0021-972X/97/$03.00/0 Journal of Clinical Endocrinology and Metabolism Copyright © 1997 by The Endocrine Society
Vol. 82, No. 4 Printed in U.S.A.
Expression of Glucocorticoid Receptor Gene Isoforms in Corticotropin-Secreting Tumors* ¨ RGEN HONEGGER, MARTIN REINCKE, PATRICIA L. M. DAHIA, JU RICHARD A. JACOBS, ADRIANA MIRTELLA, RUDOLF FAHLBUSCH, G. MICHAEL BESSER, SHERN L. CHEW, AND ASHLEY B. GROSSMAN Department of Endocrinology (P.L.M.D., A.M., R.A.J., S.L.C., G.M.B., A.B.G.), St. Bartholomew’s Hospital, London EC1A 7BE, United Kingdom; Neurochirurgische Klinik der Universita¨t ErlangenNu¨rnberg (J.H., R.F.), 91054 Erlangen, Germany; and Klinikum der Bayerischen Julius-MaximiliansUniversita¨t Wu¨rzburg (M.R), D-97080 Wu¨rzburg, Germany ABSTRACT The molecular basis of Cushing’s disease is not known. One of the most characteristic features of such tumors is their resistance to corticosteroid feedback at the pituitary level. We have hypothesized that abnormalities of the glucocorticoid receptor (GR) gene might play a role in the development of Cushing’s disease via an increase in the relative production of the nonligand-binding splice variant of the GR, GRb, known to exert dominant negative effects over the ligand-binding isoform, GRa. Alternatively, a change in overall GR expression, or mutations of some functional domains of the GR gene, might be involved in the pathogenesis of corticotroph tumors. We studied 22 tumors (17 pituitary ACTH-secreting tumors, 2 ectopic ACTH-producing tumors, 2 prolactinomas, and 1 nonfunctioning adenoma) and three normal pituitaries. RT-PCR was performed with primers specific to GRa and GRb complementary DNA, followed by Southern blotting using an internal probe, and the ratio of the two bands quantitated by densitometry. We also assessed the overall expression of GR relative to the message of both the POMC gene and a housekeeping gene. Single-strand conformation polymor-
phism analysis of the DNA-binding domain and splice junction region of the gene was also performed. GRa messenger RNA was expressed at 37.3-fold 6 5.7 (range, 32 to 46) excess, as compared with the GRb subform. This pattern was observed both in the tumor samples and in the normal pituitaries used as controls. A majority of the ACTH-secreting tumors (16/19), including the ectopic secretors, showed variable but increased overall GR expression, whereas 3 tumors showed an expression approximately equivalent to the normal controls; however, no correlation was found between these two groups and the response to the high-dose dexamethasone test, nor was there any correlation with tumor histology. No mutations were found in any of the tumors by PCR-single-strand conformation polymorphism analysis. In conclusion, although both pituitary and ectopic ACTH-secreting tumors are at least partially glucocorticoid-resistant, no significant abnormalities in the relative expression of the two main GR subforms were observed in a series of such tumors. Additionally, mutations of regions critical to normal function of the receptor do not seem to be a frequent event in these tumors. (J Clin Endocrinol Metab 82: 1088 – 1093, 1997)
C
feature of their deranged biochemistry is a resetting of their steroidal feedback (6). Unlike pituitary tumors, ectopic ACTH secretors show, in general, a more pronounced degree of dexamethasone resistance, and this may indicate distinct mechanisms of glucocorticoid resistance in these two groups of tumors. Because dexamethasone, similar to cortisol, binds to the type II glucocorticoid receptor (GR), it is possible that a somatic mutation involving the GR gene may be a fundamental event in tumor pathogenesis. Indeed, mutations of the GR gene have been reported in cell lines derived from ectopic ACTH-secreting tumors (8, 9), and recently, one tumor from a patient with Nelson’s syndrome was shown to carry an insertion of the GR gene that would result in a truncated GR protein (10). The human GR is known to have two transcripts as a result of alternative splicing of the gene, giving rise to two highly homologous isoforms, GRa and GRb, which differ only at the carboxy-terminus (11, 12). In contrast to the well-characterized GRa isoform, transfected GRb does not bind glucocorticoids or antiglucocorticoids and seems to reside primarily in the nucleus (11, 13), although some studies also have demonstrated its presence in the cytoplasm (14). GRb heterodimerizes with ligand-bound GRa, either in the cytoplasm, with subsequent translocation into the nucleus, or in
