brain cholesterol. J. Clin. Lipidol. 5, 373–379. Craig, P.M., Moon, T.W., 2011. Fasted zebrafish mimic genetic and physiological responses in mammals: a model for obesity and diabetes? Zebrafish 8, 109–117. D'Amico, L., Scott, I.C., Jungblut, B., Stainier, D.Y.R., 2007. A mutation in zebrafish hmgcr1b reveals a role for isoprenoids in vertebrate heart-tube formation. Curr. Biol. 17, 252–259. Devaux, A., Flammarion, P., Bernardon, V., Garric, J., Monod, G., 1998. Monitoring of the chemical pollution of the river RhÃńe through measurement of DNA damage and cytochrome P4501a induction in chub (Leuciscus cephalus). Mar. Environ. Res. 46, 257–262. Eisa-Beygi, S., Hatch, G., Noble, S., Ekker, M., Moon, T.W., 2013. The 3-hydroxy-3methylglutaryl-CoA reductase (HMGCR) pathway regulates developmental cerebral–vascular stability via prenylation-dependent signalling pathway. Dev. Biol. 373, 258–266. Ellesat, K.S., Holth, T.F., Wojewodzic, M.W., Hylland, K., 2012. Atorvastatin up-regulate toxicologically relevant genes in rainbow trout gills. Ecotoxicology 21, 1841–1856. Estey, C., Chen, X., Moon, T.W., 2008. 3-Hydroxy-3-methylglutaryl coenzyme A reductase in rainbow trout: effects of fasting and statin drugs on activities and mRNA transcripts. Comp. Biochem. Physiol. C 147, 386–398. Folch, J., Lees, M., Stanley, G.H.S., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Fuzzen, M.L.M., Bernier, N.J., Van Der Kraak, G., 2011. Differential effects of 17β-estradiol and 11-ketotestosterone on the endocrine stress response in zebrafish (Danio rerio). Gen. Comp. Endocrinol. 170, 365–373. Gjini, E., Hekking, L.H., Küchler, A., Saharinen, P., Wienholds, E., Post, J.-A., Alitalo, K., Schulte-Merker, S., 2011. Zebrafish Tie-2 shares a redundant role with Tie-1 in heart development and regulates vessel integrity. Dis. Model. Mech. 4, 57–66. Gray, E.S., Woodin, B.R., Stegeman, J.J., 1991. Sex differences in hepatic monooxygenases in winter flounder (Pseudopleuronectes americanus) and scup (Stenotomus chrysops) and regulation of P450 forms by estradiol. J. Exp. Zool. 259, 330–342. Hanai, J.-I., Cao, P., Tanksale, P., Imamura, S., Koshimizu, E., Zhao, J., Kishi, S., Yamashita, M., Phillips, P.S., Sukhatme, V.P., Lecker, S.H., 2007. The muscle-specific ubiquitin ligase atrogin-1/MAFbx mediates statin-induced muscle toxicity. J. Clin. Invest. 117, 3940–3951.

