Expression and purification of biologically active ...

Protein Expression and Purification 145 (2018) 14–18

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Expression and purification of biologically active bovine Interferon λ3 (IL28B) in Pichia pastoris

T

S. Barathiraja, P.A.V. Gangadhara, V. Umapathi, H.J. Dechamma, G.R. Reddy∗ ICAR-Indian Veterinary Research Institute, Hebbal, Bengaluru 560024, India

A R T I C L E I N F O

A B S T R A C T

Keywords: Interferon λ3 Expression in Pichia pastoris SP-Sepharose chromatography Interferon stimulated genes (ISGs)

Interferon lambda-3 (IFNλ3) which is also known as IL28B is a member of type III Interferons which are structurally and genetically different from type I Interferons. These Interferons induce signal transduction pathways similar to type I Interferons which results in the activation of Interferon Stimulated Genes (ISGs). This group of Interferons are tissue specific and reported to have antiviral activity. In the present communication, we report the expression of bovine IFNλ3 gene (coding for the mature protein) in Pichia pastoris, purification of the expressed protein and evaluation of its biological activity. About 19 kDa protein expressed by the transformed Pichia cells, secreted into the media and the protein was purified by SP-Sepharose ion exchange chromatography with NaCl stepwise gradient elution. Specificity of the protein was confirmed by Western blotting. Pichia expressed IFNλ3 was found to be biologically active, as it induced ISGs (Mx protein, OAS and PKR genes) in bovine PBMCs. Further it was also found to modulate Th1/Th2 cytokines expression in the stimulated bovine PBMCs.

1. Introduction Interferons (IFNs) constitute the first line of defence against viral infections and they are used as bio-therapeutics for controlling several viral infections. Interferon lambda (IFNλ) also knew as Type III Interferons activates JAK-STAT pathway resulting in the induction of Interferon stimulated genes (ISGs) expression. ISGs like GTPase Mx1 (Myxovirus resistance 1), ribonuclease L (RNaseL) and Protein Kinase R (PKR) which are induced are known to have to have antiviral activity. These Interferons reported to have anti-tumor and immune modulating effects in addition to antiviral activity. Only a limited subset of tissues responds to type III Interferons in contrast to the almost universal response to type I Interferons [8,9]. Different levels of IFN-λ receptor expression in the target tissues underlines the possibility of Interferon therapy targeting at a particular tissue. Type III Interferon family comprises of IFNλ1 (IL29), IFNλ2 (IL28A), IFNλ3 (IL28B) and the very recently described IFNλ4 in humans. IFNλ3 protein from human and mice were well characterized but bovine IFNλ3 was not studied so far except a single report where bovine IFNλ3 expressed using adenoviral system [5]. To address the viral infection in animals (bovine), there is a need of species specific IFNλ3 protein to use as therapeutic agent for the control of viral infection at early stages. The ultimate objective of the present study is to use the antiviral activity of IFNλ3 against most contagious disease of bovine i.e. FMDV (Foot-and- mouth disease) infection. In this manuscript, we report the expression of bovine IFNλ3

∗

gene encoding mature protein in Pichia pastoris, purification and the evaluation of its biological activity. This protein will be further analyzed for its anti-viral activity against FMDV infection. 2. Materials and methods 2.1. Cloning of mature bovine IFNλ3 in yeast shuttle vector pPICZαA pcDNA-IFNλ3 plasmid construct used in the study as a source of IFNλ3 gene is available in our laboratory. The plasmid was used for amplification of the sequence encoding IFNλ3 mature protein by gene specific forward and reverse primers with XhoI restriction sites. The Kex2 cleavage site (AAAAGA) coding sequence included in the forward primer which enables the cleavage of the protein expressed to get authentic N-terminal aa of hte mature IFNλ3. After amplification, PCR product was digested with XhoI and ligated to XhoI digested pPICZαA vector. The ligation mixture was transformed into E. coli Top 10 cells using low salt LB-Zeocin plates (1%Tryptone, 0.5%yeast extract, 0.5%NaCl and 2%agar and Zeocin at 100 μg/ml of media). The colonies were further streaked in to fresh low salt LBZeocin plates and screened for the presence and orientation of the insert by colony PCR using 5′AOX1 vector specific forward primer and insert specific reverse primer (IFNλ3 R). Presence of the insert was further confirmed by RE digestion and sequencing.