USHING’S disease, pituitary-dependent Cushing’s syndrome, is usually secondary to a small pituitary adenoma secreting ACTH. Recent studies have established that most of such tumors are monoclonal in origin (1). However, abnormalities of putative oncogenes or tumor suppressor genes involved in their pathogenesis rarely have been found, or account for only a relatively small proportion of such tumors (2– 4). One of the most characteristic biochemical features of corticotroph tumors is their resistance to corticosteroid feedback, as demonstrated by a failure to suppress circulating cortisol or its urinary metabolites during a dexamethasone suppression test (5–7). Nevertheless, this resistance is only partial, and most patients will show considerable suppression when high doses are used, suggesting that the cardinal Received October 23, 1996. Revision received December 6, 1996. Accepted December 16, 1996. Address all correspondence and requests for reprints to: Prof. Ashley Grossman, Department of Endocrinology, St. Bartholomew’s Hospital, London EC1A 7BE, United Kingdom. E-mail: a.b.grossman@mds. qmw.ac.uk. * This work was supported by Grant 2025– 8/94 from Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (to P.L.M.D.); by the Joint Research Board of the St. Bartholomew’s Hospital (to R.A.J); and by the Wellcome Trust (to S.L.C.).
1088
GR TRANSCRIPTS IN ACTH-SECRETING TUMORS
the nucleus itself, to act as a dominant negative inhibitor of the classic receptor. In addition, GRb can repress the activity of GRa on glucocorticoid-responsive promoters (13, 15). It recently has been demonstrated that both GRb messenger RNA (mRNA) and protein are expressed at low levels in virtually all human tissues and may be found complexed with heat shock protein (hsp90) and other proteins (14 –16). The GRb isoform therefore seems to participate in determining the sensitivity of target tissues to glucocorticoids. We speculated that an increase in the relative production of the GRb splice variant might play a role in the development of Cushing’s disease, specifically in determining relative corticosteroid resistance, and have investigated this in a series of such tumors. Our technique also has allowed us to determine whether the reported mutation in Nelson’s syndrome is a common causative factor in Cushing’s disease, and finally, whether changes in overall GR expression are characteristic of these tumors. Materials and Methods Tumor specimens We studied tumors from 22 patients, of which 17 were pituitary ACTH-secreting tumors, 2 secreted ACTH ectopically (both were bronchial carcinoids), and 3 were non-ACTH-secreting pituitary tumors (2 prolactinomas and 1 nonfunctioning adenoma). Clinical details, including responses to low- and high-dose dexamethasone where applicable, are shown in Table 1. Detailed histological data were available for a number of tumors and revealed them to be a heterogeneous population, with regard to the presence of intermediary filaments, degree of pleomorphism, and mitotic activity. One of the tumors (no. 21 in Table 1) showed a high degree of mitotic activity and invasion of adjacent structures. Both ectopic neoplasms were classified as intermediate types of carcinoid tumor (between classical central and peripheral forms). All corticotroph and ectopic tumors stained positive for ACTH on immunohistochemistry. Tumors were obtained at surgery and kept at 270 C until assay. TABLE 1. Clinical and biochemical features of the patients studied Patient no.
Sex
Age
Diagnosis
HDDST
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
M F F M F F F F F F F M F F F F F M M F M F
59 24 25 36 36 42 63 28 24 47 26 31 49 47 60 64 24 49 31 44 52 38
CD CD CD PRLoma NF CD CD PRLoma CD ectopic CD CD ectopic NS CD CD CD NS CD CD CD 1 metastases ectopic
2 1 1 NA NA 1 1 NA 1 2 1 2 2 ND 1 2 1 ND 2 1 2 1
HDDST, High-dose dexamethasone suppression test; CD, Cushing’s disease; NS, Nelson’s syndrome; NA, not applicable; ND, not done, PRLoma, prolactinoma; NF, nonfunctioning adenoma.
