Expression of prolactin-releasing peptide and its ... - Semantic Scholar

Molecular Human Reproduction Vol.8, No.4 pp. 356–362, 2002

Expression of prolactin-releasing peptide and its receptor in the human decidua* Fernando M.Reis1,4, Paola Vigano`1, Enrico Arnaboldi2, Poli M.Spritzer5, Felice Petraglia3 and Anna M.Di Blasio1,6 1Laboratory

of Molecular Biology, Istituto Auxologico Italiano, 2Clinical Chemistry Laboratory, Istituti Clinici di Perfezionamento, Milan, of Obstetrics and Gynecology, University of Siena, Siena, Italy, 4Department of Obstetrics and Gynecology, University of Minas Gerais, Belo Horizonte and 5Gynecological Endocrinology Unit and Department of Physiology, University of Rio Grande do Sul, Porto Alegre, Brazil 3Department

6To

whom correspondence should be addressed at: Laboratory of Molecular Biology, Istituto Auxologico Italiano, Viale Montenero, 32, 20135 Milan, Italy. E-mail: [email protected]

Human decidua and decidualized endometrial cells produce prolactin (PRL). Several growth factors and cytokines have been shown to regulate decidual PRL release, but a specific PRL-releasing substance remains to be characterized. Prolactin-releasing peptide (PrRP) is a peptide isolated from the brain and distinguished by its potent and specific stimulation of PRL release by cultured pituitary cells. Here, we demonstrate that human decidua expresses immunoreactive PrRP as well as the mRNAs encoding PrRP and its receptor. First trimester deciduas were obtained from women undergoing elective termination of pregnancy. Tissue specimens were stained by immunohistochemistry using a rabbit anti-human PrRP-31 antibody, and PrRP was localized in both epithelial cells of the decidual glands and in stromal cells, with diffuse distribution and no special relation with the neighbourhood of blood vessels. In primary cultures of decidual stromal cells, PrRP and PrRP receptor gene expression were detected using RT–PCR, and the identity of the PCR products was further confirmed by restriction enzyme digestion. The effect of PrRP on decidual PRL release was also evaluated, and there was a significant increase in PRL production (135 ⍨ 4% of control levels, P < 0.05) after incubation of decidual stromal cells with synthetic PrRP. The expression of PrRP and PrRP receptor in human decidual cells and the ability of PrRP to induce PRL secretion by cultured decidual cells suggests that this peptide may be a novel local modulator of decidual PRL release. Key words: decidua/mRNA/pregnancy/prolactin-releasing peptide

Introduction Human endometrial stromal cells produce prolactin (PRL) as they undergo decidualization during the secretory phase of the menstrual cycle (Tabanelli et al., 1992). If pregnancy occurs, these decidual cells continue to produce PRL, which is carried through fetal membranes and released into the amniotic fluid (Riddick and Maslar, 1981; Hamaguchi et al., 1990). There are many potential target tissues for decidual PRL since PRL binding sites or receptors have been identified in the endometrium, placenta, amnion and a number of fetal tissues (Bole-Feysot et al., 1998; review). PRL effects are mediated

*Part of this paper was presented at the 53th Annual Meeting of the American Society for Reproductive Medicine, Orlando, USA, 20–25 October 2001, and received a Finalist award from the Poster Prize Committee.

356

by a membrane-anchored receptor appertaining to the class 1 cytokine receptor superfamily (Bazan, 1990), whose binding by the hormone promotes tyrosine phosphorylation of several cellular proteins, including the receptor itself, leading to the activation of tyrosine kinase signalling cascades (Bole-Feysot et al., 1998). Decidual PRL is biologically and immunologically equipotent with pituitary PRL (Tomita et al., 1982), but its regulation involves different mechanisms. For example, unlike pituitary PRL, decidual PRL release is not stimulated by estradiol or by thyrotrophin-releasing hormone (TRH) and is not inhibited by dopamine or bromocriptine (Golander et al., 1979; Irwin et al., 1991). The de-novo PRL production by cultured decidual cells is stimulated or inhibited by several cytokines, protein hormones and growth factors with nonspecific PRL-modulating activity (Ben-Jonathan et al., 1996; review). © European Society of Human Reproduction and Embryology

