expression and purification of recombinant ...

2 downloads 3 Views 726KB Size Report
Expression and Purification of Recombinant Mycobacterium Tuberculosis. Diagnosis Antigens, ESAT-6, CFP-10, and ESAT-6/CFP-10, and Their Potential.

Archive of SID

Iranian Red Crescent Medical Journal Original Article

Expression and Purification of Recombinant Mycobacterium Tuberculosis Diagnosis Antigens, ESAT-6, CFP-10, and ESAT-6/CFP-10, and Their Potential Use in the Diagnosis and Detection of Tuberculosis M Hemmati 1∆, A Seghatoleslam 1∆, M Rasti 1, S Ebadat1, N Mosavari 2, M Habibagahi 3, M Taheri 4 , A Sardarian 5 and Z Mostafavi-Pour 1, 6* 1 Recombinant Protein Laboratory, Biochemistry Department, Medical School, Shiraz University of Medical Sciences, Shiraz, IR Iran 2 PPD Tuberculin Department, Razi Vaccine and Serum Research institute, Tehran, IR Iran 3 Immunology Department, Medical School, Shiraz University of Medical Sciences, Shiraz, IR Iran 4 Faculty of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, IR Iran 5 Dental School, Shiraz University of Medical Sciences, Shiraz, IR Iran 6 Faculty for Advanced Biomedical Sciences, Shiraz University of Medical Sciences, Shiraz, IR Iran

Please cite this paper as: Hemmati M, Seghatoleslam A, Rasti M , Ebadat S, Mosavari N, Habibagahi M, Taheri M, Sardarian A, Mostafavi-Pour Z. Expression and Purification of Recombinant Mycobacterium Tuberculosis Antigens, ESAT-6, CFP-10 and ESAT-6/CFP-10, and Their Potential Use in the Diagnosis and Detection of Tuberculosis. Iran Red Crescent Med J. 2011;13(8):558-65. Ab st r a ct Background: One of the most widely used methods to detect tuberculosis (TB) infection is the tuberculin skin test (TST). full Sequencing of the Mycobacterium tuberculosis (M.tb) genome has led to the identification of several antigens that can be utilized for accurate diagnosis and control of TB. The aim of this study is to produce and purify several specific recombinant M.tb antigens in order to evaluate their potential use in the diagnosis of TB. Materials and Methods: The recombinant secretory antigens ESAT-6, CFP-10, and ESAT-6/CFP-10 were produced through PCR and cloning methods. To investigate the antigen-specific responses of these recombinant antigens in the detection of TB, ex vivo enzyme-linked immunospot (ELISPOT) tests were performed on samples of 30 clinically diagnosed TB patients. Results: Throughout this study, the selected M.tb antigens were cloned, expressed, and purified in Escherichia coli (BL21). The ELISPOT assays for the detection of TB showed sensitivity values of 93 %, 90 %, and 100 % for recombinant ESAT-6, CFP-10, and ESAT-6/CFP-10 proteins, respectively, which were significantly higher than the values obtained in conventional tuberculin skin test (TST). Conclusions: Our results show that these recombinant antigens can be used as an accurate detecting TB test for Iranian patients Keywords: Mycobacterium tuberculosis; ELISPOT; CFP-10; ESAT-6; TB diagnosis

Introduction Despite more than a century of researches on developing the best method to detect and treat tuberculosis (TB) infection throughout the world, the disease still remains * Corresponding author at: Zohreh Mostafavi-Pour, Recombinant Proteins Lab, Biochemistry Department, Shiraz University of Medical Sciences, PO Box: 71345-1167, Shiraz, IR Iran. Tel:.+98-7112303029, Fax :+98-7112303029, e-mail: [email protected] ∆ Both authors contributed equally to this work and both are considered first author. Received: 25 November 2010 Accepted: 11 April2011

a major cause of morbidity and mortality. TB accounts for approximately 3 million deaths annually, and 9 million new cases of the disease diagnosed each year (1, 2). In 2008, the World Health Organization (WHO) estimated that about 1.7 million people die each year because of TB infection (3). The incidence of all forms of TB in Eastern Mediterranean countries such as Iran is 104 per 100,000, and the incidence of smear-positive is 24 per 100,000 people (4). In Iran, most new TB cases occur among immigrants, particularly those from Afghanistan. The major cause of TB is infection by the intracellular pathogen Mycobacterium tuberculosis (M.tb). Alveolar

www.SID.ir

Archive of SID Diagnostic Potential of Recombinant Antigens of Mycobacterium Tuberculosis