Corresponding author. E-mail address: [email protected] (G.R. Reddy).

https://doi.org/10.1016/j.pep.2017.12.007 Received 12 September 2016; Received in revised form 23 November 2017; Accepted 20 December 2017 Available online 24 December 2017 1046-5928/ © 2017 Elsevier Inc. All rights reserved.


S. Barathiraja et al.

using histopaque-1077 (Sigma-Aldrich). The blood sample was centrifuged in a swing out rotor at 2500 rpm for 20 min at room temperature. The buffy-coat was collected and layered on 2 ml of histopaque-1077 and centrifuged at 2500 rpm for 30 min at room temperature to collect layer of PBMC at the interface between the lower histopaque-1077 and the upper plasma and it was transferred in to 15 ml centrifuge tube with 10 ml of sterile 1X PBS and centrifuged at the same condition. Supernatant was discarded and to the pellet around 500 μl chilled sterile distilled water was added and incubated for 40 s to lyse the RBC's and then about 5 ml sterile 1X PBS was added and centrifuged at 2500 rpm for 10 min. The supernatant was discarded and washed once with 10 ml RPMI-1640 (Roswell Park Memorial Institute medium-1640, Sigma-Aldrich) media by centrifugation at 2500 rpm for 10 min and the cells were re-suspended in RPMI-1640 to make the cell concentration at 1 million cells per ml of RPMI-1640 with 8% serum. These PBMCs about 1 ml was seeded into 12 well plate and the plate was incubated for 2 h for the cells to settle into the bottom of plate and proceeded for incubation with protein and ISGs studies. The PBMCs (1million per well) in 12 well plate were incubated with 1 μg of IFNλ3 protein for 6 h at 37 °C with 5% CO2 level. After the incubation the media was removed, cells were washed with 1XPBS (pH7.4) 0.5 ml of TRIzol (Invitrogen) was added. Total RNA from the treated cells were extracted using Trizol reagent (Life technologies, USA). The concentration of RNA was determined using Nanodrop-Spectrophotometer and the Purity was assessed by A260 nm:A280 nm ratio and by agarose gel electrophoresis. cDNA was synthesized using an oligod(T) primer (150pm per reaction) and MMuLV Reverse Transcriptase enzyme (200,000U/ml, cat no. M0253S, NEB). qPCR was performed with specific primers for Mx protein, OAS, PKR genes using 7500 Fast Real Time PCR system (Appied Bisosystems) and PowerUp SYBR Green Master mix (Cat No: A25742, Applied Biosysytems, USA). The reaction mix (10 μl) composed of 2X SYBR green mixes: 5 μl, Forward Primer (20pm per μl): 0.2 μl, Reverse Primer (20pm per μl): 0.2 μl, sterile distilled water: 3.6 μl, cDNA: 1 μl). qPCR results were analyzed by relative quantification method, where bovine β-actin was used as the internal control gene. The PCR conditions consist of an initial holding step at 50 °C for 2min and 95 °C for 2min followed by 40 cycles at 95 °C for 15sec and at 60 °C for 1min.