1089
RT-PCR Total RNA was obtained and reverse-transcribed into complementary DNA (cDNA), as previously published (17, 18). Two regions of the GR gene were targeted: one common area including the DNA-binding domain (DBD), spanning exons 2 to 4 (primers GRCs and GRCa, see sequences in Table 2); and the splice junction region, using the sense primer at exon 7 (GR7s), common to both primers, and either exon 9a (GRaa) or exon 9b (GRba) as antisense sequences to assess the two different subforms of GR (Fig. 1). The overall expression of the gene was determined by a duplex PCR using the GRCs and GRCa primers relative to the expression of either a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH), or of a corticotroph-specific gene, the POMC gene product. All the PCRs were performed before the saturated phase of the synthesis curve, and the primers were designed to span introns, such that any genomic DNA product would be distinguished from cDNA by size difference. Briefly, we used 100 ng cDNA, 200 mmol/L deoxynucleotides (Promega, Southampton, UK), 0.4 mmol/L each primer (0.2 mmol/L for GAPDH primers), 1.5 mmol/L MgCl2, 0.125 U Taq (Promega) and TaqStart antibody (Clontech, Heidelberg, Germany), according to the manufacturers’ guidelines. Twenty-eight cycles were performed at 94 C for 1 min, 54 C (for GAPDH and GR duplex) or 61 C (for POMC and GR duplex) for 1 min, and 72 C for 1 min, after a first denaturing cycle at 95 C for 5 min. A final extension cycle of 10 min at 72 C was used. The PCR products were run on ethidium bromide-stained agarose gels. The absorbance values for each band were measured by densitometry (Model GS-670 Imaging Densitometer, Bio-Rad, Hemel Hempstead, Hertfordshire, UK), using the Molecular Analyst/PC Software for Bio-Rad’s Image Analysis Systems, and expressed as optical density units. A ratio between the GR and GAPDH, and of the GR and POMC bands, was obtained for each individual sample. The specific GRa and GRb products were amplified in a duplex PCR, in which the specific antisense primers GRaa and GRba shared the same sense primer, GRSs, each of them at 0.5 mmol/L concentration. All other components of the reaction were as described above. Because the expression of the GRb subform is at a much lower level than the GRa subform, the two products could not be visualized on a gel at the same phase of the PCR. Therefore, we performed a Southern blot analysis of the amplified products after a 28-cycle PCR.
Southern blotting of GRa and GRb After 28 cycles of reaction, both GRa and GRb products were still on the exponential phase of the PCR, with only the GRa products visible by ethidium bromide staining. The gels were then transferred to nylon membranes (N1, Amersham, UK) with the Mini-Electron Transfer Blot (Bio-Rad), and hybridized to an end-labeled internal oligoprobe directed against exon 8, as previously described (19). Two bands were expected to be generated from such a procedure. The relative intensity of the two bands resulting from the respective abundance of the two subforms was assessed by densitometric analysis, as described above. The GRa/GRb ratio of ACTH-secreting pituitary and ectopic tumors was compared with the ratio obtained in pituitaries from three autopsies in individuals without endocrine disease or glucocorticoid therapy, and also to three non-ACTH-secreting tumors.
SSCP (single-strand conformation polymorphism) analysis To search for mutations of the DBD and the splice junction area of the GR gene, PCR-SSCP analysis was performed. A single PCR was performed as described above, and the products were labeled with a[32P]dCTP (6000 Ci/mmol S.A., ICN Biochemicals, Thame, UK), as previously described (17). The radioactive PCR products were diluted in a denaturing dye and run on polyacrylamide gels under two different conditions: with or without 10% glycerol. Products greater than 400 bp in length were digested with two different restriction enzymes, AvaII and ClaIII (New England Biolabs, Taunus, Germany), according to the manufacturer’s guidelines, giving rise to bands of smaller size before running on the gels. Three different pituitaries obtained from autopsy in individuals without endocrine disease were used as normal controls. The small cell lung cancer-derived cell line COR L24 (kindly provided by Dr. Adrian Clark),
1090
JCE & M • 1997 Vol 82 • No 4
DAHIA ET AL.