559

Table 1. Primers and vector used for cloning of esat-6, cfp-10, and esat-6/cfp-10 (Restriction sites are underlined)

Antigen

Primer sequence ( 5' to 3' )

Forward (F) or Reverse (R)

Cloned between

Vector

ESAT-6

TAAGGATCCATGACAGAGCAGGAGTG

F

BamHI a and ECORI b

pGEX4T1

GCGAATTCTGCGAACATCCCAGTG

R

TAAGGATCCATGGCAGAGATGAAGAAC

F

BamHI and ECORI

pGEX4T1

GCGAATTCGAAGCCCATTTGCGAGGA

R

TAAGGATCCATGACAGAGCAGGAGTG

F

BamHI

pGEX4T1

c GGAACCTGGAGA TGCGAACATCCCAGTG

R

d TCTCCAGGTTCC ATGGCAGAGATGAAGAAC

F

AAGGAATTCGAAGCCCATTTGCGAGGA

R

ECORI

pGEX4T1

CFP-10

ESAT-6 /CFP-10

a BamHI site: GGATCC b ECORI site: GAATTC c GGAACCTGGAGA: Linker d TCTCCAGGTTCC: linker

macrophages are the main target of invasion by M.tb bacilli, in which the organism has the potential to survive and grow (5). Rapid and accurate diagnosis of TB is important in controlling the disease. In recent years, there has been emphasis on the development of new , rapid tests for the diagnosis of TB, such as detection of M.tb components in clinical specimens by using cell-mediated immune (CMI) responses (6). In a tuberculin skin test (TST), a commonly used CMI-based test, tuberculin purified protein derivative (PPD) is used to detect TB, but this test has low specificity (7). Therefore, a new diagnostic test based on specific antigens would be of great value in the screening and detection of TB. The availability of the fully sequenced genome for M.tb has provided the tools necessary for the identification of bacterial antigens that are potentially useful in the development of new reagents to diagnose and control TB.(7) The M.tb genome consists of 16 regions of differences (RDs). Among these regions, the RD1 locus, which plays a key role in the virulence of M.tb, is present in clinically pathogenic strains of M.tb and M. bovis, but is deleted in M. bovis Bacillus Calmette-Guerin (BCG) vaccine strains (4). This region contains 9 protein-coding genes (RV38713879c), which probably encode protective and/or virulent antigens (7, 8). Among the major antigens encoded on the RD1 locus, early secretory antigenic target-6 (ESAT6) and culture filtrate protein-10 (CFP-10), encoded by the genes esxA and esxB, respectively, form a 1:1 heterodimer-

ic complex in vitro. ESAT-6 is the best-characterized protein within the RD1 region. It has been recognized as an important stimulator of T cells both in vitro and in vivo (9). It has also been proposed to be a potential tool for the diagnosis of M.tb infection and is frequently used in enzyme-linked immunospot assay (ELISPOT) (10, 11). This assay is a specific method for identifying M.tb infection arising from the response to BCG vaccination. It is based on detection of interferon gamma (IFN-γ)producted by activated T cells after exposure to M.tb antigens. CMI-based tests such as ELISPOT permit early detection of TB infection in a setting of low endemicity, and also provide inexpensive tools for the diagnosis of TB in developing countries. Given the importance of ESAT-6 and CFP-10 secretion to mycobacterial virulence and the potential of these antigens to be used as diagnostic tools for the detection of TB, we expressed and purified these 2 antigens as well as their fused form, ESAT-6/CFP-10. In order to evaluate how useful these antigens are as markers in the detection of TB in Iranian patients, the diagnostic potential of commercial ESAT-6 was determined and compared with that of the produced recombinant proteins.