2.2. Expression of mature bovine IFNλ3 in Pichia pastoris Pichia pastoris (GS115 strain) cells grown overnight in 5 ml of YPD (1% yeast extract, 2% peptone and 2% dextrose), inoculated into 200 ml of fresh YPD and grown to reach OD600 = 1.5–2.0. Cells were harvested, washed twice with ice-cold sterile water and final washing with 20 ml of 1 M Sorbitol. Cell pellet was suspended in 1 ml of 1 M Sorbitol. About 8 μg of SacI linearized pPICZαA-IFNλ3 plasmid was added to 80 μl cells and electroporated at 1.5 KV with 25 μF capacitance using Gene Pulser (BioRad). After electroporation cells were suspended in 1 ml of 1 M Sorbitol, grown for 1 h at 30 °C without shaking and plated on YPDS-Zeocin plates (1% yeast extract, 2%peptone, 2%dextrose, 1 M Sorbitol, 2%agar and Zeocin at 100 μg/ml of media). Plates were incubated at 30 °C for 2–3 days until the colonies appear. Colonies were further streaked on fresh YPDS plate (with Zeocin 100 μg/ml of media) and incubated at 30 °C for 2–3 days. Zeocin resistant colonies were inoculated into 25 ml of BMGY (1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer, pH 6.0, 1.34% YNB, 0.04 mg% biotin and 1% glycerol) medium and grown till OD600 reaches to 2–6. Cells re-suspended in 20 ml of BMMY (1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer pH 6.0, 1.34% YNB, 0.04 mg% biotin and 0.5% methanol) medium to induce expression by adding methanol (final concentration of 1%) at every 24 h interval. Supernatant collected at 48, 72 and 96 h induction were precipitated with ammonium sulphate (60%w/v saturation) for 4 h at 4 °C and dissolved in 1X phosphate buffered saline (PBS) and dialysed against 1X PBS overnight at 4 °C. Dialysed protein was analyzed by 12% SDS-PAGE and protein yield in the crude sample was estimated by Bradford assay method [3]. 2.3. Purification of bovine IFNλ3 by Ion exchange chromatography IFNλ3 was purified by SP-Sepharose ion exchange chromatography using NaCl gradient. Protein sample was dialyzed against 0.1 M citrate and loaded on SP-Sepharose (GE Healthcare) column which was earlier equilibrated with 0.1 M citrate buffer (pH 4.2). Column was initially washed with equilibration buffer to remove the unbound protein and the elution was carried out by stepwise gradient using NaCl (0.5 M, 1.0 M and 1.5 M). Elutes collected in all the gradient steps were analyzed for the presence of protein by O. D at 280 nm. All the steps of equilibration, washing and elution were carried at a constant flow rate of 15 ml/h at 4° C. Elutes with protein were dialyzed against 1XPBS overnight at 4 °C and analyzed by 12%SDS-PAGE. Specificity of the protein was further confirmed by western blotting using mouse IFNλ3 antibodies raised in goat (cat No: AF1789 from R& D systems, USA). The protein in 12% SDS-PAGE gel was transferred to 0.2 μm nitrocellulose membrane (Product no.88024, Thermo Scientific) using Transblot SD semidry transfer cell (Bio-Rad) at 5 V for 45 min. After transfer, the membrane was blocked with overnight incubation in 3% skim milk powder, membrane was washed with washing buffer (1XPBS-Tween 20) and incubated with mouse IFNλ3 antibodies for 1 h at 25 rpm (25 °C). The membrane further was washed and incubated with rabbit anti-goat secondary antibody-HRPO (Horse radish peroxidise) conjugate for 1 h. Then membrane was washed, developed by o-Dianisidine dihydrochloride (ODD-Sigma) substrate in presence of H2O2 (10 mg ODD and 100 μl H2O2 in 10 ml of substrate buffer). The blot was also analyzed separately by Chemiluminescence method using clarity western ECL substrate (cat.no:170–5060, Bio Rad).

2.5. Modulation of bovine cytokine response by IFNλ3 The effect of bovine IFNλ3 on Th1/Th2 cytokine expression in bovine PBMCs was evaluated by qPCR. Bovine PBMCs were incubated with 1 μg of purified IFNλ3 protein for 12 h and RNA extracted from the cells was analyzed by qPCR using primers mentioned in Table 1. Table 1 Primers used in the experiment.

