Expression of the Extracellular Domain of the Rat Liver Prolactin

Vol. 268, No. 30, Issue of October 25, pp. 22347-22352, 1993 Printed in U.S.A.

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Expression of the Extracellular Domainof the Rat Liver Prolactin Receptor and Its Interaction with Ovine Prolactin* (Received for publication, February 22, 1993)

Kyle P. Hooper, R. Padmanabhan, and Kurt E.EbnerS From the Department of Biochemistry a n d Molecular Biology, University of Kansas Medical Centec Kansas City, Kansas 66160-7421

The extracellular domainsof a number of membrane-bound receptors have been generated by mutagenesis and expressed in a soluble form in both eukaryotic and prokaryotic systems (14-21). These soluble binding proteins are readily isolated, bind their protein ligands with Kd values comparable to those for the membrane-bound receptor, and are highly suitable for structural andbiological studies. For example, studies with the extracellular domain of the human growth hormone receptor have shown that two molecules of the extracellular domain dimerize upon binding of one molecule of human growth hormone both in solution (22) and in the crystallized complex (23). Receptor dimerization has also been demonstrated with the extracellular domains of both the tumor necrosis factora (24) and epidermal growth factor(15) receptors and may bea general requirement to initiate signal transduction in some systems. In this study,a clone of t h e rat liver PRL’ receptor extracellular domain (PRED) was generated by RNA-based PCR a n d expressed in HeLa cells using a vaccinia virusPT7 hybrid expression system (25). The protein was readily isolated from serum-free culture medium by oPRL affinity chromatography a n d h a sa molecular mass of 38.5 kDa on SDS-PAGE. Purified PRED was very effective i n blocking the oPRL-dependent miProlactin, a polypeptide hormone secreted by the anterior togenesis of Nb2 cells andhas a n ICso in the picomolar range. pituitary, exhibits a multitude of biological activities in a variThe binding of lZ5I-oPRL to immobilized PRED is of high afa cell-surface ety of species and requires initial interaction with finity, and the binding of lZ5I-PRED to immobilized oPRL exreceptor(1).Prolactinreceptorshavebeenclonedandsea Hill coefficient of 1.73. hibited positive cooperativity with quenced from rat (21, mouse (3), rabbit (41, human (5), bovine Analysis by highpressuregelfiltrationchromatography (6),and chicken (7) tissues. The cDNA fort h e rat liver prolactin showed that one oPRL molecule bound to two molecules of the receptor predicted a protein with a 19-amino acid signal seextracellular domain of the rat prolactin receptor. quence, an NH2-terminal 210-amino acid extracellular domain, a 24-amino acid transmembrane domain, and a COOH-termiEXPERIMENTALPROCEDURES nal57-amino acid cytoplasmic domain, for a total of 291 amino Materials-All general laboratory chemicals were obtained from eiacids. Two other forms of the rat prolactin receptor have been ther Fisher or Sigma. oPRL wasobtained from the National Institute of isolated, one from the rat Nb2 cell line that has a total of 393 Diabetes and Digestive and Kidney Diseases. Oligonucleotideswere amino acids( 8 ) and the otherfrom rat ovary and liver that has synthesized by the Biotechnology Support Service (University of Kansas Medical Center) and were based on the cDNA reported by Boutin e t a total of 591 amino acids (9). The differences between these al. receptor forms occur in the COOH-terminal cytoplasmic region.(2). General molecular biology reagents were obtained from either New England BioLabs, Inc. or PromegaBiotec. Plasmid expression The prolactin family of receptors isclosely related to the growth vector pTMl was kindly provided by Dr. Bernard Moss (National Instihormone family of receptors (101, and both belong to a larger tutes of Health). Pierce AminoLink coupling gel was used for the prosuperfamily that includes the cytokine and hematopoietic fam- duction of all affinity matrices. The amino acid sequence of the mature well rat prolactin receptor extracellular domain was analyzed by the proily of receptors (11).The rat liver prolactin receptor is defined and is being subjected to mutational analysis 13) (12, to gram Protean (DNA*),and the conversion of Azao of 1.0 = 0.36 mg/ml was obtained. This conversion and the calculated molecular mass of the determine its interaction with ovine prolactin. core polypeptide (24,544 Da) were used to determine concentrations of the rat prolactin receptor extracellular domain. green monkey kidney CV-1 cells (ATCC CellCulture-African * This work was supported in part by Grant HD18584from the CCL70) weregrown in Dulbecco’smodified Eagle’smedium suppleNational Institutes of Health. The costs of publication of this article were defrayedin part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordancewith 18 The abbreviations used are: PRL, prolactin; oPRL, ovine prolactin; U.S.C. Section 1734 solely to indicate this fact. hGH, human growth hormone;PCR, polymerase chain reaction; PAGE, f To whom correspondence should be addressed: Dept. of Biochemispolyacrylamide gel electrophoresis; PRED, prolactin receptor extraceltry and Molecular Biology, University of Kansas Medical Center, 3901 lular domain; HPLC,high pressure liquid chromatography; SMEM, Rainbow Blvd., Kansas City, KS 66160-7421. Tel.: 913-588-7007; Fax: Joklik’s modifiedminimal essential Eagle’s mediumfor suspension cul913-588-7440. tures; FBS, fetal bovine serum; TBS, Tris-buffered saline.