Materials and Methods Specimen collection The study population (n = 60) was divided into 2 groups. The first group (n = 30) was comprised of patients who

Table 2. Values for sensitivity, specificity, PPV, and NPV

Antigen

Sensitivity

Specificity

PPV a

NPV b

Recombinant ESAT-6

93

100

100

100

Recombinant CFP-10

90

96

96

100

Recombinant ESAT-6/CFP-10

100

100

100

100

Commercial ESAT-6

93

100

100

100

PPD

76

85

90

80

a ppv: Positive predictive value b Npv: Negative predictive value

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID 560

Hemmati M et al.

were diagnosed with pulmonary TB (as confirmed by examination of sputum for acid-fast bacilli and/or culturing), with no history of treatment for the disease. Twenty percent of these patients were Afghan immigrants, and the PPD skin test for all TB patients was performed. Among these, 25 % of the patients tested negative for the PPD skin test. All blood samples were obtained from the newly diagnosed sputum smear-positive patients reported to the Masih Daneshvari Hospital in Tehran before administration of chemotherapy. The second group was comprised of healthy BCG-vaccinated individuals (n = 30). Healthy donors were individuals without prolonged direct contact with TB patients, no history of TB vaccination during the 10 years prior to the study, and no other clinical TB symptoms. HIV-positive individuals were excluded from the study. All patients and normal subjects gave written informed consent prior to participation in the study.

Antibodies and reagents Mouse monoclonal ESAT-6 antibodies and glutathione S-transferase (GST) antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and mouse monoclonal CFP-10 antibodies were purchased from Ab-

kDa

1

2

3

4

5

6

cam. Glutathione-agarose purchased from Sigma, and isopropyl-1-thio-β-D-galactopyranoside (IPTG) was obtained from Fermentas (USA). Commercial ESAT-6 was obtained from Staten Serum Institute (Copenhagen, Denmark).

Bacterial strains Purified DNA from different mycobacterial strains, including M. tuberculosis C (M.tb C), M. tuberculosis DT, M. tuberculosis PN, M. bovis AN5, and M. IR 150, were provided by the Razi Serum and Vaccine Institute (Iran). We performed a bioinformatic analysis to compare the genomes of these strains with M.tb H37RV. The native M.tb C strain, which most closely resembled M.tb H37RV, was selected for our analysis.

Cloning of esat-6, cfp-10, and esat-6/cfp-10 fusion genes Standard procedures for PCR, transformation, cloning, and DNA analysis were used (5-12). All PCR constructs were sequenced to verify their integrity. The esat-6, cfp10, and esat-6/cfp-10 fusion genes were amplified from the genomic DNA of M.tb C by using the forward and reverse primers shown in Table 1. The PCR products were then cloned into the pGEX4T1 vector, which contained an kDa

1

2

3

4

5

6

42

42 26

26

17

17

10

10 ESAT-6 kDa

1

2

CFP-10 3

4

5

6

42 26 17 10 ESAT-6/CFP-10 Figure 1. Expression and purification of ESAT-6, CFP-10, and ESAT-6/CFP-10 proteins. Samples (lanes 1-6) were resolved in a 16 % (w/v) polyacrylamide gel, under reducing conditions. Lanes: (1) uninduced cells; (2) induced cells; (3) glutathione-agarose flow-through (unbound); (4) washed glutathione-agarose beads showing bound protein; (5) thrombin-cleaved supernatant; (6) washed glutathione-agarose after thrombin cleavage. Molecular weight standards are shown to the left of lane 1.

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID Diagnostic Potential of Recombinant Antigens of Mycobacterium Tuberculosis

N-terminal GST tag. Recombinant plasmids were transformed to E. coli (DH5α). Positive clones were evaluated to find the correct insertion.