95

Hegelund, T., Celander, M.C., 2003. Hepatic versus extrahepatic expression of CYP3A30 and CYP3A56 in adult killifish (Fundulus heteroclitus). Aquat. Toxicol. 64, 277–291. Horton, J.D., Goldstein, J.L., Brown, M.S., 2002. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125–1131. Huang, S.H., Hsiao, C.D., Lin, D.S., Chow, C.Y., Chang, C.J., Liau, I., 2011. Imaging of zebrafish in vivo with second-harmonic generation reveals shortened sarcomeres associated with myopathy induced by statin. PLoS ONE 6 (9), e24764. Ibabe, A., Grabenbauer, M., Baumgart, E., Fahimi, H.D., Cajaraville, M.P., 2002. Expression of peroxisome proliferator-activated receptors in zebrafish (Danio rerio). Histochem. Cell Biol. 118, 231–239. Ibabe, A., Bilbao, E., Cajaraville, M.P., 2005. Expression of peroxisome proliferatoractivated receptors in zebrafish (Danio rerio) depending on gender and developmental stage. Histochem. Cell Biol. 123, 75–87. Karthik, M.V.K., Deepak, M.V.K.N.S., Shukla, P., 2012. Explication of interactions between HMGCR isoform 2 and various statins through in silico modeling and docking. Comput. Biol. Med. 42, 156–163. Larsson, A., Fange, R., 1977. Cholesterol and free fatty acids (FFA) in the blood of marine fish. Comp. Biochem. Physiol. B 57, 191–196. Lister, A., Regan, C., Van Zwol, J., Van Der Kraak, G., 2009. Inhibition of egg production in zebrafish by fluoxetine and municipal effluents: a mechanistic evaluation. Aquat. Toxicol. 95, 320–329. Mandard, S., Muller, M., Kersten, S., 2004. Peroxisome proliferator-activated receptor alpha target genes. Cell. Mol. Life Sci. 61, 393–416. Martin, G., Duez, H., Blanquart, C., Berezowski, V., Poulain, P., Fruchart, J.-C., Najib-Fruchart, J., Glineur, C., Staels, B., 2001. Statin-induced inhibition of the rho-signaling pathway activates PPARalpha and induces HDL apoA-I. J. Clin. Invest. 107, 1423–1432. Marz, W., Scharnagl, H., Abletshauser, C., Hoffmann, M.M., Berg, A., Keul, J., Wieland, H., Baumstark, M.W., 2001. Fluvastatin lowers atherogenic dense low-density lipoproteins in postmenopausal women with the atherogenic lipoprotein phenotype. Circulation 103, 1942–1948. Metcalfe, C., Miao, X.-S., Hua, W., Letcher, R., Servos, M., 2004. Pharmaceuticals in the Canadian environment. In: Kummerer, K. (Ed.), Pharmaceutical in the Environment, Sources, Fate, Effects, and Risks. Berlin: Springer, pp. 67–90. Mimeault, C., Woodhouse, A., Miao, X.S., Metcalfe, C.D., Moon, T.W., Trudeau, V.L., 2005. The human lipid regulator, gemfibrozil bioconcentrates and reduces testosterone in the goldfish, Carassius auratus. Aquat. Toxicol. 73, 44–54. Mimeault, C., Trudeau, V.L., Moon, T.W., 2006. Waterborne gemfibrozil challenges the hepatic antioxidant defense system and down-regulates peroxisome proliferatoractivated receptor beta (PPARβ) mRNA levels in male goldfish (Carassius auratus). Toxicology 228, 140–150. Passeri, M.J., Cinaroglu, A., Gao, C., Sadler, K.C., 2009. Hepatic steatosis in response to acute alcohol exposure in zebrafish requires sterol regulatory element binding protein activation. Hepatology 49, 443–452. Paumelle, R., Blanquart, C., Briand, O., Barbier, O., Duhem, C., Woerly, G., Percevault, F., Fruchart, J.-C., Dombrowicz, D., Glineur, C., Staels, B., 2006. Acute antiinflammatory properties of statins involve peroxisome proliferator-activated receptor-alpha via inhibition of the protein kinase C signaling pathway. Circ. Res. 98, 361–369. Prindiville, J.S., Mennigen, J.A., Zamora, J.M., Moon, T.W., Weber, J.-M., 2011. The fibrate drug gemfibrozil disrupts lipoprotein metabolism in rainbow trout. Toxicol. Appl. Pharmacol. 