TABLE 2. Sequences of the primers used in this study Region
GRC GR a GRb POMC GAPDH
Sense Primer
59 59 59 59 59
TCCCTTTCTCAACAGCAGGAT 39 ACACAGGCTTCAGGTATCTT 39 ACACAGGCTTCAGGTATCTT 39 ACCACGGAAAGCAACTGCTG 39 GGAGTCAACGGATTTGGT 39
Antisense Primer
59 59 59 59 59
Product size (bp)
CAATCATTCCTTCCAGCACAT 39 ACTGCTTCTGTTGCCAAG 39 CGCCAAGATTGTTGGGATGA 39 TGCCGCTGCTGCTGCTGTT 39 GTGATGGGATTTCCATTGAT 39
371a 557a 294 178 206
GRC, Common glucocorticoid receptor region; GRa, a-isoform; GRb, b isoform; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. products were digested with restriction enzymes before SSCP analysis.
a
FIG. 1. Schematic representation of the GR gene (exons are represented by boxes, and introns by lines) and the two splicing variants, GRa and GRb. The primers used in this study are represented by arrows and labeled according to Table 2. *, A mutation previously reported in exon 2 (10).
known to carry abnormalities of the GR sequence (8), was used as a positive control for the SSCP.
Results
Sixteen of the 19 ACTH-secreting tumors (including the 2 ectopic secretors) showed variable, but increased overall GR expression, whereas 3 showed an expression approximately equivalent to the normal controls. These findings were observed for both the GAPDH and POMC duplex PCRs (Fig. 2). No clinical, histological, or biochemical feature of the patients [in particular, the degree of suppressibility to highdose dexamethasone (Fisher’s exact test 5 0.65; P 5 0.75)], correlated with increased expression of GR. The non-ACTHsecreting tumors showed intermediate expression of GR between the corticotroph tumors and normal pituitaries, in relation to both GAPDH and POMC transcripts. The GRa subform was expressed at 37.3- 6 5.7- (range, 32to 46-) fold optical density units (nonlinear values), as compared with the GRb subform; this pattern was observed in the tumor samples and the normal pituitaries used as controls (Fig. 3). The expression of GRa varied among the tumors, with 70% showing a higher expression, and 30% a similar expression, compared with the controls.
No mobility shifts were identified in any of the tumor samples in either region examined under two different SSCP conditions, whereas the positive control, COR L24 cell line, had a clear mobility shift (Fig. 4). Discussion
The molecular events leading to the development of ACTH-secreting tumors remain unclear. Investigation of known oncogenes has not generally demonstrated their involvement. For example, whereas expression of the p53 protein was noted to be altered in more than 50% of corticotroph tumors (2), another study (3) failed to demonstrate structural abnormalities of the corresponding gene in a small series of four ACTH-secreting tumors. Thus, it has been suggested that genes involved in the physiological regulation of corticotroph function may be deranged in ACTH-secreting tumors. We recently have shown that the gene encoding for the pituitary vasopressin receptor, V3R, is overexpressed in ACTH-secreting tumors of both pituitary and ectopic origin, and this finding may be related to the abnormal responses seen in such patients to the vasopressin analog, desmopres-
GR TRANSCRIPTS IN ACTH-SECRETING TUMORS
1091
FIG. 2. Ethidium bromide-stained agarose gel of products of a GR and GAPDH duplex PCR (lanes 2–9) and GR and POMC duplex PCR (lanes 10 –19). Two normal pituitaries (lanes 2, 3, 10, 11), five ACTH-secreting tumors (lanes 4 – 8 and 12–16), and two non-ACTH-producing tumors (lanes 18 and 19) are shown. Note the increased expression in four of the five tumors in both experiments, whereas one tumor has similar expression to the normal pituitaries. Lanes 9 and 17 are negative controls (DNA was replaced by water in these samples), and lane 1 is a size marker (HinfI-digested PhiX174).
FIG. 3. Southern blotting of GRa and GRb products from a duplex PCR, hybridized to an internal oligoprobe after 48 h exposure. Lanes 1 and 2 are two normal pituitaries, lane 3 is a 1:1 mixture of GRa (top band) and GRb (bottom band) controls, lanes 4 –10 are ACTH-secreting tumors (lane 4 is a 10-times diluted sample), and lane 11 is a negative control.