Expression and purification of ESAT-6, CFP-10, and ESAT6/CFP-10 fusion proteins Expression and purification of the recombinant proteins were performed under standard protocols (5, 7). E. coli BL21 (DE3) transformed by pGEX4T1 (+) was grown in LB medium containing 100 µg/mL ampicillin. Expression was induced at mid-log phase by addition of IPTG. Cell pellets were lysed in lysis buffer containing 1 % Triton X-100, 1 mM EDTA (pH 8.0), and 1 µg/mL each of the protease inhibitors aprotinin, leupeptin, and pepstain A, in PBS. The cell lysates were sonicated, and the suspension was centrifuged (5). The lysate was then applied to glutathione-agarose beads. The lysate-bead mixture was incubated with reduced glutathione reagent to elute GST-tagged proteins. After dialysis, the purity of the recombinant proteins was analyzed by SDS-PAGE and western blotting. in order to achieve pure recombinamt protein, the GST tags were removed by thrombin cleavage in some samples.

SDS-PAGE analysis and western blotting SDS-PAGE of the purified recombinant protein products was performed in the presence of 0.1 % SDS in the gel. Protein samples (with or without the GST tag) were prepared by addition of reducing sample buffer (13) and boiling in a sand bath for 5 min. Gels were run at a constant volt-

kDa

1

2

561

age (200 V). Recombinant proteins were transferred to nitrocellulose membranes (Millipore, Biomanufacturing and Life Science Research) using a Mini Trans-blot Cell (Bio-Rad). The membranes were incubated with an appropriate dilution of primary anti-ESAT-6, anti-CFP-10, or anti-GST antibodies, and were then incubated with horseradish peroxidase-conjugated secondary antibody solution. Detection of specific proteins was facilitated using enhanced chemiluminescence (ECL) solution (5).

Circular dichroism spectroscopy Far-UV circular dichroism (CD) spectra were used to determine the secondary structure of the recombinant proteins in an Aviv circular dichroism spectropolarimeter model 215. Protein samples were dissolved in a buffer containing 50 mM Tris-HCl (pH 8.0), 180 mM NaCl, 1 mM dithiothreitol (DTT), and 10% v/v glycerol. CD spectra of the proteins were recorded from 190 to 260 nm, with each spectrum representing an average of 3 accumulations.

IFN-γ ELISPOT assay INF-γ ELISPOT assay for detection and quantification of IFN-γ-producing T cells against mycobacterial antigens was performed by using a commercially available antiIFN-γ antibody pair and black spot developing reagents (U-Cytech, the Netherlands) (11, 12). Briefly, peripheral blood mononuclear cells (PBMCs, 2 × 105 cells/well) were added to duplicate wells pre-coated with anti- IFN-γ antibodies. Following overnight stimulation with ESAT-6,

1

2

1

2

42 26 17 10

A

B

C

Figure 2. Western blots of the ESAT-6/CFP-10 fusion protein probed with anti-GST (A), anti-ESAT-6 (B), and anti-CFP-10 (C) mouse monoclonal antibodies. Lanes 1 and 2 represent the ESAT-6/CFP-10 protein with and without thrombin cleavage, respectively.

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID 562

Hemmati M et al.

CFP-10, ESAT-6/CFP-10, commercial ESAT-6, PPD, plain medium (as a negative control), or phytohemagglutinin (PHA, as a positive control), the wells were washed, and the presence of IFN-γ was detected by biotinylated antiIFN-γ and φ-labeled goat anti-biotin antibodies. Next, the addition of activators I and II caused precipitation of the silver on the φ-labeled antibodies, and revealed spots indicating IFN-γ-secreting cells. The spots were quantified with a stereomicroscope and photographed digitally. The number of spots in the background control wells was subtracted from the number in each test well. A response was considered positive if the number of spots per test well was greater than the cutoff point for each antigen and was at least twice the value found in the background control wells. The means of the duplicates were used, and all results were expressed as number of IFN-γ spot-forming cells (SFCs) per million PBMCs for comparison (14, 15).

Statistical analysis The statistical significance of differences between experimental and control groups was determined by a Mann-Whitney U test (SPSS version 16.0). Data were considered statistically significant at p < 0.05. For the evaluation of antigen responses, cutoff values were calculated for each antigen as the mean number of SFCs + 2 standard deviations (SDs) obtained with the PBMCs from 30 healthy BCG-vaccinated donors.