A clone of the extracellular domain of the rat liver prolactinreceptorwasgenerated by the RNA-based polymerase chain reaction, and the NH,-terminal210 amino acids were expressed in HeLa cells using a vaccinia virus57 hybrid expression system. The protein was isolated from serum-free culture medium directly by chromatography on an ovine prolactin affinity column and yielded -1.5 mg of proteiditer of suspension culture. The extracellular domain of the rat prolactin receptor inhibited the ovine prolactin-dependent mitogenesis of rat lymphomaNb2 cells with anICso of 7.1 PM and bound 12SI-labeled ovine prolactin with Kd of a 1.21 0.19 nM. In contrast, the binding of the *251-labeled extracellular domain to ovine prolactin exhibited positive cooperativity with a Hill coefficient of 1.73. High pressuregelfiltrationchromatographywasused to demonstrate the formation of a complex consisting of one moleculeof ovine prolactin and two molecules of the Comextracellular domainof the rat prolactin receptor. plex formation occurred with human growth hormone, but not with ovine growth hormone, a non-lactogen.

=

22347

22348

Extracellular Domain

of Liver Rat the Prolactin

Receptor

mented with 10% fetal bovine serum. The cells were grown to conflu- centrifuged for 5 min at 1500 rpm in an IEC PR-2 centrifuge. Thecells ency in 25-cm2 flasks t o a final concentration of 3 x lo6 cells/flask in a were resuspended in 25 ml of SMEM containing 2.5% FBS and coin5% COP, 95% air atmosphere in a 37"C incubator. Green monkey kid- fected with a mixture of both vED-B2 and vTF7-3 a t a multiplicity of ney BS-C-1 cells (ATCC CCL26) and human TK- 143B cells (ATCC infection of 2 plaque-forming unitskell. The viruses were allowed to CRL8303) were grown under the same conditions. Human cervical epi- infect the cells for 2 h with shaking at 37 "C. The cells were then thelial carcinoma HeLaS3 cells (ATCC CCL2.2) were grownat 37 "C in transferred to a 50-ml polypropylene centrifuge tube, and SMEM was Joklik's modified minimal essentialEagle's medium for suspension cul- added t o 50 ml. The cells were pelleted at 300 x g for 5 min in an IEC tures (SMEM) supplemented with a mixtureof 3.5% newborncalf and clinical centrifuge. The medium was poured off, and the cells were 3.5% donor calf sera. The cells were subcultured xatlo5 5 cells/ml. Nb2 washed two times with ml 50 of SMEM. The cells were then returned to cells (26) were grown a t 37 "C under 5%CO,,95% air in Fischer's the spinner flask, brought to 500 ml with SMEM, and incubated a t medium for leukemia cellsfrom mice and contained 0.1 mM P-mercapto37 "C for 24 h. The cells were centrifuged at 1500 rpm as described ethanol, 50 unitdm1 penicillin, and 50 pg/ml streptomycin (basal me- before, and the conditioned medium was filtered through a 0.45-pm dium) with 10% FBS and 10% donor horse serum. Thecells were made bottle-top filter. The filtrate was brought to 0.05% NaN3 and 10 mM quiescent by transfer to basal medium containing only 1% FBS and10% MgCl,. donor horse serum (slow-down medium) for 24 h. All assays were perPurification of P R E h O v i n e prolactin was coupled t o AminoLink formed in stationary medium (basal medium supplemented with 10% affinity matrix as described by Pierce ChemicalCo. with 96%efficiency. donor horse serum). The column was equilibrated with m50 M Tris-HC1,pH 7.5,0.05%NaN,. Production of PrePRED cDNA by RNA-based PCR-Total RNA was The conditioned medium was passed over a 0.5 x 30-cm oPRL affinity isolated fromthe liver of a 19-day pregnant Sprague-Dawleyrat by the column (2.3-2.7 mg of oPRL/ml of gel) a t a flow rate of 0.3 mumin.Once all of the conditioned medium