PrRP and its receptor in the decidua

Prolactin-releasing peptide (PrRP) is a peptide isolated from rat hypothalamus with specific PRL-releasing activity on pituitary cells (Hinuma et al., 1998). There are two isoforms of PrRP with a common carboxy-terminal portion and distinct N termini due to alternative cleavage of the preproprotein. These isoforms contain 31 and 20 amino acids and have been named PrRP-31 and PrRP-20 respectively (Hinuma et al., 1998). In the rat, analysis of the tissue distribution of PrRP mRNA and immunoreactive PrRP showed that its constitutional gene expression predominates in the central nervous system, particularly in the hypothalamus, posterior pituitary, thalamus and medulla oblongata, but the peptide is also present to a lesser extent in the digestive tract, liver, kidney, pancreas, adrenal gland, testis and ovary (Maruyama et al., 1999; Matsumoto et al., 1999a; Takahashi et al., 2000a). The tissue distribution in humans is still unknown. PrRP binds to a receptor formerly known as the orphan seven-transmembrane receptor hGR3. This receptor has been identified using RT–PCR in normal human pituitary and pituitary adenomas (Zhang et al., 1999; Takahashi et al., 2000b). In the rat, PrRP receptor mRNA has been reported in the pituitary anterior lobe and also in extra-pituitary organs such as adrenal medulla, testis and pancreas (Nieminen et al., 2000). The present study aimed to evaluate the possible local expression of PrRP and its receptor in human decidua by using immunohistochemistry on integral tissue specimens and mRNA characterization in primary cultures of isolated decidual stromal cells. In addition, the possible effect of PrRP on PRL secretion by cultured decidual cells was investigated.

Materials and methods Tissue collection Deciduas (n ⫽ 6) were collected from healthy women undergoing elective termination of pregnancy at 8–14 weeks gestation. The operative method used was cervical dilatation followed by vacuum extraction of the products of conception. Specimens of decidua were rinsed several times in phosphate-buffered saline (PBS) and then processed immediately. The specimens destined for histological processing were fixed in phosphate-buffered 10% formaldehyde, while those destined to cell culture were collected in Hank’s balanced salt solution and immediately transported to the laboratory. Endometrial specimens were collected from women undergoing laparoscopy for non-endometriotic benign ovarian cysts. These procedures were approved by the local ethics committee and patients gave their informed consent. Immunohistochemistry Formalin-fixed, paraffin-embedded decidual specimens were cut into 4 µm slices, which were stained by immunohistochemistry using the avidin–biotin–peroxidase method (Hsu et al., 1981), as previously described (Reis et al., 1999). All samples and controls were processed together. After exposure to 1% H2O2 in methanol to block endogenous peroxidase, sections were treated with normal goat serum for 30 min to suppress non-specific binding. Rabbit anti-human PrRP-31 serum (Phoenix Pharmaceuticals, Mountain View, CA, USA) was diluted 1:100 in PBS and applied onto the slides for 12 h at 4°C. This is a specific polyclonal antibody that has 3.13% cross-reaction with human PrRP-20 and no cross-reaction with other known hypothalamic neurohormones (Chen et al., 1999). An antibody against PrRP