sin (20, 21); however, we were unable to demonstrate any mutation of the V3R in these same patients (17). The GR is a more plausible candidate gene potentially involved in Cushing’s disease, as dexamethasone resistance is one of the most robust biochemical indicators of the syndrome (6, 7, 22). Other clinical models of glucocorticoid resistance, such as rare cases of glucocorticoid-resistant asthma, recently have begun to be explored at the molecular level (23). There is evidence that a shift in the proportions of the alternate splice variants occurs in such cases, such that the GRb transcript is overexpressed (24). Similarly, it has been shown that New World primates overexpress the GRb isoform, compared with humans, which may account for the glucocorticoid resistance seen in these species (25, 26). It has been suggested that the GRb excess may disrupt the receptor dimerization process; alternatively, a predominance of GRaGRb heterodimers may contribute to a decrease in the transactivating process or may even actively transrepress GRresponsive genes, as compared with the GRa-GRa homodimers. We therefore investigated whether the nonligand-binding form, or GRb, might be involved in determining the tissue-specific glucocorticoid resistance seen in ACTH-secreting tumors. However, we were unable to demonstrate any abnormality in the level of expression of the two subforms of GR, GRa and GRb, in a panel of tumors of both pituitary and ectopic origin. The active or ligand-binding form, GRa, was expressed in greater excess than the GRb subform in our tumor samples, as well as in three normal
pituitaries used as controls. Nevertheless, as we have not attempted to quantify the expression of the two isoforms at the protein level, possible posttranslational modifications affecting the relative amount of GRa and GRb cannot be entirely excluded. In fact, a discrepancy between the mRNA and protein expression levels of the two GR isoforms recently has been suggested (14). We found that total GR mRNA expression was variable, with the majority (.80%) of tumors showing increased expression, whereas the few remaining cases had expression equivalent to the pituitary controls. Chronic exposure to high cortisol levels, such as that occurring in Cushing’s disease, might be expected to down-regulate GR if feedback mechanisms were intact. In fact, previous studies in vitro have described a decrease in GR expression after glucocorticoid exposure (27–30). In addition, a study performed in cultured cells from corticotroph adenomas revealed maintenance of the feedback mechanism by showing a decrease in the GR expression after exposure to dexamethasone (31). The reasons for these apparently contradictory findings amongst our tumors are unknown. It is possible that, owing to the small size of the pituitary tumors, some degree of contamination with normal tissue could have occurred, and thus, the variable extent of normal cells in the tumor preparation could account for differential expression levels of the GR gene amongst the different samples. In the normal pituitary, the corticotroph population accounts for approximately 12–20% of the whole pituitary population and may be diluted by other cell types. As the other cell types may also express the GR (it has been shown that most GH-secreting, at least 50% of LH-, FSH-, and TSH-secreting, and some PRL-secreting cells also express GR (32, 33)), it is difficult to estimate the normal corticotroph GR density. We have attempted to normalize our data by relating the GR expression to another corticotroph product, that of POMC gene, although POMC expression in corticotroph tumors has not been defined clearly in comparison with normal corticotrophs. Nevertheless, our data clearly suggest that in corticotroph tumors, the GR message is not decreased and may even be overexpressed in some tumors. We also were unable to correlate the degree of dexamethasone suppression to the relative expression of GR message. It is conceivable that the regulation of GR in response to high cortisol levels does not occur at the tran-
1092
DAHIA ET AL.
JCE & M • 1997 Vol 82 • No 4
FIG. 4. SSCP analysis of the common region of the GR. Lane 1 is a normal pituitary control, lane 2 is the positive control (COR L24 cell line), and the remaining lanes are tumor samples.
scriptional level, but instead, posttranscriptional or posttranslational regulatory mechanisms might account for a putative down-regulation of GR. We also were unable to detect any mutation of the region of the GR analyzed. This included the DBD and part of the ligand-binding domain, two important functional regions of the GR protein. The technique employed, SSCP, has been widely used for mutation screening. Two different gel conditions were used, and the fragments were digested with restriction enzymes to enhance sensitivity of the SSCP. This technique allowed us to detect a mutation in the GR previously reported in a small-cell lung carcinoma cell line (8). Although we cannot rule out the occurrence of mutations in other regions of the gene, recent reports have suggested that mutations of the GR regions examined in our study, in particular the DBD, seem to correlate with clinically relevant conditions (10). It has been proposed that mutations of this region may play a part in the pathogenesis of certain cases of Nelson’s syndrome, but we were unable to find mutations of this area in either of our two cases of Nelson’s syndrome. More recently, another mutation of the GR-coding region has been described in a very uncommon clinical setting: Cushing’s disease developed in a subject previously shown to be glucocorticoid resistant (34), indicating that structural abnormalities of the GR may contribute to, but are not essential for, the corticotropin tumor phenotype. In conclusion, although ACTH-secreting tumors commonly show glucocorticoid resistance on clinical testing, no significant abnormalities in the relative expression of the two main GR subforms were observed in a series of such tumors. Additionally, mutations of regions critical to normal function of the receptor do not seem to be a frequent event of these tumors. However, other mechanisms of regulation of the GR gene cannot be ruled out as mediators of the development of ACTH-secreting tumors. Acknowledgments We are grateful to Dr. Ricardo C. T. Aguiar for his helpful comments and to Dr. Se´rgio P. A. Toledo and Dr. Bruno Allolio for providing tumor samples.
