Protein Expression and Purification 21, 60 – 64 (2001) doi:10.1006/prep.2000.1339, available online at http://www.idealibrary.com on
Expression and Purification of Extracellular Penicillin G Acylase in Bacillus subtilis Sheng Yang, He Huang, Ruan Zhang, Xiaodong Huang, Shiyun Li, and Zhongyi Yuan 1 Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China
Received June 2, 2000, and in revised form August 18, 2000
Penicillin G acylase (PGA) is one of the most important enzymes for the production of semisynthetic -lactam antibiotics and their key intermediates. To enhance its expression, the PGA gene from Bacillus megaterium was amplified by PCR and subcloned into an expression vector under the control of the P43 promoter. The resulting construct was transferred into Bacillus subtilis WB600 and the transformant producing the most PGA was selected and designated SIBAS205. In contrast to the parent cells, which have to be induced by phenylacetic acid and cultured at 28 and 25°C successively to produce PGA, the recombinant cells needed neither induction nor thermoregulation during fermentation at 37°C. PGA was secreted and reached an expression level of 40 U/mL under optimized conditions. The enzyme was separated by centrifugation and purified by Al 2O 3 adsorption and phenyl-Sepharose CL-4B hydrophobic chromatography with a yield of 85%. The purified enzyme had a specific activity of 45 U/mg protein. © 2001 Academic Press
The industrial production of -lactam antibiotics and their intermediates is undergoing a remarkable transformation. Traditional chemical conversions based on stoichiometry are being replaced by enzyme-catalyzed processes. Since the end of the 1960s, the majority of N-deacylations of penicillin and cephalosporin G for industrial production of 6-APA and 7-ADCA have been carried out by a group of penicillin acylases (PGA, 2 EC 3.5.1.11) to accelerate the commercialization of semisynthetic -lactam antibiotics. In the past 20 years, 1
To whom correspondence should be addressed. Fax: 86-2164338357. E-mail:
[email protected]. 2 Abbreviations used: PGA, penicillin G acylase; PAA, phenylacetic acid; Km, kanamycin; Ap, ampicillin; NIPAB, 6-nitro-3-phenylacetaminobenzoic acid; LB, Luria–Bertam. 60
more effort was put into exploiting the same enzyme to catalyze synthesis of new cephalosporins based on its catalysis of the reverse reaction, i.e., the condensation of the appropriate D-amino acid analogs with the -lactam nucleus, such as 7-ADCA and 7-ACA (1). This resulted in a tremendous change in the world market for -lactam antibiotics in recent years. A variety of strategies have been designed to increase the productivity of the strain carrying the PGA gene by screening mutant strains isolated by conventional mutagenesis and by using DNA technology to construct recombinant PGA overproducing strains. The penicillin acylase from Bacillus megaterium is one of the most massive and widely used enzymes in the -lactam antibiotics industry. The enzyme is secreted out of the B. megaterium cells and easily separated and purified. However, it is inconvenient to add PAA into medium to induce PGA in large-scale fermentations. Some successful cloning and expression of cloned B. megaterium PGA genes in Escherichia coli and Bacillus subtilis has been reported, but the PGA yields were always less than the expression level provided by the parental B. megaterium strain (6 U/ml) (2, 3). In recent years, we have tried to use genetic engineering to construct a microorganism that would produce PGA in high yield. The PGA gene has been isolated from B. megaterium and cloned in E. coli, Pichia pastoris, and B. subtilis, as reported previously (4 – 6). Among these expression systems, the most successful one is presented in this paper which deals with the subcloning of the B. megaterium PGA gene into B. subtilis with PGA overproduction and the efficient purification of the enzyme. MATERIALS AND METHODS
Strains, Plasmids, and Media The parent organism B. megaterium AC8904 is a strain that needs phenylacetic acid (PAA) and temper1046-5928/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
EXPRESSION AND PURIFICATION OF PENICILLIN G ACYLASE
61
FIG. 1. Construction of PGA expression plasmid pEES102. pPGA was digested by EcoRI, followed by a filling reaction using Klenow fragment. It was further digested by BamHI to release a 2.4-kb fragment carrying the PGA gene. This fragment was then inserted into SmaI ⫹ BamHI-digested pPZW103, to generate pEES102.