receptor was not used because such a reagent is not currently available. Sections were treated with biotinylated goat anti-rabbit immunoglobulin G for 30 min at room temperature and incubated with the avidin–biotin–peroxidase complex (Vector, Burlingame, CA, USA) for 60 min. Peroxidase activity was visualized by exposing the slices for 3 min to 1 mg/ml 3,3⬘-diaminobenzidine tetrahydrochloride (Sigma Chemical Co., St Louis, MO, USA) in PBS containing 0.3% H2O2. The sections were then counterstained with haematoxylin. In the negative controls the primary antibody was pre-adsorbed with synthetic human PrRP-31. Additional negative controls consisted of the replacement of the primary antibody by normal rabbit serum at equivalent dilution. Endometrial specimens dated as proliferative (obtained between days 8 and 13 of the menstrual cycle, n ⫽ 7) and secretory (obtained between days 21 and 28, n ⫽ 7) were submitted to the same immunohistochemical procedure in order to verify whether PrRP might be present in the endometrium before its complete decidual differentiation. Sections of endometrium and decidua contiguous to those evaluated for PrRP expression were immunostained with antiPRL antibody as previously described (Reis et al., 1999) and colocalization with PrRP was determined using image processing software. Culture of decidual stromal cells Decidual cells were isolated from fragments of decidua vera while fragments of decidua basalis containing trophoblast were not used. Briefly, decidual tissue was minced thoroughly between two scalpels and digested for 1 h at 37°C with gentle agitation in HAM’S F-10 with 0.1% collagenase and 0.2% hyaluronidase. Single cell suspensions were left at 37°C overnight, then washed several times to remove non-attached cells and debris. Decidual stromal cells were cultured in HAM’S F-10 with 10% FCS and antibiotics in an humidified atmosphere of 95% air and 5% CO2 at 37°C. After a minimum of 8 days, cells were counted and used for RNA extraction. An aliquot of the cell suspension was submitted to flow cytometric analysis to determine the possible contamination of CD45/CD14positive cells in these cultures. Cultures in which the proportion of CD45-positive cells was ⬎2% were not used. Extraction of RNA and synthesis of cDNA The cultured cells were harvested in phenol-guanidine isothiocyanate (Trizol; Gibco BRL, Gaithersburg, MD, USA) according to the supplier’s instructions. Total RNA was extracted with chloroform and precipitated with isopropanol by 12 000 g centrifugation at 4°C (Chomczynski and Sacchi, 1987). In order to digest any contaminant genomic DNA, RNA samples were treated with 5 IU DNAse (Promega RQ1, Milano, Italy) at 37°C for 10 min, and precipitated with 0.1 mol/l sodium acetate pH 5.2 and 100% ethanol by centrifugation at 12 000 g. The RNA pellet was washed with 75% ethanol, resuspended in diethylpyrocarbonate-treated water and quantified by light absorbance at 260 nm. First strand cDNA was synthesized from 2 µg total RNA using the GeneAmp® RNA PCR kit purchased from Perkin-Elmer (Roche Molecular Systems, Branchburg, NJ, USA). After denaturing the template RNA and primers at 70°C for 10 min, 50 IU reverse transcriptase was added in the presence of buffer II (50 mmol/l KCl, 10 mmol/l Tris–HCl, pH 8.3), 2.5 mmol/l MgCl2, 0.5 mmol/l dNTP mix and 20 IU RNAse inhibitor. The mixture (20 µl) was incubated at 42°C for 55 min, then heated at 70°C to stop the reaction and stored at –20°C. RT–PCR RT–PCR was carried out in a final volume of 50 µl. A total of 2 µl of the first strand synthesis reaction was incubated with buffer

357

F.M.Reis et al. II, 1.5 mmol/l MgCl2, 0.2 µmol/l sense and antisense primers, 0.2 mmol/l dNTP mix and 1.25 IU Taq DNA polymerase. The specific primers used to amplify cDNA fragments corresponding to the target genes were as follows: PrRP (GenBank accession no. AB015419) sense, 5⬘-TGGCTCCTGTGCCTGCTGATG-3⬘ (bases 19–39) and antisense, 5⬘-CAGCCATCCTGGGACGACATAG-3⬘ (bases 242–263), generating a product of 245 bp; and PrRP receptor (GenBank accession no. AB015745) sense, 5⬘-TGCTCTACAGCGTCGTGGTG-3⬘ (bases 194–213) and antisense, 5⬘-AGATGGCCAGCACAGCGTAG-3⬘ (bases 531–550), generating a 357 bp fragment. Genomic DNA extracted (Tsai et al., 1995) from the peripheral lymphocytes of a female donor was also submitted to PCR amplification using the PrRP primers. PCR amplification consisted of 35 thermal cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. The first cycle was preceded by denaturation at 94°C for 3 min and the last cycle was followed by extension at 72°C for 5 min. The product of a first strand reaction performed without reverse transcriptase was also submitted to the PCR protocol to serve as negative control. An aliquot of the PCR mixture (15 µl) was resolved on a 3% agarose gel stained with ethidium bromide and photographed under UV light. The identity of the amplified fragments was further confirmed by

