Expression of Carbonic Anhydrase Isozyme III in the Ciliary Processes ...

Reports 4. Niederkorn JY, Streilein JW. Induction of anterior chamber associated-immune deviation (ACAID) by allogeneic intraocular tumor cells does not require splenic metastases./Immunol. 1982; 128:2470-2474. 5. Streilein JW, Niederkorn JY. Induction of anterior chamber associated-immune deviation requires an intact, functional spleen. J Exp Med. 1981;153:10581067. 6. Waldrep JC, Kaplan HJ. Anterior chamber associatedimmune deviation induced by TNP-splenocytes (TNPACAID). I. Systemic tolerance mediated by suppressor T-cells. Invest Ophthalmol Vis Sci. 1983; 24:1086-1092. 7. Waldrep JC, Kaplan HJ. Anterior chamber associatedimmune deviation induced by TNP-splenocytes (TNPACAID). II. Suppressor T-cell network. Invest Ophthalmol Vis Sci. 1983; 24:1339-1345.

Expression of Carbonic Anhydrase Isozyme III in the Ciliary Processes and Lens Henry D. Jampel, Xiaoming Chen, Calvin Chue, and Donald J. Zack Purpose. To determine whether carbonic anhydrase isozyme (CA) III is expressed in the ciliary processes and lens. Methods. Total RNA was isolated from rabbit ciliary epithelium and human ciliary processes and from the anterior lens of rabbit, cow, and human eyes. First-strand cDNA was synthesized, and the polymerase chain reaction (PCR) was performed using oligomer primers designed to amplify CA III sequences specifically. Selected PCR products were eluted from agarose gels, cloned, and sequenced. Northern blots were performed to confirm the presence of CA III in these tissues. Results. Polymerase chain reaction products of the predicted size were generated from rabbit ciliary epithelium and from rabbit, bovine, and human lens. The sequence of the PCR product from human lens was identical to the published sequence of the corresponding region of the human CA III gene. The sequence of the PCR products from,rabbit ciliary epithelium and bovine lens showed 88% and 97% identity, respectively,

From the Departments of Ophthalmology, Molecular Biology and Genetics, and Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Maryland. Supported by grants from the National Eye Institute (EY09769), the American Health Assistance Foundation, and the Glaucoma Foundation; by unrestricted funds from Research to Prevent Blindness; and by the Rebecca P. Moon, Charles M. Moon, Jr., and Dr. P. Thomas Manchester Research Fund. Submitted for publication February 22, 1996; revised August 2, 1996; accepted October 4, 1996. Profmetary interest category: N. Reprint requests: Henry D. Jampel, Glaucoma Service, Johns Hopkins University School of Medicine, Maumenee B-110, 600 N. Wolfe Street, Baltimore, MD 212879205.

539

8. Wilbanks GA, Streilein JW. Characterization of suppressor cells in anterior chamber associated-immune deviation (ACAID) induced by soluble antigen: Evidence of two functionally and phenotypically distinct T-suppressor cell populations. Immunology. 1990; 71:383-389. 9. Wilbank GA, Mammolenti M, Streilein JW. Studies on induction of anterior chamber associated-immune deviation (ACAID) II: Eye-derived cells participate in generating blood-borne signals that induce ACAID. / Immunol. 1991; 146:3018-3024. 10. Ferguson TA, Herndon JM. The immune response and the eye: The ACAID inducing signal is dependent on the nature of antigen. Invest Ophthalmol Vis Sci. 1994; 35:3085-3093.

with the corresponding sequences for human CA III, suggesting that the PCR products corresponded to the rabbit and bovine orthologs. Northern blots confirmed the presence of CA III mRNA in the rabbit ciliary epithelium and in rabbit and bovine lens. Conclusions. mRNA for CA III is present in the intraocular tissues of rabbits, cows, and humans. The previous detection of CA III protein in the bovine lens is confirmed, and it extended to the lenses of other species, including humans. The detection of mRNA for CA III in the ciliary epithelium is new and suggests that the ciliary epithelium contains not only isozymes II and IV but isoenzyme III as well. Aldiough the function of CA III in the eye is unknown, it may play a role in fluid transport and homeostasis. Invest Ophthalmol Vis Sci. 1997; 38:539-543. x^arbonic anhydrase (CA) is a ubiquitous enzyme that catalyzes the reversible hydration of carbon dioxide and is considered to play an important role in aqueous humor production. Inhibition of carbonic anhydrase activity by agents such as acetazolamide and methazolamide leads to a reduction of aqueous humor secretion by the ciliary processes. For 40 years, carbonic anhydrase inhibitors have been used orally to treat the elevation of intraocular pressure associated with glaucoma. Topical carbonic anhydrase inhibitors recently have become available for clinical use. Seven isozymes of carbonic anhydrase have been identified. CA I, CA II, and CA III are located in the cytosol, CA IV is membrane bound, CA V is present in mitochondria, and CA VI and CA VII are present only in salivary glands. Results of previous histochemical studies have suggested that isozymes I and II are the only isozymes present in the eye and that CA II is the only enzyme present in the ciliary epithelium.1