2.4. Biological activity of expressed bovine IFNλ3 Biological activity of the purified bovine IFNλ3 was evaluated by analyzing ISG expression in bovine PBMCs upon stimulation. Whole blood was collected from apparently healthy cow at jugular vein using 18G needle in a heparin coated vacutainer and PBMCs were isolated 15

S.No

NAME

SEQUENCE

Tm

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Mx1 L (RT) Mx1 R (RT) OAS L (RT) OAS R (RT) PKR L (RT) PKR R (RT) ACTB RTL ACTB RTR IL-2-RT-L IL-2-RT-R IL-4(Lq) IL-4 (Rq) IL-6 (Lq) IL-6 (Rq) IL-12A RT-L IL-12A RT-R IFNλ3-R IFNλ3F

CCCTCCACAGATGAGATCTT TTCTTGAGCTGCTCGCCATA GTTGCTGGTAAAGACGCAAAT CATCAGGTCGCTGTGTTCTT GGAGTGCATTATATACATTCAGA ACTTGTCCGCGTTTCATCATT CCTCACGGAACGTGGTTACA TCCTTGATGTCACGCACAATTT ACTTGAACCCCAGAGAGAT TACAGCGTTTACTGTTGCAT CTGAACATCCTCACAACGAGAA CCAGGAATTGTTCAAGCACGT CCTCATCCTGAGAAACCTTG ACATAAGTTGTGTGCCCAT GTTCCAGGCCATGAATGCA CTTTCAGGGAGGGTTTCTGT GGCGCTCGAGTCAGACACACTGGTCTCC TCTCTCGAGAAAAGAGTTCCTGTGCCCTCTGCCC

53.5 °C 56.5 °C 54.1 °C 55. °C 50 °C 55.2 °C 57.1 °C 55.9 °C 52.7 °C 52.3 °C 54.7 °C 56 °C 52.7 °C 51.9 °C 56 °C 54.5 °C 66.9 °C 77.4 °C



Fig. 1. AGE of PCR Amplified of matured IFNλ3. Lane 1 & 2: PCR amplified matured IFNλ3 (around 550bp). Lane 3: No template control. Lane 4: 1 kb DNA Ladder (OGeneRuler, cat. no:SM1163, ThermoScientific).

Fig. 3. 12% SDS-PAGE analysis shows expression of bovine IFNλ3 protein in Pichia. Lane 1, 2&3: Expression of 19 KDa of bovine IFNλ3 protein at 48, 72 and 96 h respectively. Lane 4: Supernatant from control GS115 cell. Lane 5: Protein Molecular Weight Marker (cat.no.26610, ThermoFisher Scientific).

Bovine β-actin was used as the internal control gene. Instrument used for the analysis was 7500 Fast Real Time PCR system (Appied Bisosystems) with 7.00 software version 2.5. The data were analyzed using t-test.