restriction enzyme digestion. The PrRP amplified fragment has a unique restriction site for AluI, while the fragment corresponding to PrRP receptor has a unique restriction site for PstI. The PCR products were precipitated by incubation at –20°C for 10 min followed by centrifugation at 12 000 g for 15 min in the presence of dextran, 3 mol/l sodium acetate pH 5.2 and 100% ethanol. The pellet was washed with 75% ethanol and resuspended in 15 µl sterile water. The endonucleases (8 IU AluI or 20 IU PstI, New England Biolabs, Beverley, MA, USA) were added together with the accompanying buffer and bovine albumin to a final volume of 20 µl and incubated at 37°C for 90 min. The digested products were size fractioned in a 3% agarose gel run at 76 V for 45 min. Sequencing of PCR products Purification of the specific PCR bands was performed in a GFX column (Amersham, Milano, Italy) by brief centrifugation at full speed, followed by elution with 10 mmol/l Tris–HCl buffer pH 8.0 and Tris– EDTA buffer pH 8.0. Sequencing reactions were prepared using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) according with the manufacturer’s instructions, read in an ABI Prism 310 automatic sequencer (PE Applied Biosystem, Monza, Italy) and processed by the software ABI Prism version 3.0.

Figure 1. (a,b) Cellular localization of PrRP in human decidua of early pregnancy using immunohistochemistry. The presence of immunoreactive PrRP is indicated by the granular brown staining in the cytoplasm of both epithelial and stromal cells. (c,d) Decidua incubated with non-immune serum (c) or with the antibody preadsorbed with human PrRP (d) showing absence of staining (negative controls). Endometrial biopsies collected during the proliferative phase (e) and secretory phase (f) of the menstrual cycle show PrRP immunostaining, which is absent from the negative control (g). Scale bar ⫽ 30 µm.

358

PrRP and its receptor in the decidua

Figure 4. Characterization of the PrRP gene transcript of human decidual cells versus genomic DNA. The same primers generated a 245 bp PCR product from decidual cDNA and a 583 bp product from genomic DNA. The difference (338 bp) is due to an intron located between bases 100 and 101 of the published PrRP cDNA sequence (GenBank accession no. AB015419). performed using a commercially available chemiluminescent immunometric assay provided by the Diagnostics Product Corporation (Los Angeles, CA, USA). The results were normalized to the number of cells present in each well at the end of the experiment. Data are expressed as means ⫾ SEM of four experiments. Statistical comparison between control and treatments was performed by oneway analysis of variance followed by Fisher’s post-test.

Results

Figure 2. Identification of PrRP (A) and PrRP receptor (B) mRNA in isolated decidual cells using RT–PCR. Each pair of lanes represents the product of RT–PCR performed with (RT ⫹) or without (RT –) reverse transcriptase, using as a template the RNA extracted from four different cell cultures. M ⫽ size marker.

Figure 3. Restriction enzyme analysis of the PCR products shown in Figure 2. The bands correspond to PrRP before (245 bp, lane 1) and after AluI digestion (204 and 41 bp, lane 2), and to PrRP receptor before (357 bp, lane 3) and after PstI digestion (224 bp and 133 bp, lane 4). M ⫽ size marker. Prolactin release by decidual stromal cells Decidual stromal cells were plated in 12-well tissue culture plates at an average density of 1.2⫻105 cells/well in HAM’S F-10 with 10% FCS and antibiotics. After 8 days during which medium was changed every other day, cells were treated with PrRP-31 (Phoenix Pharmaceuticals) at concentrations ranging from 10–11 to 10–7 mol/l. The treatment lasted 24 h and, thereafter, the medium was collected and immediately frozen until assayed for PRL content. The quantitative detection of PRL in medium conditioned by cultured cells was

