Expression Patterns of the Prolactin Receptor Gene in Chicken ...

Expression Patterns of the Prolactin Receptor Gene in Chicken Lymphoid Tissues During Embryogenesis and Posthatch Period Z. Kang,* G. Y. Be´dećarrats,*1 and D. Zadworny† *Department of Animal and Poultry Science, University of Guelph, Guelph, Ontario, Canada, N1G 2W1; and †Department of Animal Science, McGill University, Sainte-Anne-de-Bellevue, Que´bec, Canada, H9X 3V9 ABSTRACT Prolactin (PRL) is a pituitary hormone with multiple homeostatic roles among vertebrates. Although it has mainly been studied in relation to its role during the initiation and maintenance of incubation behavior in avian species, it has also been shown to act on the immune system. In this study, levels of PRL receptor (PRLR) mRNA were quantified by real-time PCR, and tissue expression was localized by in situ hybridization in primary and secondary lymphoid organs. Prolactin receptor was shown to be expressed in the bursa follicles, thymus lob-

ules, and splenic pulp at all stages of development examined. Levels of PRLR expression were consistently higher in the bursa of Fabricius when compared with other lymphoid organs, suggesting that PRL acts primarily on bursal development. Furthermore, levels of PRLR mRNA appeared to fluctuate during embryogenesis, with a significant increase observed at embryonic day 19 in the bursa, at 7 d of age in the thymus, and on hatching day in the spleen. Thus, PRL might play an important role during the development of the immune system in chickens.

Key words: prolactin, prolactin receptor, chicken, embryo, lymphoid organ 2007 Poultry Science 86:2404–2412 doi:10.3382/ps.2007-00235

INTRODUCTION Prolactin (PRL) is a pituitary hormone mainly synthesized in, and secreted by, specialized cells of the anterior pituitary gland (Sinha, 1995). It is involved in more than 300 biological activities ranging from reproduction, growth, and metabolism to behavior and immune responses (Nicoll et al., 1986; Bole-Feysot et al., 1998). In the immune system, PRL can regulate antibody and cellmediated immunity in physiological as well as pathological states (Neidhart, 1998). In avian species, the main documented functions of PRL are the induction and maintenance of incubation behavior (March et al., 1994), the production of crop milk in pigeons (Scanes et al., 1975), and osmoregulation (Doneen and Smith, 1982a,b; Murphy et al., 1986). Moreover, PRL has also been shown to play an important role during embryogenesis. As such, by influencing thyroid hormone secretion, PRL can affect the survival of chicks during hatching (Christensen, 1985). In addition, PRL also controls osmoregulation in avian embryos by stimulating the reabsorption of NaCl from fetal urine by the metanephric kidneys (Doneen and Smith, 1982a,b; Murphy et al., 1986),

©2007 Poultry Science Association Inc. Received June 8, 2007. Accepted July 23, 2007. 1 Corresponding author: [email protected]

most likely by interacting with its specific receptor shown to be expressed in embryonic kidneys, intestines, and allantoic membranes (Yamamoto et al., 2003). During embryogenesis, PRL can be detected in the chicken pituitary gland as early as embryonic day (ED) 6 (Jozsa et al., 1979), and PRL is present in the circulation after ED9 (Harvey et al., 1979). Plasma levels of PRL remain low from ED9 to ED13 then drastically increase from ED19 to the day after hatch (Harvey et al., 1979). In the pituitary gland, concentrations of PRL and PRL mRNA levels were both shown to increase around ED18 to ED19 (Ishida et al., 1991; Kansaku et al., 1994). In the turkey, plasma concentrations of PRL remain low until 3 d before hatch, increase on the day of hatch, decrease the day after hatch, and increase until 7 d of age (Gue´mene´ et al., 2000). Levels of PRL mRNA and protein content inthepituitaryalsomimicplasmaconcentrations(Be´dećarrats et al., 1999). Previous studies have demonstrated that, in chickens, PRL can influence the function of lymphoid tissues, regulate the antibody-mediated immune response, and stimulate multiplication of chicken thymocytes and splenocytes (Bhat et al., 1983; Skwarlo-Sonta, 1990). Although it is expected that PRL acts on lymphoid tissues by binding to its receptor, the presence of PRL receptors (PRLR) in these tissues still remains to be demonstrated, and the reciprocal interdependence between PRL and the avian immune system during embryogenesis still needs to be determined. Thus, in this study, the expression of the

2404

PROLACTIN RECEPTOR IN CHICKEN LYMPHOID ORGANS

PRLR gene was detected and quantified in lymphoid tissues from chickens at different embryonic stages and after hatch.