Results Cloning and construction of expression vectors pGEX4T1-ESAT-6, pGEX4T1-CFP-10, and pGEX4T1-ESAT-6/ CFP-10 In this study, we amplified the esat-6, cfp-10, and esat-6/ cfp-10 fusion genes from native M.tb C genomic DNA by

PCR. All PCR products (288 bp for esat-6, 303 bp for cfp-10, and 591 bp for esat6/cfp10) were cloned into the pGEX4T1 expression vector. DNA sequencing of the genes showed that all cloned genes were identical to genes reported in the gene bank (esat-6, Accession No. RV3875; cfp-10, Accession No. Rv3874). The esat-6 and cfp-10 genes were completely inserted in the fusion gene.

Analysis of the recombinant proteins by SDS-PAGE and immunoblotting The recombinant proteins were purified from cell-free supernatants by affinity chromatography on GST-agarose. The expressed products were subjected to SDS-PAGE analysis using Mini Format Vertical Electrophoresis (BioRad, USA). Gels were run in Tricine-Tris running buffer. The expression and purification results for the ESAT-6, CFP-10, and ESAT6/CFP10 proteins are shown in Figure 1. The theoretical molecular weights for ESAT-6, CFP-10, and ESAT-6/CFP-10 are approximately 10, 13, and 25 kDa, respectively, in an E. coli expression system. The resolved proteins were transferred to nitrocellulose membrane to determine expression by western blotting. The ESAT-6/ CFP-10 fusion protein could be recognized by mouse antiGST, anti-ESAT-6, and anti-CFP-10 monoclonal antibodies. The western blot results are shown in Figure 2. Structural characterization of recombinant proteins The structural states of the recombinant proteins were confirmed by CD spectroscopy. As shown in Figure 3, both ESAT-6 and ESAT-6/CFP-10 had high helical content, whereas CFP-10 appeared to have a largely unstructured, random coil structure.

Detection of TB in Iranian patients by ELISPOT assay Samples from healthy individuals were analyzed to calculate mean and standard deviation (SD), and subsequently, the cutoff point for positive samples set at mean + 2SDs (6). The distributions of responses to ESAT-6, CFP10, ESAT-6/CFP-10, PPD, and commercial ESAT-6 are shown in Figure 4. The results are the mean values determined by independent observers, given as spots per million PBMCs. The number of IFN-γ SFCs in response to ESAT-6, CFP-10, ESAT-6/CFP-10, and commercial ESAT-6 exposure was significantly higher in TB patients than in BCG-vaccinated healthy donors (Figure 4). All patients participating in this study had been previously vaccinated with the BCG vaccine; nevertheless, 25 % tested negative in the TST skin test. All patients subjected to IFN-γ ELISPOT analysis for ESAT-6, CFP-10, ESAT-6/CFP-10, and commercial ESAT-6 showed a positive reaction. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) for recombinant proteins and PPD in the ELISPOT assay are summarized in Table 2.

Discussion Figure 3. Far-UV circular dichroism spectra obtained from solution of CFP-10 (A), ESAT-6 (B), or ESAT-6/CFP-10 (C).

Delayed diagnosis and treatment of tuberculosis in-

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID Diagnostic Potential of Recombinant Antigens of Mycobacterium Tuberculosis

creases the risk of disease dissemination and decreases the survival rate in certain subgroups of patients (16-18). Thus new advancements in techniques facilitating rapid diagnosis are required in order to successfully control TB. The use of ESAT-6 and CFP-10, 2 specific antigens encoded in the RD1 locus of the bacterial genome, can distinguish M.tb from other mycobacteria and has resulted in increased specificity and sensitivity of the IFN-γ ELISPOT assay (15). The current study is the first report to evalu-

563

ate an ex vivo INF-γ_based assay (TSPOTTB) using recombinant antigens of native M.tb C for the diagnosis of TB in Iranian adults. The antigens chosen for the present study have been found to be strong targets for human B-cell and T-cell responses (19). Overlapping ESAT-6 and CFP-10 peptides was found to offer increased specificity over the PPD skin test when they were used in an ELISPOT assay for the diagnosis of M.tb (20, 21). Arend et al. have shown that ESAT-6 and CFP-10, in combination with T cell

Figure 4. Frequency of IFN-γ SFCs per million PBMCs responding to recombinant proteins in different individual groups. The dotted horizontal line indicates the cutoff value for a positive response for ESAT-6/CFP-10 (A), ESAT-6 (B), CFP-0 (C), commercial ESAT-6 (D), and PPD (E).