540

TABLE l. Isozyme I II III

Investigative Ophthalmology 8c Visual Science, February 1997, Vol. 38, No. 2

Oligonucleotide Primers for Polymerase Chain Reaction Primer 5' 3' 5' 3' 5' 3'

Corresponding to Base Pairs

Primer Sequence

5'-AAGGTTGGTCAGGCCAACCC-3' 5'-TCACA(G/T)TTCTGCCCTTCAGA-3' 5'-CAGTTTCACTTTCACTGGGG-3' 5'-GGGTTCCTTTCTCACAATCC-3' 5'-CGCTGTG(A/G)TTGGCATTTTTC-3' 5'-AGGCT (G/C) CGCAGCTTGGCCAT-3'

There is recent evidence, however, that isozymes other than CA I and CA II are expressed within the eye. CA IV has been detected immunohistochemically in human ocular tissue, including the endothelial cells of the choriocapillaris and epithelial and fiber cells of the lens. 2 Positive histochemical staining for carbonic anhydrase along the membranes of the ciliary epithelium in mice deficient in isozyme II further implies the presence of CA IV in the ciliary epithelium. 3 CA III, which differs from CAs I and II in its low enzymatic activity and its resistance to inhibition by acetazolamide, generally has been thought to be present only in skeletal muscle in higher mammals. 4 Recently, however, it has been detected in the epithelium of various secretory tissues, including the human choroid plexus. 5 There is one report of the presence of CA III in bovine lens. 6 Given the importance of carbonic anhydrase in ocular physiology and pharmacology and of data suggesting the presence of several CA isozymes within the eye, we undertook a study to determine the tissue expression of CA III using reverse transcription polymerase chain reaction (RT-PCR) and Northern blot analysis. We report, for the first time, the presence of CA III in the rabbit ciliary epithelium, and we demonstrate that CA III is present in the rabbit and human lens as well as in the bovine lens. METHODS. Tissue Isolation. Rabbit eyes were obtained in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and with the approval of the Johns Hopkins University Animal Care and Use Committee. Five 2- to 3-kg New Zealand white rabbits were anesthetized deeply by the intramuscular injection of a mixture of 25 mg/kg ketamine hydrochloride and 5 mg/kg xylazine. Their eyes were enucleated, and the rabbits were killed with intravenous injections of sodium pentobarbital. In one animal, a portion of soleus muscle was removed for total RNA isolation. The eyes were bisected anterior to the equator, and the ciliary epithelium was isolated by the technique of Jumblatt et al.7 Purity of the preparation

444-463 769-750 274-293 645-626 423-442 686-667

Species

Predicted Size (bp)

Rabbit

325

Human

372

Human

264

was confirmed by electron microscopy. The anterior lens capsule was excised using a fine scissors and forceps. Retina was separated from the underlying tissues. Dissected tissues were placed immediately in Tri Reagent (Molecular Research Center, Cincinatti, OH) and kept at 4°C until homogenization. Bovine eyes were obtained from a local slaughterhouse within 1 hour of death and dissected at 4°C. After bisecting the eyes anterior to the equator and blotting away vitreous on a sterile gauze pad, a fine scissors was used to sever the zonules and free the lens. Ciliary processes were removed with a forceps and scissors; the anterior lens capsule was excised. Tissue samples from several eyes were placed in Tri Reagent and were processed for RNA preparation as described below. Bovine skeletal muscle total RNA was a gift from Neil Delia (Johns Hopkins University School of Medicine, Baltimore, MD). Human anterior lens capsule was obtained after capsulorhexis in eyes undergoing cataract surgery. Twelve specimens were collected into a microcentrifuge tube on dry ice over the course of 6 hours. The tenets of the Declaration of Helsinki were followed. The protocol was exempt (exemption #4, DHHS regulation 45CRF46) from review by the institutional experimentation committee. Isolation of Total RNA and Preparation of FirstStrand cDNA. Tissues were disrupted by homogenization and sonication. Total RNA was isolated using Tri Reagent, according to the manufacturer's protocol. cDNA was prepared from 1 to 3 fig of total RNA by adding 100 ng (one /A) of oligo dT14 (Genelink, Thornwood, NY) to the RNA and incubating it at 70°C for 2 minutes. The sample was quick chilled on ice, and buffer was added to make a 20 //I reaction mix containing 50 mM Tris HC1, pH 8.3, 75 mM KC1, 3 mM MgC12, 0.5 mM dNTP, and 0.01 M dithiothreitol. After 10 minutes at room temperature, 1 fi\ (200 U) of Moloney-Murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) was added, and the samples were incubated at 37°C for 50 minutes, heated at 90°C for 5 minutes, and treated with 1 yX (2 U) of RNase H (Boehringer Mannheim, Indianapolis, IN) for 20 minutes at 4°C.

