Open Access Asian-Australas J Anim Sci Vol. 00, No. 00:1-11 Month 2018 https://doi.org/10.5713/ajas.17.0115 pISSN 1011-2367 eISSN 1976-5517
Expression of fox-related genes in the skin follicles of Inner Mongolia cashmere goat Wenjing Han1, Xiaoyan Li1, Lele Wang1, Honghao Wang1, Kun Yang1, Zhixin Wang1, Ruijun Wang1,2, Rui Su1, Zhihong Liu1, Yanhong Zhao1, Yanjun Zhang1,3,* and Jinquan Li1,4,*
*C orresponding Authors: Yanjun Zhang Tel: +86-13190601108, Fax: +86-4309178, E-mail:
[email protected] Jinquan Li Tel: +86-13947131345, Fax: +86-4309170, E-mail:
[email protected] College of Animal Science, Inner Mongolia Agricultural University, Hohhot, Inner Mongolia Autonomous Region 010018, China 2 Key Laboratory of Animal Genetics, Breeding and Reproduction in Inner Mongolia Autonomous Region, Hohhot, Inner Mongolia Autonomous Region 010018, China 3 Engineering Research Center for Goat Genetics and Breeding, Inner Mongolia Autonomous Region, Hohhot, Inner Mongolia Autonomous Region 010018, China 4 Key Laboratory of Mutton Sheep Genetics and Breeding, Ministry of Agriculture, Hohhot, Inner Mongolia Autonomous Region 010018, China 1
ORCID Yanjun Zhang http://orcid.org/0000-0001-5349-4233 Jinquan Li http://orcid.org/0000-0001-9159-5916
Keywords: Cashmere Goat; Real-time Quantitative Polymerase Chain Reaction Detecting System; Western Blot; FoxN1; FoxE1; FoxI3
INTRODUCTION
Submitted Feb 20, 2017; Revised Apr 10, 2017; Accepted Jun 5, 2017
www.ajas.info
Objective: This study investigated the expression of genes in cashmere goats at different periods of their fetal development. Methods: Bioinformatics analysis was used to evaluate data obtained by transcriptome sequen cing of fetus skin samples collected from Inner Mongolia cashmere goats on days 45, 55, and 65 of fetal age. Results: We found that FoxN1, FoxE1, and FoxI3 genes of the Fox gene family were probably involved in the growth and development of the follicle and the formation of hair, which is con sistent with previous findings. Real-time quantitative polymerase chain reaction detecting system and Western blot analysis were employed to study the relative differentially expressed genes FoxN1, FoxE1, and FoxI3 in the body skin of cashmere goat fetuses and adult individuals. Conclusion: This study provided new fundamental information for further investigation of the genes related to follicle development and exploration of their roles in hair follicle initiation, growth, and development.
The sheep-raising industry has a long history in China, which is undoubtedly a country with developed sheep-raising regardless of quantity or types utilized. Inner Mongolia is one of the most important livestock breeding regions in China. This regions are also famous for its Cashmere goat, which is an indispensable part of the Inner Mongolia's animal husbandry. The precious animal fiber cashmere, produced in Inner Mongolia by Cashmere Goats, is rare and recognized for its outstanding quality in the whole world. The cashmere product obtained is slender, white-textured, and lustrous, which makes it a high-end textile material. Moreover, the textile products in which cashmere has been used as a raw material are not only light but also warm and smooth, which makes it popular and highly valued around the world. As a subsidiary structure of the skin, the hair follicle controls the growth of villi. Therefore, it has a direct impact on the yield and quality of cashmere. The different parts of the hair follicle are vary considerably in shape, but their basic structure is the same [1]. The follicle that governs the growth of the shag is called primary follicle. The growth of hair follicles is initiated by a signal from the dermal cells inducing the formation of hair buds from the epidermis. Then, hair buds release some factors that induce dermal fibroblasts to form dermal papillae, which then release a second signal to stimulate the proliferation and differentiation epithelial cells to form a complete hair follicle structure [2,3]. Transcription factors regulate gene expression and participate in the regulation of cell proliferation and differentiation. Forkhead box (Fox) family of proteins is a class of DNA-binding domain transcription factors
Copyright © 2018 by Asian-Australasian Journal of Animal Sciences This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
1
Han et al (2018) Asian-Australas J Anim Sci 00:1-11
with alary helix, first discovered in Drosophila. This protein family mediates a variety of important biological processes, such as DNA repair and embryonic development, and regulates the metabolic balance. So far, more than 20 Fox genes have been found in hu mans [4]. FoxN1 is a member of forkhead box protein family. It is mainly expressed in the thymic epithelial cells and skin kerati nocytes, and plays an important role in different processes, such as the growth of thymus, T-cell proliferation, hair growth, and development of nails. There is evidence that the absence of FoxN1 in mouse leads to the development of nude mice, i.e. no thymus was formed, and they were hairless, with skin defects [5,6] . In the skin, FoxN1 is mainly expressed in the follicular epithelium and hair follicles [7]. The mutations of the FoxE1 gene can lead to thyroid abnormalities, cleft palate, and inner nostril atresia, with thinning hair and a phenotype with two epiglottis [8]. The lack of FoxI3 prevents the downward growth of the hair follicles and obstructs the hair cycle [9]. The purpose of this examination was to determine the relative expression level of the differential genes FoxN1, FoxE1, and FoxI3 in the skin of cashmere goat fetuses and adult animals to provide new information for further inves tigation of the genes related to follicle development. In addition, we aimed to explore the roles of these genes in the initiation of hair follicle formation and their further growth and development at different periods of fetal development in cashmere goats.