Expression of PrRP peptide and mRNA in human decidua Figure 1 (a,b) shows that specific immunoreactive PrRP is present in human first trimester decidua. Immunostaining was apparently uniform in the cytoplasm of both epithelial cells of the decidual glands and stromal cells. Immunopositive cells were diffusely distributed throughout the decidua and had no special relationship with the neighbourhood of blood vessels. This pattern of distribution of PrRP immunostaining was constant throughout the tissue samples examined. Staining was absent in the slides incubated with non-immune rabbit serum (Figure 1c) or with the antibody pre-adsorbed with human PrRP-31 (Figure 1d). PrRP immunostaining was present in the endometrium of both proliferative and secretory phases of the menstrual cycle, but the staining was much less intense in specimens collected during the proliferative phase (Figure 1e). In the secretory endometrium, PrRP was abundantly expressed in both stromal and epithelial layers, and staining was particularly intense in the glandular epithelium (Figure 1f). Co-localization analysis indicated that the majority of cells expressing PrRP also expressed PRL immunoreactivity (data not shown). The specific mRNA encoding the human PrRP was expressed in all four primary cultures of decidual cells (Figure 2A). The specificity of the product of PrRP gene expression obtained by RT–PCR amplification was attested by confirmation of the predicted 245 bp fragment length (Figure 2A), by the recovery of the expected products of endonuclease digestion corresponding to the unique restriction site for AluI, resulting in fragments of 204 and 41 bp (Figure 3), and also by sequencing of the PCR product. In addition to previous digestion of any contaminant genomic DNA, further evidence was obtained to verify that the RT–PCR product corresponding to the PrRP 359

F.M.Reis et al.

Table I. Nucleotide sequence of an intron identified in the human PrRP gene 1 51 101 151 201 251 301

GTGAGTGCCTGGACCCCTGTCNGCCTCCCTTACCCCACCCTGCCTCACCC CAGAACCTAGTGCAGCCTGGTCGCTCGAGAACCTGGCAGGAACGGGGTGC GCGGGAGGAAAGGGAAGTCAGTCTTGGTGCTTTTTTGAACTCCTGCTTCC CAAAGCCAGCCCACGCCCAGAAATGGCCTCGCCAGAACCTCTGGGTGCCT GTTCCTCGGGTGGCTCCCAGCATGGCCTGGCGACTGGGCTGAGAGGCCCT GCCTGTGCACTCTGCCCCGCTGCCTCTGGGAGCACAGCACACCCTGGGGA CACGTGCCCATGGTCTGCTCCAGCTCTTTCCTTTCCAG

50 100 150 200 250 300 338

gene originated from cDNA rather than genomic DNA. First, the negative controls performed with omission of the RT step did not produce any visible band (Figure 2A); and second, amplification of genomic DNA using the same PrRP primers resulted in a 583 bp fragment, contrasting with the 245 bp fragment obtained when cDNA from decidual cells was used as a template (Figure 4). Expression of PrRP receptor mRNA in human decidual cells Cultured human decidual cells also expressed the gene of PrRP receptor. The expected 357 bp fragment was obtained by RT–PCR analysis of the same cell cultures in which PrRP had been detected (Figure 2B), which rules out the hypothesis of residual contamination by genomic DNA. The specificity of this finding was further confirmed by absence of amplification of the negative controls (Figure 2B), and by restriction enzyme digestion of the amplified fragments (Figure 3). As expected from the localization of the unique restriction site for PstI within the sequence framed by the specific PrRP receptor primers, digestion of the RT–PCR product with this endonuclease resulted in fragments of 224 and 133 bp (Figure 3). Sequencing of the PrRP gene transcript of human decidual cells versus genomic DNA In order to further clarify that the product obtained by RT– PCR analysis of PrRP gene expression in decidual cells was not an artifact from contamination by genomic DNA, we intended to design the primers to span intron–exon borders. Since the structure of the PrRP gene was still unknown (S.Hinuma, personal communication), we performed parallel amplification of both cDNA and genomic DNA templates with the PrRP primers and sequenced the products for comparison. This procedure led to the identification of a 338 bp intron located between bases 100 and 101 of the published cDNA sequence (GenBank accession no. AB015419). The sequence of this intron is depicted in Table I. PRL release by decidual stromal cells Figure 5 shows the results of PrRP treatment on PRL release by decidual stromal cells. The peptide was able to enhance PRL release starting from a dose of 10–11 mol/l, but this effect was only statistically significant at the dose of 10–9 mol/l (135 ⫾ 4% of control levels, P ⬍ 0.05). In contrast, higher doses did not seem to be effective.