ature variation for the induction of PGA. E. coli XL1Blue and B. subtilis WB600 are the hosts for transformation. pPZW103 is the derivative plasmid of pUB110 with P43 as promoter (7). B. megaterium and E. coli were grown with aeration at 37°C in LB medium (tryptone 1 g, yeast extract 0.5 g, and NaCl 1 g in 1 L). B. subtilis-competent cells were prepared following the method described by Sadaie et al. (8). The initial demonstration of enzyme production by B. subtilis was done in LB. The agar medium used was LB plus 15 g/L agar. For antibiotic selective media, kanamycin (Km) or ampicillin (Ap) was added at 10 or 50 g/mL, respectively. Reagents Endonucleases, Taq polymerase, DNA polymerase I (Klenow fragment) and T4 DNA ligase were purchased
from Boehringer. Yeast extract was from Shanghai Yeast Factory (Shanghai, China), tryptone from Guojia (Shanghai, China), starch from Linhu Food Chemical Factory (Zhejiang, China), 6-nitro-3-phenylacetaminobenzoic acid (NIPAB) from Dongfeng Reagent Factory (Shanghai, China), and aluminum oxide (neutral) from Shanghai Wusi Chemical Reagent Factory (Shanghai, China). Other reagents were of AR grade. Construction of Recombinant Plasmids Plasmid pEES102 for the expression of PGA was constructed using an expression cassette PCR technique to provide cloning sites and optimum translational signals for the expression of foreign protein in B. subtilis. Chromosomal DNA from B. megaterium was prepared following the method described by Marmur (9). The 5⬘ PCR primer contained a 5⬘ EcoRI restriction
62
YANG ET AL.
FIG. 2. Influence of temperature on PGA production. A single colony of B. subtilis SIBAS205 was grown in 3 mL LB–Km. After 18 h of incubation at 37°C with aeration, 0.5 mL of the exponentially growing culture was withdrawn and added to the 50-mL medium in 250 mL shake flask. Fermentation was performed on a rotary shaker at 25, 30, 37, and 40°C, respectively, for 24 h.
site (GAATTC), a strong ribosome binding site (GGAGG) that is also the original ribosome site of P43 and an optimum spacer element, which is rich in AT and beneficial for gene expression in B. subtilis. The sequence of the 5⬘ primer was 5⬘ ⬎ GCCGAATTCGGAGGTGGAAATGTAAT ⬍ 3⬘. The 3⬘ primer consisted of the codon for the five c-terminal amino acids of PGA, a translational stop signal (TAA), and the 3⬘ BamHI restriction site. The sequence of the 3⬘ primer was 5⬘ ⬎ GTGGATCCTTACTTACTCATATTTAA ⬍ 3⬘. The PCR reactions was performed with 1 min at 94°C, 1 min at 50°C, 3 min at 72°C for 30 cycles. The PCR product (2.4 kb) and pBluescript SK(⫹) were digested with EcoRI and BamHI, purified, ligated, and transformed into XL1-Blue and then sequenced (GenBank Accession No. AF161313). The resulting plasmid, designated pPGA, was digested by EcoRI, followed by a fill-in reaction using Klenow fragment. It was further digested by BamHI to release a 2.4-kb fragment carrying the PGA gene. This fragment was then inserted into SmaI ⫹ BamHI-digested pPZW103, to generate pEES102 (Fig. 1). The ligated DNA was transformed into B. subtilis WB600-competent cells and transformants were selected on LB-agar plates containing 10 g of kanamycin per milliliter at 37°C after overnight incubation. Single colonies were picked from plates and grown at 37°C for 24 h in 3 mL LB–Km and the transformant producing the most PGA was selected and designated SIBAS205. Expression of Penicillin G Acylase For the shake flask culture, the single colony from a LB–Km–agar plate was inoculated in 3 mL LB–Km.
FIG. 3. Effect of PAA on cell growth and PGA production. A single colony of B. subtilis SIBAS205 was grown in 3 mL LB–Km. After 18 h of incubation at 37°C with aeration, 0.5 mL of the exponentially growing culture was withdrawn and added to the 50-mL medium containing 0 to 0.4% PAA in a 250-mL shake flask. Fermentation was performed on a rotary shaker at 37°C for 24 h.
After 18 h of incubation at 37°C with aeration, 0.5 mL of the exponentially growing culture was withdrawn and added to the 50 mL medium in 250 mL shake flask.