3.2. Expression of pPICZαA-IFNλ3 in Pichia pastoris Recombinant plasmid with IFNλ3 insert (pPICZαA- IFNλ3) was linearized with SacI and transformed into GS115 Pichia pastoris cells with Zeocin resistance as the marker for the recombinant selection. Colonies grown on Zeocin plates were picked up and analyzed for expression of IFNλ3 gene. The expression was induced by addition of methanol (1% of final volume). Supernatants collected from 48 to 96 h of induction at 24 h intervals were precipitated by ammonium sulphate and dialyzed. The sample was analyzed by 12% SDS-PAGE and protein bands were further stained by Coomassie Blue Staining. A Protein band of 19 kDa in size observed in induced cultures (Fig. 3: lane 1, 2 & 3). This band was not seen in supernatant from control GS115 cells. Optimal levels of IFNλ3 expression was observed at 72 h of induction. This crude protein yield was estimated by Bradford assay method and it was found to be 2.4 mg in 40 ml of supernatant which comes to 60 mg per Litre. IFNλ3 protein was further purified by SP-Sepharose ion exchange chromatography. About 2.4 mg of protein was loaded into the equilibrated SP-Sepharose column, washed with equilibration buffer and eluted in 0.5 M, 1 M and 1.5 M NaCl. Elutes collected in all the gradient steps were analyzed for presence of protein by O. D at 280 nm. Elutes were pooled, dialyzed against 1XPBS overnight at 4 °C and lyophilized. This eluted protein yield was estimated by Bradford assay method and it was found to be 0.9568 mg in 40 ml of total supernatant used (23.92 mg/L). The protein sample was analyzed by 12%SDS-PAGE using Coomassie Blue Staining. A thick band of 19 kDa seen in lane 1 of Fig. 4 A corresponds to IFNλ3 protein which shows that the protein got eluted in 1.5 M NaCl. Protein samples on 12%SDS-PAGE were transferred to membrane by blotting and detected by using mouse IFNλ3 antibodies. The protein band reacted with IFNλ3 antibodies confirms specificity of the protein (Fig. 4B: lane 1 & 2). The blot was developed by chemiluminescence method also and it was showing a thick clear band of 19 KDa in size (Fig. 4C: lane1).

3. Results 3.1. Construction of pPICZαA-IFNλ3 plasmid to express bovine IFNλ3 with authentic N-terminal amino acid Sequence encoding for mature bovine IFNλ3 protein was amplified with specific primers containing XhoI site using pcDNA-IFNλ3 plasmid as a template. The PCR fragment amplified was about 550 nt in size (Fig. 1: lane 1 & 2). Amplified product was digested and cloned into pPICZαA vector at XhoI site and the recombinants were screened for the presence and the orientation of the insert by colony PCR. Colonies showing amplification of 850 bp PCR product shows presence of insert (Fig. 2: lane 2, 3, 4 & 5). Amplification of 850bp PCR product confirms the correct orientation of the insert (which include the 550bp of the insert and 300 bp of the vector). Presence of the insert was further confirmed by RE digestion using gene specific primers and sequencing.

3.3. Bovine IFNλ3 expressed in Pichia pastoris is biologically active Biological activity of bovine IFNλ3 expressed in Pichia pastoris was evaluated by assessing induction of ISGs in bovine PBMCs. PBMCs stimulated with the purified IFNλ3 at 6 h was measured for induction of ISGs by qPCR using β-actin gene as housekeeping gene. qPCR analysis has shown the induction all the three ISGs (Mx protein, PKR, OAS

Fig. 2. AGE of Colony PCR product confirming clone & orientation Lane1: 1 kb DNA ladder (O-GeneRuler, cat. no:SM1163, Thermo Scientific). Lane 2, 3, 4 &5: positive colonies with matured IFNλ3 amplified using 5′AOX and IFNλ3-R primers (around 850bp).

16



Fig. 6. Modulation of bovine cytokine response by IFNλ3: Bovine PBMCs in 12 well plate incubated with 1 μg/well of bovine Interferon λ3 protein. RNA extracted from the cells at 12 h incubation was subjected to RT-qPCR with cytokine specific primers with β-actin as housekeeping gene. Relative quantification was done by calculating 2-ΔΔCt.