Discussion The data reported herein represent the first demonstration that PrRP and its receptor are expressed in human decidua. The 360

Figure 5. Promotion of PRL secretion from human decidual stromal cells by increasing doses of PrRP. PRL concentrations represent the means of percentages ⫾ SEM relative to a control (100%) without PrRP. *P ⬍ 0.05 versus control (Fisher’s posttest).

presence of PrRP was observed in both stromal and glandular epithelial cells of first trimester deciduas, whereas the local synthesis of PrRP and its receptor was indicated by the identification of both RNA transcripts in isolated decidual cells. These findings make human decidua a novel source and potential target for PrRP. The localization of PrRP in the decidua was consistent with previous observations of the pattern of decidual PRL expression during early pregnancy (Wu et al., 1991). Like PRL, PrRP is present not only in the stroma but also in the epithelial layer of the glands. Also similarly to PRL (Wu et al., 1991), we observed PrRP immunostaining uniformly distributed in the cytoplasm of positive-staining cells and diffusely distributed throughout the decidua. This was confirmed by colocalization analysis of serial sections showing that most PrRP-positive cells also expressed PRL immunoreactivity. The present data did not determine which of these cells actually produce PrRP, but the finding of PrRP mRNA in cultured decidual cells supports the hypothesis of local synthesis of the peptide. The abundant expression of PrRP in early pregnancy decidua, just as occurs with PRL (Ben-Jonathan et al., 1996), suggests that PrRP and PRL production are related both topographically and functionally. From previous studies, it is known that decidual PRL release is modulated by steroid and peptide factors. Progesterone is the main hormone required for endometrial decidualization and consequent PRL production, but it acts primarily by inducing stromal cell differentiation rather than by directly stimulating PRL gene expression (Reis et al., 1999). Insulin

PrRP and its receptor in the decidua

and insulin-like growth factor (IGF)-I stimulate PRL release from cultured decidual cells, whereas proinflammatory cytokines like interleukins 1α, 1β and 2, and tumor necrosis factor α inhibit PRL secretion (Ben-Jonathan et al., 1996; Kanda et al., 1999). During the critical period of implantation and early pregnancy, however, PRL production is probably up regulated by the action of some local releasing factor. IGF-I may be a major candidate as such a factor, but its biological activity is modulated by IGF-binding protein-1, whose expression in the endometrium increases with endometrial decidualization and early pregnancy (Julkunen et al., 1990). Thus, the present identification of PrRP and its receptor in decidual cells adds a new candidate for a specific local modulator of decidual PRL. According to the findings of the present study, a physiological role for PrRP and its receptor in the decidua is plausible. PrRP was able to induce PRL release from cultured decidual cells, indicating that a functional interaction between PrRP and its receptor indeed occurs in this cell type. It seems that PrRP is effective at a relatively narrow concentration range, probably ~10–9 mol/l. The fact that higher doses were not effective is not surprising and resembles the tendency for a less intense effect of extremely high concentrations of the peptide on PRL secretion from rat pituitary-derived cells (Hinuma et al., 1998). This phenomenon will probably find explanation in the intrinsic mechanisms of action of PrRP in decidual cells, which should be explored henceforth. Recently, it has been demonstrated that PrRP stimulates pituitary PRL release in rats, both in vitro (Hinuma et al., 1998) and in vivo (Matsumoto et al., 1999b). The intracellular mechanism of this stimulation in pituitary lactotrophs appears to be related to arachidonic acid metabolism via the lipoxygenase pathway, but PrRP can also induce Ca2⫹ influx and partially suppress cyclic AMP production in CHO cells (Hinuma et al., 1998). The mechanisms which control decidual PRL release at the time of endometrial decidualization and early pregnancy may have relevant implications. Decidual PRL may participate in the process of embryo implantation by acting both on the local immune response and in the control of apoptosis (Frasor et al., 1999). During pregnancy, PRL seems to be involved in fetal osmoregulation and amniotic fluid turnover, since pregnancies complicated by polyhydramnios are characterized by decreased intrauterine PRL production and a reduced number of PRL binding sites in fetal membranes (Ben-Jonathan et al., 1996). An incidental finding of the present study was the observation that the human PrRP gene has one intron within the coding region. The structure of the PrRP gene has yet to be characterized, and our observation does not rule out the possibility of splicing variants occuring in different cells and tissues. Since we amplified and sequenced a fragment corresponding to 93% of the coding region of the preprohormone, our data suggest that the decidual PrRP is similar, possibly identical, to brain PrRP. This homology does not necessarily imply that brain and decidual PrRP share functional properties or regulatory mechanisms, and only additional studies will clarify whether such equivalence exists. In conclusion, we have shown that PrRP and its receptor are expressed in human decidua of early pregnancy, and PrRP