FIG. 4. Influence of pH on PGA production. A single colony of B. subtilis SIBAS205 was grown in 3 mL LB–Km. After 18 h of incubation at 37°C with aeration, 0.5 mL of the exponentially growing culture was withdrawn and added to the 50 mL LB of pH 4 to 10 in a 250-mL shake flask. Fermentation was performed on a rotary shaker at 37°C for 24 h.
63
EXPRESSION AND PURIFICATION OF PENICILLIN G ACYLASE
TABLE 1 Effect of Carbon Source on Cell Growth and PGA Production
Medium
LB
LB ⫹ glucose (1.0 g/L)
LB ⫹ glucose (⬎2.5 g/L)
LB ⫹ sucrose (30 g/L)
LB ⫹ starch (10 g/L)
A 600 PGA activity (U/ml)
3.0 4.0
3.5 5.0
3.5–4 0
10 7.0
15 17
Fermentation was performed on a rotary shaker at 37°C. Assay for Penicillin G Acylase Penicillin G acylase activity was determined by a modification of the method of Kutzbach (10). Samples were added to a solution of 0.15 mmol/L NIPAB in 50 mmol/L sodium phosphate buffer, pH 7.5, and the change of absorbance at 405 nm was measured. One unit of enzyme activity is defined as the amount of enzyme catalyzing the hydrolysis of 1 mol of substrate per minute at 37°C. Examination of Recombinant Plasmid (pEES102) Stability in Antibiotic-free LB A single colony from an LB–Km plate was inoculated into 3 mL LB and incubated at 37°C, 250 revolutions/ min, 24 h. The supernatant of the culture broth was assayed for PGA activity and 30 L was transferred to 3 mL of fresh LB, which was then cultured under the same conditions for 24 h. This procedure was repeated for 10 days. Purification of Penicillin G Acylase
concentration in the eluate was adjusted to 200 g/L and then applied to a phenyl–Sepharose CL-4B column preequilibrated with the same ammonium sulfate phosphate buffer as above. The column was washed with 200 g/L ammonium sulfate phosphate buffer and the enzyme was eluted with phosphate buffer. RESULTS AND DISCUSSION
The B. megaterium strain, as an effective PGA producer, was grown at 25–28°C for 48 h in a medium that contained yeast extract and induced by 0.2% PAA. As a result of the replacement of the native regulatory regions by P43, PGA production of the recombinant B. subtilis transformant was not sensitive to temperature or PAA. The maximum yield of PGA was achieved at 37°C in the absence of PAA (Figs. 2 and 3). The optimum pH for PGA production was about 7.0, and lower yields were obtained at either acidic or alkaline pH (Fig. 4). The cell density of B. subtilis SIBAS205 cultured in LB reached an A 600 only of 3.0. To improve the cell density and PGA yield, the carbon source was modified. Moderate concentration of glucose(聿 1.0 g/L) improved the yield of PGA. However, no PGA activity was detected when the
Before packing it into a column, aluminum oxide was treated with 0.1 mol/L HCl and then washed with H 2O to pH ⬎ 5.0 and the column was neutralized by phosphate buffer (0.05 mol/L, pH 7.0). The culture broth of B. subtilis SIBAS205 was centrifuged at 8000 revolutions/min for 15 min. The supernatant was applied to the aluminum oxide column and the column was washed with phosphate buffer until the effluent was clear. The PGA was eluted with 200 g/L ammonium sulfate in phosphate buffer. The ammonium sulfate
TABLE 2 Effect of Starch Concentration on Cell Growth and PGA Production Starch concentration (%)
1.5
2.5
3.0
4.0–6.0
A 600 PGA activity (U/mL)
18 27
20 30
25 35
25 42
FIG. 5. Stability of the plasmid pEES102. A single colony of B. subtilis SIBAS205 was grown in 3 mL LB free of kanamycine at 37°C for 24 h, and then 30 L of broth was transferred to 3 mL fresh LB, cultured under the same condition for 24 h. The daily transfer was repeated for 10 days.
64
YANG ET AL.
TABLE 3 Purification of PGA from the Culture Broth
No.