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID 564

Hemmati M et al.

assays, can provide the level of specificity and sensitivity necessary to detect exposure to TB (22). According to our results from the ELISPOT assay, use of these recombinant proteins could allow for discrimination of TB patients from healthy BCG-vaccinated individuals with p < 0.001. According to the values we obtained for sensitivity, specificity, PPV, and NPV for all of our recombinantly produced proteins, commercial ESAT-6, and PPD, and considering that 25 % of TB patients tested negative by TST, we think that the use of ESAT-6 and ESAT-6/CFP-10 proteins could provide a means for diagnosing TB with high confidence and accuracy. Our results indicated that higher sensitivity and specificity were achieved using the ESAT-6/CFP-10 fusion protein, while poor sensitivity was apparent when using PPD, in the diagnosis of TB, which is in accordance with previous findings (6, 8, 20, 22). Furthermore, these recombinant proteins offer a realistic and cost-effective alternative to PPD, and their commercial availability in purified form would facilitate this application. In conclusion, we present the cloning, expression, and purification of large amounts of the recombinant secretory antigens ESAT-6, CFP-10, and ESAT-6/CFP-10. These proteins were purified easily by affinity chromatography, and their expression was confirmed by western blotting and CD methods. Because of higher sensitivity and specificity, the recombinant antigens ESAT-6, CFP-10, and ESAT-6/CFP-10 may represent better candidates for the detection of TB than conventional diagnostic methods such as the PPD skin test. There was a high similarity in the sensitivity of the ELISPOT test when commercial ESAT-6 (a worldwide standard means of TB detection) was used and when the recombinant proteins produced in our lab were used, these recombinant antigens can be a reliable diagnostic tool for the detection of TB.

Financial support None declared.

Conflict of interest None declared.

Acknowledgements This study was conducted as a part of PhD student thesis and was supported by grant 87-4289 from the office of the Vice Chancellor for Research and the Committee for Advanced Biomedical Sciences, Shiraz University of Medical Sciences. We would like to specially thank Dr. N. Sattarahmady for her help with CD spectroscopy data analysis.

References 1.

Andersen P, Munk ME, Pollock JM, Doherty TM. Specific immunebased diagnosis of tuberculosis. Lancet. 2000;356(9235):1099104.