251, 201–208. Raldúa, D., Andre, M., Babin, P.J., 2008. Clofibrate and gemfibrozil induce an embryonic malabsorption syndrome in zebrafish. Toxicol. Appl. Pharmacol. 228, 301–314. Ramsay, J.M., Feist, G.W., Varga, Z.M., Westerfield, M., Kent, M.L., Schreck, C.B., 2009. Whole-body cortisol response of zebrafish to acute net handling stress. Aquaculture 297, 157–162. Rocco, L., Frenzilli, G., Fusco, D., Peluso, C., Stingo, V., 2010. Evaluation of zebrafish DNA integrity after exposure to pharmacological agents present in aquatic environments. Ecotoxicol. Environ. Saf. 73, 1530–1536. Ruhí, A., Acuña, V., Barceló, D., Huerta, B., Mor, J.-R., Rodríguez-Mozaz, S., Sabater, S., 2016. Bioaccumulation and trophic magnification of pharmaceuticals and endocrine disruptors in a Mediterranean river food web. Sci. Total Environ. 540, 250–259. Sakai, J., Duncan, E.A., Rawson, R.B., Hua, X., Brown, M.S., Goldstein, J.L., 1996. Sterolregulated release of SREBP-2 from cell membranes requires two sequential cleavages, one within a transmembrane segment. Cell 85, 1037–1046. Saunders, R.L., Farrell, A.P., Knox, D.E., 1992. Progression of coronary arterial lesions in atlantic salmon (Salmo salar) as a function of growth rate. Can. J. Fish. Aquat. Sci. 49, 878–884. Scharnagl, H., Schinker, R., Gierens, H., Nauck, M., Wieland, H., März, W., 2001. Effect of atorvastatin, simvastatin, and lovastatin on the metabolism of cholesterol and triacylglycerides in HepG2 cells. Biochem. Pharmacol. 62, 1545–1555. Skolness, S.Y., Durhan, E.J., Jensen, K.M., Kahl, M.D., Makynen, E.A., Villeneuve, D.L., Ankley, G.T., 2012. Effects of gemfibrozil on lipid metabolism, steroidogenesis, and reproduction in the fathead minnow (Pimephales promelas). Environ. Toxicol. Chem. 31, 2615–2624. SoRelle, R., 2001. Baycol withdrawn from market. Circulation 104, E9015–E9016. Sun, L.-P., Seemann, J., Goldstein, J.L., Brown, M.S., 2007. Sterol-regulated transport of SREBPs from endoplasmic reticulum to Golgi: Insig renders sorting signal in Scap inaccessible to COPII proteins. Proc. Natl. Acad. Sci. 104, 6519–6526. Suzuki, R., Lee, K., Jing, E., Biddinger, S.B., McDonald, J.G., Montine, T.J., Craft, S., Kahn, C.R., 2010. Diabetes and insulin in regulation of brain cholesterol metabolism. Cell Metab. 12, 567–579. Thorpe, J.L., Doitsidou, M., Ho, S.-Y., Raz, E., Farber, S.A., 2004. Germ cell migration in zebrafish is dependent on HMGCoA reductase activity and prenylation. Dev. Cell 6, 295–302. Tseng, H.-P., Hseu, T.-H., Buhler, D.R., Wang, W.-D., Hu, C.-H., 2005. Constitutive and xenobiotics-induced expression of a novel CYP3A gene from zebrafish larva. Toxicol. Appl. Pharmacol. 205, 247–258.

96


van Raalte, D.H., Li, M., Pritchard, P.H., Wasan, K.M., 2004. Peroxisome proliferatoractivated receptor (PPAR)-alpha: a pharmacological target with a promising future. Pharm. Res. 21, 1531–1538. Velasco-Santamaría, Y.M., Korsgaard, B., Madsen, S.S., Bjerregaard, P., 2011. Bezafibrate, a lipid-lowering pharmaceutical, as a potential endocrine disruptor in male zebrafish (Danio rerio). Aquat. Toxicol. 105, 107–118. Wang, W., Wong, C.-W., 2010. Statins enhance peroxisome proliferator-activated receptor gamma coactivator-1 alpha activity to regulate energy metabolism. J. Mol. Med. 88, 309–317.

Wang, X., Sato, R., Brown, M.S., Hua, X., Goldstein, J.L., 1994. SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis. Cell 77, 53–62. Westerfield, M., 2000. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). University of Oregon Press, Eugene. Yokoyama, C., Wang, X., Briggs, M.R., Admon, A., Wu, J., Hua, X., Goldstein, J.L., Brown, M.S., 1993. SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell 75, 187–197.