stimulates PRL release from decidual stromal cells. Further studies should attempt to determine the physiological and clinical relevance of PrRP in the control of decidual PRL production and in the local decidual response to embryo implantation.

References Bazan, J.F. (1990) Structural design of molecular evolution of a cytokine receptor superfamily. Proc. Natl Acad. Sci. USA, 87, 6934–6938. Ben-Jonathan, N., Mershon, J.L., Allen, D. and Steinmetz, R.W. (1996) Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr. Rev., 17, 639–669. Bole-Feysot, C., Goffin, V., Edery, D., Binart, N. and Kelly, P.A. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr. Rev., 19, 225–268. Chen, C., Dun, S.L., Dun, N.J. and Chang, J.K. (1999) Prolactin-releasing peptide-immunoreactivity in A1 and A2 noradrenergic neurons of the rat medulla. Brain Res., 822, 276–279. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–159. Frasor, J., Gaspar, C.A., Donnelly, K.M., Gibori, G. and Fazleabas, A.T. (1999) Expression of prolactin and its receptor in the baboon uterus during the menstrual cycle and pregnancy. J. Clin. Endocrinol. Metab., 84, 3344–3350. Golander, A., Barrett, J.M., Hurley, T., Barry, S. and Handwerger, S. (1979) Failure of bromocriptine, dopamine, and thyrotropin-releasing hormone to affect prolactin secretion by human decidual tissue in vitro. J. Clin. Endocrinol. Metab., 49, 787–789. Hamaguchi, M., Yamamoto, T. and Sugiyama, Y. (1990) Production of prolactin by cultures of isolated cells from human first trimester decidua. Obstet. Gynecol., 76, 783–787. Hinuma, S., Habata, Y., Fujii, R., Kawamata, Y., Hosoya, M., Fukusumi, S., Kitada, C., Masuo, Y., Asano, T., Matsumoto, H. et al. (1998) A prolactinreleasing peptide in the brain. Nature, 393, 272–276. Hsu, S.M., Raine, L. and Fanger, H. (1981) A comparative study of the peroxidase–antiperoxidase method and an avidin-biotin complex method for studying polypeptide hormones with radioimmunoassay antibodies. Am. J. Clin. Pathol., 75, 734–738. Irwin, J.C., Utian, W.H. and Eckert, R.L. (1991) Sex steroids and growth factors differentially regulate the growth and differentiation of cultured human endometrial stromal cells. Endocrinology, 129, 2385–2392. Julkunen, M., Koistinen, R., Suikkari, A.-M., Seppala, M. and Janne, A.O. (1990) Identification by hybridization histochemistry of human endometrial cells expressing mRNAs encoding a uterine β-lactoglobulin homologue and insulin-like growth factor-binding protein-1. Mol. Endocrinol., 4, 700–707. Kanda, Y., Jikihara. H., Markoff, E. and Handwerger, S. (1999) Interleukin-2 inhibits the synthesis and release of prolactin from human decidual cells. J. Clin. Endocrinol. Metab., 84, 677–681. Maruyama, M., Matsumoto, H., Fujiwara, K., Kitada, C., Hinuma, S., Onda, H., Fujino, M. and Inoue, K. (1999) Immunocytochemical localization of prolactin-releasing peptide in the rat brain. Endocrinology, 140, 2326–2333. Matsumoto, H., Murakami, Y., Horikoshi, Y., Noguchi, J., Habata, Y., Kitada, C., Hinuma, S., Onda, H. and Fujino, M. (1999a) Distribution and characterization of immunoreactive prolactin-releasing peptide (PrRP) in rat tissue and plasma. Biochem. Biophys. Res. Commun., 257, 264–268. Matsumoto, H., Noguchi, J., Horikoshi, Y., Kawamata, Y., Kitada, C., Hinuma, S., Onda, H., Nishimura, O. and Fujino, M. (1999b) Stimulation of prolactin release by prolactin-releasing peptide in rats. Biochem. Biophys. Res. Commun., 259, 321–324. Nieminen, M.L., Brandt, A., Pietila, P. and Panula, P. (2000) Expression of mammalian RF-amide peptides neuropeptide FF (NPFF), prolactin-releasing peptide (PrRP) and the PrRP receptor in the peripheral tissues of the rat. Peptides, 21, 1695–1701. Reis, F.M., Maia, A.L., Ribeiro, M.F.M. and Spritzer, P.M. (1999) Progestin modulation of c-fos and prolactin gene expression in the human endometrium. Fertil. Steril., 71, 1125–1132. Riddick, D.H. and Maslar, I.A. (1981) The transport of prolactin by human fetal membranes. J. Clin. Endocrinol. Metab., 52, 220–224.