had entered the gel, the column was method of Andrews et al. (27).RNA-based PCR was performed essentially by the method of Kawasaki etal. (28). One pg of total RNA was washed with200 ml of 50 mM Tris-HC1, pH 7.5,0.5 M NaC1,0.05% NaN, used as template for cDNA synthesis by reverse transcriptase in the and then with 100 ml of 50 nm Tris-HC1, pH 7.5, 0.05% NaN,. Bound material was eluted with 100 mM glycine, pH 2.8. One-ml fractions were presence of 100 pmol of random hexanucleotides as primers, 200 units collected into polypropylene tubes containing 50p1 of 2 M Tris-HC1, pH of Superscript reverse transcriptase (Life Technologies, Inc.) and 40 units of RNasin (PromegaBiotec) in a total volume of 20 pl. The entire 9.5. The fractions were read at 280 nm. Inhibition of Nb2 Cell Mitogenesis-Assays were performed in tripreverse transcriptase reaction was used for PCR with the addition of 100 ngof the upstream primer KE7(CCATCTGCACTTGCTTTCGTC), licate using 24-well cell culture plates as previously described (35). 100ng of thedownstreamprimer KE2 (GTCCTTCAAGGTGAAGT- Cells were transferred to slow-down medium for 24 h. Quiescent cells CATTTGG), and 5 units of AmpliTaq DNA polymerase (Perkin-Elmer were spun down in sterile50-ml centrifuge tubesa t 300 x g and resuspended in stationary medium. The cells were washed two times by Cetus Instruments) in a 100-pl total reaction volume. Both reactions were performedin 1x AmpliTaq PCR buffer. PCR was performedfor 30 pelleting and resuspension in stationary medium and finally adjusted cycles on a Perkin-ElmerCetusInstruments DNA Thermal Cycler to 1-2 x lo5 cells/ml with stationary medium. For the assay, 900 p1of cells were combined with 100 pl of the test sample. PRED samples (50 using a profile that included denaturation a t 94 "C for 30 s, annealing to 0.39 ng/ml) were prepared with 10 ng/ml oPRL in phosphate-buffered a t 50 "C for 1 min, and DNA synthesis at 72 "C for 1 min. saline, 10 mM MgCl,, and 0.1% bovine serum albumin and filter-sterilSubcloning ofPrePREDcDNA intopTMI-Astop codon was addedto ized. After a n incubation period of 72 h at 37 "C, the samples were the 3'-endof the prePRED cDNA byperforming a second PCR with 1 pl counted manually using a hemocytometer. of the RNA-based PCR product with 100 ng eachof two primers, KE7 High Pressure Gel Filtration Chromatography-In a total volume of and KE6 (GCTTAAGCTA-KE2),using the same profile as described above for 20 cycles. This product wassubcloned into the NcoVSmaI-cut, 200 pl, varying amounts of PRED were incubated with a constant Klenow-filled pTMl vector by blunt-end ligation as described by Sam- amount of oPRL, yielding solutions of 0.5:0.5, 1.0:0.5, and 1.5:0.5 p ~ , brook et al. (29). The insert was sequencedby the method of Sanger et respectively, in TBS containing 10mM MgC1,. The solutions were incual. (30) asmodified by Del Sal et al. (31) to verify the accuracy of the bated for 7 hat ambient room temperature and then passed over a 0.75 x 60-cm TosoHaas G3000SW TSK-Gel column at 0.35 mumin. Elution PCR. mM MgCl,, and monitoring wasat Production ofRecombinant Vaccinia Virus-The prePRED cDNA was was effected with TBS containing 10 220 nm. Protein standards were obtainedfrom Bio-Rad. incorporated into the genome of wild-type vaccinia virus strain WR Iodination of Proteins-One IODO-BEAD (Pierce ChemicalCo.) was (ATCC VR1354) by homologous recombination into the thymidine kicombined with 1 mCi of carrier-free N a ' T (Amersham Corp.) and200 nase gene. Recombinant virus plaques were picked, and the positive ones were identified by DNA hybridization (32). Primary recombinant mM sodium phosphate, pH7.0, in a 