2. Gao LY, Guo S, McLaughlin B, Morisaki H, Engel JN, Brown EJ. A mycobacterial virulence gene cluster extending RD1 is required for cytolysis, bacterial spreading and ESAT-6 secretion. Mol Microbiol. 2004;53(6):1677-93. 3. WHO. WHO report Global tuberculosis control - Surveillance, Planning and Financing. WHO Press. 2008:22-3. 4. WHO. WHO report Global tuberculosis control- Epidemiology, Strategy and Financing. WHO Press. 2009:10-6. 5. Ganguly N, Giang PH, Gupta C, Basu SK, Siddiqui I, Salunke DM, et al. Mycobacterium tuberculosis secretory proteins CFP-10, ESAT-6 and the CFP10:ESAT6 complex inhibit lipopolysaccharideinduced NF-kappaB transactivation by downregulation of reactive oxidative species (ROS) production. Immunol Cell Biol. 2008;86(1):98-106. 6. mKulshrestha A, Gupta A, Verma N, Sharma SK, Tyagi AK, Chaudhary VK. Expression and purification of recombinant antigens of Mycobacterium tuberculosis for application in serodiagnosis. Protein Expr Purif. 2005;44(1):75-85. 7. Bai Y, Xue Y, Gao H, Wang L, Ding T, Bai W, et al. Expression and purification of Mycobacterium tuberculosis ESAT-6 and MPT64 fusion protein and its immunoprophylactic potential in mouse model. Protein Expr Purif. 2008;59(2):189-96. 8. Renshaw PS, Lightbody KL, Veverka V, Muskett FW, Kelly G, Frenkiel TA, et al. Structure and function of the complex formed by the tuberculosis virulence factors CFP-10 and ESAT-6. EMBO J. 2005;24(14):2491-8. 9. Guinn KM, Hickey MJ, Mathur SK, Zakel KL, Grotzke JE, Lewinsohn DM, et al. Individual RD1-region genes are required for export of ESAT-6/CFP-10 and for virulence of Mycobacterium tuberculosis. Mol Microbiol. 2004;51(2):359-70. 10. Marei A, Ghaemmaghami A, Renshaw P, Wiselka M, Barer M, Carr M, et al. Superior T cell activation by ESAT-6 as compared with the ESAT-6-CFP-10 complex. Int Immunol. 2005;17(11):1439-46. 11. Wang JY, Chou CH, Lee LN, Hsu HL, Jan IS, Hsueh PR, et al. Diagnosis of tuberculosis by an enzyme-linked immunospot assay for interferon-gamma. Emerg Infect Dis. 2007;13(4):553-8. 12. Mukherjee P, Dutta M, Datta P, Dasgupta A, Pradhan R, Pradhan M, et al. The RD1-encoded antigen Rv3872 of Mycobacterium tuberculosis as a potential candidate for serodiagnosis of tuberculosis. Clin Microbiol Infect. 2007;13(2):146-52. 13. Schagger H. Tricine-SDS-PAGE. Nat Protoc. 2006;1(1):16-22. 14. Ferrand RA, Bothamley GH, Whelan A, Dockrell HM. Interferongamma responses to ESAT-6 in tuberculosis patients early into and after anti-tuberculosis treatment. Int J Tuberc Lung Dis. 2005;9(9):1034-9. 15. Lalvani A, Pathan AA, McShane H, Wilkinson RJ, Latif M, Conlon CP, et al. Rapid detection of Mycobacterium tuberculosis infection by enumeration of antigen-specific T cells. Am J Respir Crit Care Med. 2001;163(4):824-8. 16. Alwood K, Keruly J, Moore-Rice K, Stanton DL, Chaulk CP, Chaisson RE. Effectiveness of supervised, intermittent therapy for tuberculosis in HIV-infected patients. AIDS. 1994;8(8):1103-8. 17. Pablos-Méndez A, Sterling TR, Frieden TR. The relationship between delayed or incomplete treatment and all-cause mortality in patients with tuberculosis. JAMA: J Am med Assoc. 1996;276(15):1223. 18. Wang JY, Hsueh PR, Lee LN, Liaw YS, Shau WY, Yang PC, et al. Mycobacterium tuberculosis inducing disseminated intravascular coagulation. Thromb Haemost. 2005;93(4):729-34. 19. Brodin P, Rosenkrands I, Andersen P, Cole ST, Brosch R. ESAT-6 proteins: protective antigens and virulence factors? Trends Microbiol. 2004;12(11):500-8. 20. Hill PC, Jackson-Sillah D, Fox A, Franken KL, Lugos MD, Jeffries DJ, et al. ESAT-6/CFP-10 fusion protein and peptides for optimal diagnosis of mycobacterium tuberculosis infection by ex vivo enzyme-linked immunospot assay in the Gambia. J Clin Microbiol. 2005;43(5):2070-4. 21. Van-Lume DS, De Souza JR, Cabral MM, Rego JC, Balbino V, Saad MH, et al. Immunological diagnosis of tuberculosis based on recombinant antigens ESAT-6 and CFP-10 in children from an endemic area in northeast Brazil. Scand J Immunol. 2010;72(5):460-8. 22. Arend SM, Andersen P, van Meijgaarden KE, Skjot RL, Subronto YW,