MATERIAL AND METHODS Material Fetal samples from the body side skin of cashmere goat embryos were collected at the Aerbasi White Cashmere Goat Breeding Farm (Inner Mongolia, China) at 10 time points of fetal age (45, 55, 65, 75, 85, 95, 105, 115, 125, and 135 days). Samples were collected from 3 fetuses for each of these time points. For the collection of adulthood samples, three adult sheep were selected from the Inner Mongolia Cashmere Goat Breeding Farm, and skin samples were collected from the lateral body. Samples were collected every month on the same day, and samples were collected continuously for 12 months; Each time approximately 1 cm2 of the skin collecting. All above-mentioned samples were cleaned with diethylpyrocarbonate water, numbered, quickly transferred into liquid nitrogen for freezing, and stored in a refrigerator at –80°C for future use. In this experiment, the breeding environ ment was in compliance with the standards relevant to an ordinary animal laboratory facility in China National Standard “Labora tory animal environment and facilities” (GB14925-2010). The feeding of and the experimental operations on animals were in accordance with the animal welfare requirements. The total RNA and proteins were extracted from each skin sample for later use. Methods Tissue section of skin follicle of Inner Mongolia cashmere goats: The skin samples were washed with 1×phosphate buffer saline, www.ajas.info 2
dehydrated under different concentrations of alcohol and be transparent with Xylene, then put the skin into xylene: paraffin (1:1) overnight at 38°C. The paraffin was melted in 56°C about 4 to 5 h, then the skin samples were placed into melted paraffin wax. After wax solidification, it was cut into a trapezoid with knife, welded to the wood, slicing into pieces with 8 μm by micro tome. The paraffin section was spread out and was placed on the glass slide. Then dry up in 37°C oven drying, the drying paraffin section were stained with HE and Sacpic methods and sealed with neutral resin. The photos were taken under a microscope [10]. Transcriptome analysis of differentially expressed genes in the skin of fetuses of cashmere goat at 45, 55, and 65 days of their fetal development: The transcriptome sequencing data of the skin from the studied fetuses of Inner Mongolia cashmere goat on days 45, 55, and 65 were used to screen the differentially expressed genes. They were analyzed online by conducting Venn analysis (http:// omics.pnl.gov/software/VennDiagramPlotter.php), and Gene Cluster and Tree View software were employed to perform the cluster analysis of differential genes. Detection of the gene expression of FoxN1, FoxE1, and FoxI3 in skin hair follicles of Inner Mongolia cashmere goats: Real-time quantitative polymerase chain reaction (qPCR) detecting system was used to quantify the expression levels of the genes FoxN1, FoxE1, and FoxI3 and mRNA in skin samples from cashmere goat collected at different fetal and adult stages. The expression status of the genes during hair follicle generation and develop ment cycle was determined based on mRNA expression levels. First, using Primer premier 5.0 Software Design fluorescence quantitative primers, the primers of the housekeeping gene β-actin were designed by the Animal Genetics Laboratory at Agricultural University of Inner Mongolia according to the gene sequences FoxN1, FoxE1, and FoxI3 registered in GeneBank. Then, the pri mers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences are listed in Table 1. The Primer Script TM RT reagent Kit (TaKaRa Code: RR047A) (TaKaRa, Kyoto, Japan) was used in the analyses. Different reverse transcription reagents were added depending on the concentra tion measured, and the total RNA was reversely transcribed. Realtime qPCR was performed using the real-time fluorescence Table 1. Primers for real-time quantitative polymerase chain reaction detecting system analysis of the expression levels of cashmere goat β-actin and FoxN1 , FoxE1 , and FoxI3 Gene name
GenBank number
β-actin
NM_0010097
FoxN1
XM_0056932
FoxE1
XM_0040052
FoxI3
XM_0056867
Sequence of primer F: GGCAGGTCATCACCATCGG R: CGTGTTGGCGTAGAGGTCTTT F: GGTCAGAAGTCAAGGTCAA R: CCGCTGGTATGGATAGTG F: AGCTCATGGCAAGCAACTCT R: ACCACATTTATGACCCAGCAG F: GAAAGCCAGATGGAGACAA R: TGCTACTACCGACGCTGA
Products size (bp) 158 176 120 171
Han et al (2018) Asian-Australas J Anim Sci 00:1-11
quantitative instrument Agilent (USA). The expression levels of FoxN1, FoxE1, and FoxI3 genes in samples of skin tissues col lected at different time points of the fetal and adulthood periods of cashmere goats. A volume of 20 μL of the reaction system con tained 10 μL of 2X SuperReal PreMix, 1 μL of diluted reverse transcription product, 2 μL of each specific primer (10 μmol/L), 0.4 μL of ROX (50x), and 6.6 μL of ddH2O. The PCR conditions were as follows: a predenaturation for 3 min at 95°C, followed by 40 cycles of 30 s denaturation at 94°C, 30 s at the optimum annealing temperature, 60 s of extension at 95°C, and 0.5 min final extension at 55°C. The threshold cycle (Ct value) was au tomatically calculated from PCR amplification plots in which fluorescence was plotted against the number of cycles; each sam ple was analyzed in three replicates. The 2–ΔΔCt method was applied to conduct a relative quanti tative analysis of the teal-time PCR data. The fetal skin samples collected on day 45 were used as calibration samples. The fol lowing formulas (1 to 3) were used for the calculations: ΔCt (calibration sample) = Ct (calibration sample target gene) – calibration sample β-actin
(1)
ΔΔCt = (Ct of the sample of the target gene – Ct of the housekeeping gene) – ΔCt
(2)
The relative level of gene expression = 2–ΔΔCt
(3)
All tests were repeated three times. The experimental data obtained were expressed as mean±standard deviation. Finally, the data were used to conduct variance analysis using SAS9.0 software with a level significance at p