4. Discussion Recent findings suggest that IFNλ plays an important role in innate immunity as a first-line defence against invading pathogens through skin and mucosal surfaces. There are three subtypes of IFN-λ reported in humans (λ1/IL29, λ2/IL28A and λ3/IL28B) and two in mice (λ2 and λ3, where λ1 is a pseudogene). There was no study on expression and purification of bovine IFNλ3 till now. Here we describe the expression of IFNλ3 gene encoding for mature protein in Pichia pastoris, purification and evaluation of the protein for its biological activity. IFNλ3 protein mature form encoding sequence was cloned at XhoI site in pPICZαA vector to obtain the protein without any fusion/tag. Once the protein is expressed and secreted into the media, it will be cleaved by kex2 enzyme (produced by Pichia host cells) resulting in the processed protein with authentic N-terminal amino acid. Proteins secreted into the supernatant were concentrated using ammonium sulphate precipitation prior to the chromatography step. For purification of protein, SP-Sepharose ion exchange chromatography selected based upon the calculated isoelectric point of the protein (pI = 8.02). SP-Sepharose bound IFNλ3 was eluted at 1.5 M NaCl gradient. Specificity of the purified protein was confirmed by blotting followed by colour development as well as by chemiluminescence using mouse IFNλ3 antibodies. Dellgren and co workers (2009) purified E. coli expressed human IFNλ3 by cation exchange chromatography using HiTrap SP FF column [4]. Interferons stimulate the expression of several genes known as ISGs through which it inhibits the replication of invading virus. OAS, PKR and Mx protein genes are some of the ISGs stimulated by type I and III Interferons as well. In vitro studies have proved that type I and III interferons stimulate the ISGs which in turn inhibit viral replication. We observed that purified bovine IFNλ3 stimulating ISG expression effectively in bovine PBMCs. PKR inhibits the translation in the cells by phosphorylating eukaryotic translation initiation factor-2alpha [2]. PKR gene was stimulated by thirteen folds within 6 h of incubation of PBMCs by IFNλ3 protein. There was threefold increase in OAS gene induction where as seven-fold increase in case of Mx protein gene expression. OAS protein as inactive monomer accumulates in cytoplasm, when activated triggers RNAseL to cleave the cellular and viral RNAs. Mx protein monomers accumulate in the cytoplasm (endoplasmic reticulum) during viral infection, monomers are released and binds to viral components especially nucleo capsids and degrade them [1]. Induction of all the three ISG expression by the expressed IFNλ3 clearly demonstrates that the purified protein product is biologically active. Stimulation of OAS and Mx protein genes by human IFNλ3 in murine hepatocytes was reported by Harold Dickensheets and coworkers [6]. Recombinant replication-defective human adeno virus vector

Fig. 4. A: 12% SDS-PAGE analysis shows purification of bovine IFNλ3 protein by ion exchange chromatography. Lane 1: 1.5 M NaCl elute shows 19 kDa size of IFNλ3 protein. Lane 2: 1 M NaCl shows no protein. Lane 3: 0.5 M NaCl shows no protein. Lane 4: Blank. Lane 5: Protein Molecular Weight Marker (cat.no.26610, ThermoFisher Scientific). B: Western blotting analysis confirms bovine IFNλ3 protein expression: Lane 1 & 2: Purified protein. Lane 3: Thermo Scientific Page Ruler Prestained Protein Ladder (cat.no.26616). Lane 4: Supernatant from control GS115 cells. C: Blot development by Chemiluminescence: Lane1: Purified IFNλ3 protein shows the size of 19 KDa Lane2: Supernatant from control GS115 cells. Lane3: Precision Plus Western C standards (cat.no: 161–0376, Bio-rad).

Fig. 5. ISGs expression in bovine PBMC: Bovine PBMCs in 12 well plate incubated with 1 μg/well concentration of bovine Interferon λ3 protein. RNA extracted from the cells at 6 h incubation was subjected to RT-qPCR with β-actin as housekeeping gene. Relative quantification was done by calculating 2-ΔΔCt. Data presented as mean ± SE of 2-ΔΔCt.

coding genes) but the level of induction was different for each of the ISGs. PKR gene was expressed about thirteen-fold, Mx protein gene was induced about four and half fold OAS gene about two-fold in comparison to control (Fig. 5). Isolated bovine PBMCs were incubated with 1 μg of bovine IFNλ3 protein, RNA extracted and IL2, IL4, IL6 and IL-12 gene expression was quantified by qPCR. There was a three-fold increase in IL-12, two-fold increase in IL-4 expression was observed where as IL2 expression was increased by 1.5 fold compared to the un stimulated cells (Fig. 6). 17