Volume (mL)
Total (protein/mg)
Total (activity/u)
Specific (activity/u mg ⫺1)
Recovery (%)
1 Crude broth supernatant 2 After Al 2O 3 3 After Phenyl–sepharose CL-4B
2,000 750 40
40,500 2,258 1,200
63,180 59,824 54,000
1.56 26.5 45
— 95 85
glucose concentration was above 2.5 g/L, though the cells grew well. High concentrations of sucrose could enhance enzyme production and starch dramatically enhanced enzyme production in comparison with other carbon sources (Table 1). Further examination of the influence of starch concentration on PGA production showed that the cell density reached an A 600 of 18 in the presence of 1.5% starch and increasing the starch concentration to 4% or higher could further improve both cell density and PGA yield (Table 2). While cell growth and PGA yields were increased simultaneously in case of starch as carbon source, increased growth did not give rise to increase PGA yields when other carbon sources such as PAA (Fig. 3) and glucose (Table 1) were tested. It implied that the PGA yields in B. subtilis were probably repressed by fast utilized carbon source of high concentration as that in B. megaterium. Our future study will focus on the mechanism of the repression. Instability of the plasmid is a problem with recombinant B. subtilis strains in large-scale fermentation. However, PGA productivity of the B. subtilis SIBAS205 was rather stable in the absence of antibiotic selection, as the loss of plasmid from recombinant B. subtilis was almost negligible in repeated inocula and cultures (Fig. 5). Purification of PGA from the culture broth of B. subtilis SIBAS205 by centrifugation, adsorption, and hydrophobicity chromatography achieved approximately 30-fold purification with an overall yield of 85% (Table 3). Our results showed that P43 is a very strong vegetative promoter for PGA expression in B. subtilis and the host WB600 is deficient in six proteases, which probably helps to improve the yield, as compared to other hosts such as BCL1050 and DB104 (data not shown). Using the protocol described here, efficient PGA production and recovery can be achieved.
ACKNOWLEDGMENTS We thank Dr Sui-Lam Wong (University of Calgary, Canada) for kindly providing Bacillus subtilis WB600. We also thank Professor Yi Xie (Fudan University, China) for pPZW103.
REFERENCES 1. Bruggink, A., Roos, E. C., and Vroom, E. D. (1998) Penicillin acylase in the industrial production of -lactam antibiotics. Org. Process Res. Dev. 2, 128 –133. 2. Martin, L., Cortes, M. A., Cortes, E., and Garcia, J. L. (1995) Cloning and sequencing of the pac gene encoding the penicillin G acylase of Bacillus megaterium. FEBS Microbiol. Lett. 125, 287– 292. 3. Meevootisom, V., and Saunders, J. R. (1987) Cloning and expression of penicillin acylase genes from overproducing strains of Escherichia coli and Bacillus megaterium. Appl. Microbiol. Biotechnol. 25, 372–378. 4. Huang, Y. H., Zhang, Y., Chu, R. A., Wu, X. F., Wang, Y. L., and Yuan, Z. Y. (1998) Cloning and expression of the pga gene of Bacillus megaterium in E. coli. Acta Biochim. Biophys. Sin. 30(2), 107–113. 5. Huang, Y. H., Yuan, Z. Y., and Wang, Y. L. (1999) Expression and Purification of the PGA gene of Bacillus megaterium in Bacillus subtilis. Chin. J. Biochem. Mol. Biol. 15(1), 169 –171. 6. Yang, S., Huang, X. D., Huang, Y. H., Li, S. Y., and Yuan, Z. Y. (1999) High expression of penicillin G acylase gene from Bacilus megaterium in Bacillus subtilis. Acta Biochim. Biophys. Sin. 31(5), 601– 603. 7. Wang, P. Z., and Doi, R. H. (1984) Overlapping promoters transcribed by Bacillus subtilis 55 and 37 RNA polymerase holoenzymes during growth and stationary phases. J. Biol. Chem. 259(13), 8619 – 8625. 8. Sadaie, Y., and Kada, T. (1983) Formation of competent Bacillus subtilis cells. J. Bacteriol. 153, 813– 821. 9. Marmur, J. (1961) A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3, 208 –218. 10. Kutzbach, C., and Rauenbusch, E. (1974) Preparation and general properties of crystalline penicillin acylase from Escherichia coli ATCC11105. Hoppe-Seyler’s Z. Physiol. Chem. 354, 45–53.