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Archive of SID Diagnostic Potential of Recombinant Antigens of Mycobacterium Tuberculosis

van Dissel JT, et al. Detection of active tuberculosis infection by T cell responses to early-secreted antigenic target 6-kDa protein and culture filtrate protein 10. J Infect Dis. 2000;181(5):1850-4. 23. Sherkat R, Mostafavizadeh K, Zeydabadi L, Shoaei P, Rostami S.Antineutrophil cytoplasmic antibodies in patients with pulmonary tuberculosis. Iran J Immunol. 2011;8(1):52-7 24. Kochak HE, SeyedAlinaghi S, Zarghom O, Hekmat S, Jam S, Sabzvari D, Abdi Z. Evaluation of serological tests using A60 antigen for diagnosis of tuberculosis. Acta Med Iran. 2010;48(1):21-6 25. Sagheb MM, Goodarzi M, Roozbeh J.The booster phenomenon of tuberculin skin testing in patients receiving hemodialysis. Iran J Immunol. 2008;5(4):212-6. 26. Rafiei A, Kiutade Y.Identification of Mycobacterium tuberculosis CTL epitopes restricted by HLA-A*0201 in HHD mice.Iran Biomed J. 2007;11(1):23-31 27. Arjomandzadegan M, Owlia P, Ranjbar R, Farazi AA, Sofian M, Sadrnia M, Surkova LK, Titov LP. Rapid and simple approach for identification of Mycobacterium tuberculosis and M. bovis by detection of regulatory gene whiB7. Acta Microbiol Immunol Hung. 2011;58(1):65-74. 28. Aryan E, Makvandi M, Farajzadeh A, Huygen K, Bifani P, Mousavi SL, Fateh A, Jelodar A, Gouya MM, Romano M . A novel and more sensitive loop-mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex.Microbiol Res. 2010;165(3):211-20. Epub 2009 Jun 10. 29. Kariminia A, Sharifnia Z, Aghakhani A, Banifazl M, Eslamifar A, Hazrati M, Ramezani A. Comparison of QuantiFERON TB-G-test to TST for detecting latent tuberculosis infection in a high-in-

565

cidence area containing BCG-vaccinated population. J Eval Clin Pract. 2009;15(1):148-51 30. Masjedi MR, Asl RT, Fadaizadeh L. Role of private laboratories in tuberculosis detection in Tehran, Islamic Republic of Iran. East Mediterr Health J. 2008;14(5):1110-8 31. Masjedi MR, Fadaizadeh L, Taghizadeh Asl R.Notification of patients with tuberculosis detected in the private sector, Tehran, Iran. Int J Tuberc Lung Dis. 2007;11(8):882-6. 32. Mohammadzadeh A, Farnia P, Ghazvini K, Behdani M, Rashed T, Ghanaat J.Rapid and low-cost colorimetric method using 2,3,5-triphenyltetrazolium chloride for detection of multidrug-resistant Mycobacterium tuberculosis. J Med Microbiol. 2006;55(Pt 12):1657-9. 33. Gill P, Ramezani R, Amiri MV, Ghaemi A, Hashempour T, Eshraghi N, Ghalami M, Tehrani HA.Enzyme-linked immunosorbent assay of nucleic acid sequence-based amplification for molecular detection of M. tuberculosis. Biochem Biophys Res Commun. 2006;347(4):1151-7. Epub 2006 Jul 17. 34. Khazaei HA, Rezaei N, Bagheri GR, Dankoub MA, Shahryari K, Tahai A, Mahmoudi M. Epidemiology of tuberculosis in the Southeastern Iran. Eur J Epidemiol. 2005;20(10):879-83. 35. Farnia P, Mohammadi F, Mirsaedi M, Zia Zarifi A, Tabatabee J, Bahadori M, Akbar Velayati A, Reza Masjedi M. Bacteriological follow-up of pulmonary tuberculosis treatment: a study with a simple colorimetric assay. Microbes Infect. 2004;6(11):972-6 36. Velayati AA, Bakayev VV, Bahrmand AR. Use of PCR and culture for detection of Mycobacterium tuberculosis in specimens from patients with normal and slow responses to chemotherapy. Scand J Infect Dis. 2002;34(3):163-6

Iran Red Crescent Med J. 2011; 13(8):558-65

www.SID.ir

Suggest Documents