References 1. Herman V, Fagin J, Gonsky R, Kovacs K, Melmed S. 1990 Clonal origin of pituitary adenomas. J Clin Endocrinol Metab. 71:1427–1433. 2. Buckley N, Bates AS, Broome JC, et al. 1994 P53 protein accumulates in Cushing’s adenomas and invasive non-functional adenomas. J Clin Endocrinol Metab. 79:1513–1516.
3. Levy A, Hall L, Yeudall WA, Lightman SL. 1994 p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf). 41:809 – 814. 4. Herman V, Drazin NZ, Gonsky R, Melmed S. 1993 Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab. 77:50 –55. 5. Miller J, Crapo L. 1994 The biochemical diagnosis of hypercortisolism. Endocrinologist. 4:7–16. 6. Orth DN. 1995 Medical progress- Cushing’s syndrome. N Engl J Med. 332:791– 803. 7. Trainer PJ, Grossman A. 1991 The diagnosis and differential diagnosis of Cushing’s syndrome. Clin Endocrinol (Oxf). 34:317–330. 8. Ray DW, Davis JRE, White A, Clark AJL. 1996 Glucocorticoid receptor structure and function in glucocorticoid-resistant small cell lung carcinoma cells. Cancer Res. 56:3276 –3280. 9. Gaitan D, DeBold CR, Turney MK, Zhou P, Orth DN, Kovacs WJ. 1995 Glucocorticoid receptor structure and function in an adrenocorticotropin- secreting small cell lung cancer. Mol Endocrinol. 9:1193–1201. 10. Karl M, Von Wichert G, Kempter E, et al. 1996 Nelson’s syndrome associated with a somatic frame shift mutation in the glucocorticoid receptor gene. J Clin Endocrinol Metab. 81:124 –129. 11. Hollenberg SM, Weinberger C, Ong ES, et al. 1985 Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature. 318:635– 641. 12. Encio IJ, DeteraWadleigh SD. 1991 The genomic structure of the human glucocorticoid receptor. J Biol Chem. 266:7182–7188. 13. Oakley RH, Sar M, Cidlowski JA. 1996 The human glucocorticoid receptor beta isoform. Expression, biochemical properties, and putative function. J Biol Chem. 271:9550 –9559. 14. Castro M, Elliot S, Kino T, et al. 1996 The non-ligand binding b-isoform of the human glucocorticoid receptor (hGRb): tissue levels, mechanism of action and potential physiologic role. Mol Med. 2:597– 607. 15. Bamberger CM, Bamberger AM, De Castro M, Chrousos GP. 1995 Glucocorticoid receptor b, a potential endogenous inhibitor of glucocorticoid action in humans. J Clin Invest. 95:2435–2441. 16. Pratt WB. 1993 The role of heat shock proteins in regulating the function, folding, and trafficking of the glucocorticoid receptor. J Biol Chem. 268:21455–21458. 17. Dahia PLM, AhmedShuaib A, Jacobs RA, et al. 1996 Vasopressin receptor expression and mutation analysis in corticotropin-secreting tumors. J Clin Endocrinol Metab. 81:1768 –1771. 18. Chew SL, Lavender P, Jain A, et al. 1995 Absence of mutations in the MEN2A region of the ret proto-oncogene in non-MEN2A phaeochromocytomas. Clin Endocrinol (Oxf). 42:17–21. 19. Aguiar RCT, Sohal J, vanRhee F, et al. 1996 TEL-AML1 fusion in acute lymphoblastic leukaemia of adults. Br J Haematol. 95:673– 677. 20. Malerbi DA, Mendonca BB, Liberman B, et al. 1993 The desmopressin stimulation test in the differential diagnosis of Cushing’s syndrome. Clin Endocrinol (Oxf). 38:463– 472. 21. Newell-Price J, Perry L, Medbak S, et al. 1997 A combined test using desmopressin and corticotropin-releasing hormone in the differential diagnosis of Cushing’s syndrome. J Clin Endocrinol Metab. 82:176 –181. 22. Kaye TB, Crapo L. 1990 The Cushing syndrome: an update on diagnostic tests. Ann Intern Med. 112:434 – 444. 23. Bamberger CM, Schulte HM, Chrousos GP. 1996 Molecular determinants of glucocorticoid receptor function and tissue sensitivity to glucocorticoids. Endocr Rev. 17:245–261. 24. Castro M, Leung DY, Karl M, et al. Changes in the alternative splicing of the glucocorticoid receptor gene might contribute to the pathogenesis of glucocorticoid resistant asthma. Program of the 10th International Congress of Endocrinology, San Francisco, CA, 12–15 June, 1996, pp 3– 649 (Abstract). 25. Castro M, Elliot S, Stratakis CA, et al. Overexpression of the dominant negative glucocorticoid receptor beta isoform in New World primate cells. Program of the 10th International Congress of Endocrinology, San Francisco, CA, 12–15 June, 1996, pp 2– 846 (Abstract).