Appendix A. Supplementary data

expressing bovine IFNλ3 found to stimulate ISGs namely OAS, PKR and Mx about 23, 8 and 6 folds respectively in bovine PBMCs [5]. Type III interferon receptors are expressed on most of the immune cells indicating their role in innate and adaptive immune responses. Though the role of IFNλ1 and IFNλ2 in modulating the immune responses and cytokine expression was investigated, the role of IFNλ3 in immune modulation was not well understood. We incubated bovine PBMCs with purified bovine IFNλ3 and evaluated Th1/Th2 cytokine expression. We observed increased IL2, IL12 and IL4 expression in IFNλ3 stimulated cells indicating the role in both Th1/Th2 cytokine modulation. There was a significant increase in IL-12, compared to other cytokines. IL-12 bridges innate and adaptive immunity as it induces differentiation of naive CD4+ T cells to Th1 cells and activates NK cells [10]. Jordan and co-workers [7] reported that human interferonλ1 (IL29) modulates Th1/Th2 responses in human PBMCs where they have shown the up regulation of Th1 and down regulation of Th2 cytokine responses. In this study, we have reported the expression and purification biologically active bovine IFNλ3 protein. The purified protein was found to stimulate ISGs, which play important role in inhibition of viral replication. This protein will be further evaluated as antiviral agent to inhibit viral replication.

Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.pep.2017.12.007. References [1] M.A. Accola, B. Huang, A.I. Mastri, M.A. McNiven, The antiviral dynamin family member, MxA, tabulates lipids and localizes to the smooth endoplasmic reticulum, J. Biol. Chem. 277 (2002) 21829–21835. [2] J.S. Anthony, B.R.G. Williams, Interferon-inducible Antiviral Effectors, Nature Reviews Immunology vol. 8, (2008), pp. 559–568. [3] M.M. Bradford, A. Rapid, Sensitive, Method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [4] C. Dellgren, H.H. Gad, O.J. Hamming, J.R. Melchjorsen, Hartmann, Human interferon-λ3 is a potent member of the type III interferon family, Gene Immun. 10 (2) (2009) 125–131. [5] Eva Perez-Martin, Marcelo Weiss, Fayna Diaz-San Segundo, J.M. Pacheco, Jonathan Arzt, Marvin, J. Grubman, Teresa de losSantosa, Bovine type III interferon significantly delays and reduces the severity of foot-and-mouth disease in cattle, J. Virol. 86 (2012) 4477–4487. [6] Harold Dickensheets, Faruk Sheikh, Ogyi Park, Bin Gao, P. Raymond, Donnell,Interferon-lambda (IFNλ) induces signal transduction and gene expression in human hepatocytes, but not in lymphocytes or monocytes, J. Leukoc. Biol. 93 (2013) 377–385. [7] W.J. Jordan, J. Eskdale, S. Srinivas, V. Pekarek, D. Kelner, M. Rodia, G. Gallagher, Human interferon lambda-1 (IFN-lambda1/IL- 29) modulates the Th1/Th2 response, Gene Immun. 8 (2007) 254–261. [8] A. Meager, K. Visvalingam, P. Dilger, D. Bryan, M. Wadhwa, Biological activity of interleukins-28 and -29: comparison with type I interferons, Cytokine 31 (2005) 109–118. [9] C. Sommereyns, S. Paul, P. Staeheli, T. Michiels, IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo, PLoS Pathog. 4 (2008) e10000171–12. [10] Therwa Hamza, B. John, Barnett Bingyun Li, Interleukin 12 a key immunoregulatory cytokine in infection applications, Int. J. Mol. Sci. 11 (2010) 789–806.

Acknowledgement The authors acknowledge the Director, IVRI (Indian Veterinary Research Institute) Izatnagar and Joint Director, IVRI, Bangalore for providing facilities. The first author also acknowledges ICAR (Indian Council of Agricultural Research) India for the ICAR-Senior Research Fellowship.

18