361

F.M.Reis et al. Tabanelli, S., Tang, B. and Gurpide, E. (1992) In vitro decidualization of human endometrial stromal cells. J. Steroid Biochem. Mol. Biol., 42, 337–344. Takahashi, K., Yoshinoya, A., Arihara, Z., Murakami, O., Totsune, K., Sone, M., Sasano, H. and Shibahara, S. (2000a) Regional distribution of immunoreactive prolactin-releasing peptide in the human brain. Peptides, 21, 1551–1555. Takahashi, K., Abe, T., Matsumoto, K. and Tomita, M. (2000b) Does prolactin releasing peptide receptor regulate prolactin-secretion in human pituitary adenomas? Neurosci. Lett., 291, 159–162. Tomita, K., Mccashen, J.A., Friesen, H.G. and Tyson, J.E. (1982) Quantitative comparison between biological and immunological activities of prolactin from human fetal and maternal sources. J. Clin. Endocrinol. Metab., 55, 269–271.

362

Tsai, M., Miyamoto, M., Tam, S.Y., Wang, Z.S. and Galli, S.J. (1995) Detection of mouse mast cell-associated protease mRNA. Heparinase treatment greatly improves RT–PCR of tissues containing mast cell heparin. Am. J. Pathol., 6, 335–343. Wu, W.X., Brooks, J., Millar, M.R., Ledger, W.L., Saunders, P.T, Glasier, A.F. and McNeilly, A.S. (1991) Localization of the sites of synthesis and action of prolactin by immunocytochemistry and in-situ hybridization within the human utero-placental unit. J. Mol. Endocrinol., 7, 241–247. Zhang, X., Danila, D.C., Katai, M., Swearingen, B. and Klibanski, A. (1999) Expression of prolactin-releasing peptide and its receptor messenger ribonucleic acid in normal human pituitary and pituitary adenomas. J. Clin. Endocrinol. Metab., 84, 4652–4655. Submitted on May 25, 2001; resubmitted on November 5, 2001; accepted on January 18, 2002