Reports

541 1 2

3

4

5 1

1 2

3

4

2

3

4

5

6

5

eoobp—^H 600 Dp —

R

600 bp —

C

FIGURE l. Gel analysis of polymerase chain reaction products amplified using oligonucleorides designed for CA I (A), CA II (B), and CA III (C). Sources of cDNA template: lane 1 = rabbit ciliary epithelium; lane 2 = rabbit lens; lane 3 = rabbit retina; lane 4 = rabbit blood; lane 5 = rabbit soleus muscle; lane 6 (present only in C) = bovine lens. The left lane contains a 100 bp ladder.

Selection of Oligonucleotide Primers for Carbonic Anhydrase Isozymes and Polymerase Chain Reaction. Because we were attempting to amplify regions from related molecules selectively, we selected oligonucleotide primers complementary to sequences that were as dissimilar as possible from the different carbonic anhydrase isozymes. Furthermore, because the DNA sequences for several rabbit and cow CA isozymes were unknown, the oligonucleotide primers for each isoenzyme were selected to be as similar as possible between known species. To increase the likelihood that the primers would anneal to sequences that might not be identical between different species, positions in some primers were made degenerate. Table 1 lists the oligonucleotide primers used. The 3' primer used to amplify isozyme II was not a perfect complement to the human sequence. The complement is 5'-GGGTTCCTTGAGCACAATCC-3'. Polymerase Chain Reaction. Polymerase chain reaction was carried out in a 20 //I reaction volume consisting of 10 mM Tris HC1, pH 8.3, 0.5 fM of each oligonucleotide, 50 mM KC1, 1.5 mM MgC12, 1 £*1 CDNA template (made from approximately 0.2 //g RNA), 62.5 fiM dNTP, 1 U of Taq polymerase (Boehringer Mannheim), and 2 /^g gelatin. Reactions were performed using a Perkin Elmer (Norwalk, CT) Gene Amp 9600 PCR system. After heating to 94°C for 5 minutes, 30 cycles were performed at 56°C for 30 seconds, 72°C for 30 seconds, and 94°C for 1 minute. For the human lens cDNA, an annealing temperature of 63°C instead of 56°C was used. Characterization of Polymerase Chain Reaction

Products, Subcloning, and Sequencing. An aliquot of each PCR reaction was run on an analytical 1% agarose gel. For subcloning, an additional aliquot was then run on a 2% NuSieve GTG (FMC BioProducts, Rockland, ME) agarose gel. The band was cut from the gel, and the DNA was extracted using the hot phenol method. The resultant purified PCR products were ligated into the pCRTMII vector (Invitrogen, San Diego, CA) according to the manufacturer's protocol and were used for bacterial transformation. Aliquots from the transformation mix were inoculated onto LB agar plates containing 50 fig/ ml ampicillin and 40 £tg/ml 5-bromo, 4-chloro, 3indolyl, /?D-galactopyranoside, and colonies were chosen by blue-white selection. Minipreps of plasmid DNA were prepared using the Qiagen (Chatsworth, CA) system. Double-stranded DNA was prepared for sequencing using the alkaline-denaturation method and were sequenced using Sequenase Version 2.0 (United States Biochemical, Cleveland, OH) according to the manufacturer's protocol. Sequence comparison against the Genbank database were performed using the BLAST algorithm (National Center for Biotechnology Information). Individual sequence alignments and comparison were performed using Geneworks version 2.3 (IntelliGenetics, Mountain View, CA). Northern Blot Analysis. RNA samples (10 //g) were fractionated by electrophoresis on a 1% agarose gel containing formaldehyde and were transferred by capillary action onto a GeneScreen hybridization membrane (NEN Research Products, Boston, MA). Gel-purified PCR fragments for rabbit,

Investigative Ophthalmology & Visual Science, February 1997, Vol. 38, No. 2

542 Rabbit Ciliary Epithelium PCR Bovine Lens PCR Human Lens PCR Human CA III

R a b b i t C i l i a r y E p i t h e l i u m PCR Bovine Lens PCR Human Lens PCR Human CA I I I

Rabbit Ciliary Epithelium PCR Bovine Lens PCR Human Lens PCR Human CA III

AAGATAGG/

90 90 90 90

TCCAGRTTTTCCTTGATGCA TGUACAA ATTAAGACAAAGGUCAAGUAOUCGCCCTTC C I'TCGKGATTTTCCTFGATGCA TGGACAA ATTAAQACAAAGGGCAAGGAGQCGCCCTTC C ••TCCAGATTTTCCTTGATGCA TGGACAA ATTAAGACAAAG