GR TRANSCRIPTS IN ACTH-SECRETING TUMORS 26. Brandon DD, Kendall JW, Alman K, Tower P, Loriaux DL. 1995 Inhibition of dexamethasone binding to human glucocorticoid receptor by New World primate cell extracts. Steroids. 60:463– 466. 27. Burnstein KL, Bellingham DL, Jewell CM, PowellOliver FE, Cidlowski JA. 1991 Autoregulation of glucocorticoid receptor gene expression. Steroids. 56:52–58. 28. Burnstein KL, Cidlowski JA. 1992 At the cutting edge: the down side of glucocorticoid receptor regulation. Mol Cel Endocrinol. 83:C1–C7. 29. Burnstein KL, Jewell CM, Sar M, Cidlowski JA. 1994 Intragenic sequences of the human glucocorticoid receptor complementary DNA mediate hormoneinducible receptor messenger RNA down-regulation through multiple mechanisms. Mol Endocrinol. 8:1764 –1773. 30. Silva CM, PowellOliver FE, Jewell CM, Sar M, Allgood VE, Cidlowski JA. 1994 Regulation of the human glucocorticoid receptor by long-term and chronic treatment with glucocorticoid. Steroids. 59:436 – 442.
1093
31. Suda T, Tozawa F, Dobashi I, et al. 1993 Corticotropin-releasing hormone, proopiomelanocortin, and glucocorticoid receptor gene expression in adrenocorticotropin-producing tumors in vitro. J Clin Invest. 92:2790 –2795. 32. Kononen J, Soinila S, Persson H, Honkaniemi J, Hokfelt T, PeltoHuikko M. 1994 Neurotrophins and their receptors in the rat pituitary gland: regulation of BDNF and trkB mRNA levels by adrenal hormones. Mol Brain Res. 27:347–354. 33. Lopez JF, Palkovits M, Arato M, Mansour A, Akil H, Watson SJ. 1992 Localization and quantification of pro-opiomelanocortin mRNA and glucocorticoid receptor mRNA in pituitaries of suicide victims. Neuroendocrinology. 56:491–501. 34. Karl M, Lamberts SWJ, Koper JW, et al. 1996 Cushing’s disease preceded by generalized glucocorticoid resistance: clinical consequences of a novel, dominant-negative glucocorticoid receptor mutation. Proc Assoc Am Physicians. 108:296 –307.
National Institutes of Health Conference on AIDS Wasting Syndrome Bethesda, Maryland May 20 –21, 1997 An NIH Conference on AIDS Wasting Syndrome will be held in Bethesda, Maryland on May 20 –21, 1997. This international workshop will bring together leading investigators in the areas of etiology, natural history, and pathogenesis, including the links between wasting, viral load and the response to infection and inflammation, as well as new approaches to the therapy of AIDS wasting syndrome. For further information, contact Ms. Ann Borlo, Social and Scientific Systems, Inc., 7101 Wisconsin Ave, Suite 1300, Bethesda, Maryland 20814. Phone: 301-986-4870. Fax: 301-913-0351. Email:
[email protected].