1.5-ml microcentrifuge tube.After 5 vaccinia virus isolates encoding PRED and vTF7-3, encoding T7 RNA min, 10 pgof PRED or oPRL were added, bringing the finalvolume to polymerase (ATCC VT2153), were used to coinfect CV-1 cells in 25-cm2 200 pl. Proteinswere iodinated for 5 min, and the reaction mixture was to a flasks a t a napproximate multiplicity of infection of 10 plaque-forming removed from the beads and purified. Proteins were labeledspecific units/cell. The cells were incubated for 3 h a t 37 "C in 2ml of Dulbecco's activity of 30-40 pCiipg. The buffer of affinity-purified PRED was exExcellulose desalting modified Eagle's medium containing 5% FBS after infection. The me- changed for the reaction buffer with a Pierce GF-5 dium was aspirated and replaced with ml 2 of methionine-free Dulbec- column prior to iodination. Free iodine was separated from iodinated co's modified Eagle's medium containing5% dialyzed FBS (Sigma)for 1 oPRL as described (36). The PRED iodination mixture was purified as h to deplete the endogenous methionine. The mediumremoved was and described above for "S-PRED using oPRL affinitychromatography replaced with 1.5 ml of the same medium containing 200 pCi of L3%lme- with a 10-15% recovery. Binding Assays-The bindingassay of '251-oPRL to immobilized thionine (Du Pont-New England Nuclear; 1200 Ciimmol). The labeling of the method of Harris et al. (16). PRED was was allowed t o proceed for 12 h, and then the medium removed was and PRED was a modification coupled to AminoLink affinity matrix as described by Pierce Chemical diluted to 10 ml with TBS (20 mM Tris-HC1, 0.15 M NaC1, pH 7.5) plus 10 mM MgC1,. The diluted sample was passed over a 0.5-ml oPRL Co. A 50:50 suspension of PRED affinity matrix (0.2mg of PRED/ml of gel) in 50 mM Tris-HC1, pH 7.5, 0.05% NaN, was diluted 1:lO into a affinity column (0.91 mg of oPRL/ml of gel) in 4x 2.5-ml aliquots. The buffer. column was washed with 5x 2 ml of TBS. Bound material was eluted 50:50 suspension of Tris-derivatized affinity matrix in the same In 0.5-ml microcentrifuge tubes, 10pl of the 1:lO diluted bead suspenwith 5 x 1 ml of 100 mM glycine, pH 2.8; the fractions werecollected in tubes containing 50 p1 of 2 M Tris-HC1, pH 9.5, and 50 plof TBS, 0.1% sion were combined with 50 plof 50 nm Tris-HC1, pH 7.5.20 mM MgCL bovine serum albumin, 0.05% NaN3. The peak fractions were analyzed 0.1% porcine gelatin, 0.05% NaN, and with various concentrations of 'T-oPRL in 50 pl of the same buffer without MgCl,. For nonspecific by 10% SDS-PAGE (33). The plaque isolate showing the highest expression likely duet o higher input of virus particles wasamplified in HeLa binding, 5 pgof oPRL were included.For each data point,two total and two nonspecific reactions were performed. The binding reaction was cells to prepare vED-B2 virus stocks a s described (32). allowed to proceed for 1h at ambient room temperature and was thorAntisera to PRED-Antisera were generated against the first 13 oughly mixed by repeated pipettingof each tube every 5 min. The tubes NH,-terminal amino acids of PRED (QSPPGKPEIHKCK) in rabbits were centrifuged for 15 min at 14,000 x g a t 4 "C, and the supernatant (34), and the titer as determined by enzyme-linked immunosorbent was removed by pipetting. The beads were washed with 100ofplTBS assay against 1 pg of peptide was 1:15,000. The antisera recognized prolactin receptors on Western blotsof 19-day pregnantrat liver mem- containing 0.1% porcine gelatin and 0.05% NaN3. The tops were cut branes as well as PRED and were most useful in evaluating the effi- from the tubes andcounted in a Packard Cobra Auto-Gamma counter. Nonspecific binding was