MATERIALS AND METHODS Birds and Tissue Collection Fertile Barred Rock chicken eggs were artificially incubated at 37.5°C, 85 to 86% humidity, at our poultry research station. Three days before hatch, eggs were transferred to a commercial hatcher and maintained at 36.9°C in 90 to 92% humidity. After hatch, chicks were maintained in brooding pens and were fed a standard starter diet. Chicken lymphoid tissues (spleen, bursa, and thymus) were collected from embryos (n = 5/stage) at ED8, 10, 12, 14, 16, 18, 19, and 20, as well as on hatching day, and from chicks at 1, 7, and 14 d of age. Due to the small size of thymus, individual organs could not be isolated before ED14. All embryos and chicks were euthanized before organ collection, and all procedures were approved by the University of Guelph Animal Care Committee.

RNA Extraction and Reverse Transcription Total RNA was extracted from individual tissue samples using Trizol reagent (Gibco BRL Products, Life Technologies, Burlington, Ontario, Canada) according to the protocol of the manufacturer. Ribonucleic acid pellets were then dissolved in 20 ␮L of diethyl pyrocarbonatetreated water, digested with DNaseI (Invitrogen Canada Inc., Burlington, Canada) to remove any genomic DNA contaminants, and concentration was estimated by spectrophotometry at a 260-nm wavelength. Reverse transcription was performed on 3 ␮g of total RNA using Oligo(dT) primers and SuperScrip II RNase H− reverse transcriptase (Invitrogen Canada Inc.) according to the instructions of the manufacturer. For real-time PCR, after reverse transcription, RNA templates were degraded with 2 units of RNase H (Invitrogen Canada Inc.) for 20 min at 37°C. Due to the small size of organs collected from ED8 to ED14, RNA for these time points was extracted on pooled tissue samples from bursas and spleens.

Primers Primers specific for chicken PRLR cDNA were designed to amplify a 429-bp fragment and correspond to sequences located in exons 5 and 8 of the PRLR gene (accession number NM_204854). Forward: 5′TACAACATTACTGTCAGGGCAACTA Reverse: 5′AACGATCCACACAATCATATCTTTT

Standard PCR Standard reverse transcription PCR assays carried out in this study were performed using a PTC-200 thermocycler (MJ Research Inc., Waltham, MA) with 2.5 ␮L of

2405

cDNA and 20 pmol of each primer. The PCR conditions corresponded to an initial denaturation at 94°C for 5 min followed by a 40-cycle amplification (denaturation at 94°C for 1 min, annealing at 55°C for 45 s, and elongation at 72°C for 1 min) and a final extension at 72°C for 7 min.

Absolute Quantification Using Real-Time PCR To generate standard curves, a reference plasmid was constructed by ligating purified PCR product obtained by standard PCR (see above) into a PCR4-TOPO plasmid (Invitrogen Canada Inc.). Purified plasmid was then linearized with NotI, and 7 serial dilutions ranging from 1.3236356 105 to 1.3236356 102 molecules/␮L were prepared. The copy number of standard plasmid molecules was initially calculated using the following formula: Y (molecules/␮L) = {plasmid concentration (g/␮L)/[plasmid length (bp) × 660]} × 6.022 × 1023. After PCR, a standard curve was generated by plotting the log of initial copy number of standard (X) vs. the calculated cycle threshold value (Y). Amount of target in unknown samples was then calculated using the equation derived from the standard curve. To ensure the uniformity between amplifications, real-time PCR efficiency was also calculated from the standard curve. A reference sample (pooled cDNA sample) was also included in every assay plate to calculate the interassay CV. All real-time PCR reactions were carried out in a ABI PRISM 7000 (Applied Biosystems, Foster City, CA) using the QuantiTect SYBR Green PCR system (Qiagen Inc. Canada, Mississauga, Ontario, Canada). Briefly, 25-␮L reactions containing 2.5 ␮L of cDNA template and 12.5 ␮L of SYBR Green mix were initially incubated at 50°C for 2 min and denaturated at 95°C for 15 min to activate the DNA polymerase. Amplification was then performed for 50 cycles (denaturation at 95°C for 15 s, annealing at 60°C for 45 s, and extension at 72°C for 30 s). Specificity of the amplifications was determined by melting curve analysis (60°C for 15 s to 95°C in 0.1°C/s increments) and by gel electrophoresis.

In Situ Hybridization Probe Synthesis. The plasmid encoding the 429-bp PRLR fragment used as standard for the real-time PCR (PCR4-TOPO plasmid; Invitrogen Canada Inc.) was chosen as a template to generate sense and antisense riboprobes. The antisense riboprobe corresponding to the complementary DNA strand was synthesized with T3 RNA polymerase on plasmid DNA linearized with NotI, whereas the sense probe was generated using T7 polymerase on plasmid DNA linearized with PmeI. Newly synthesized riboprobes were then labeled with a digoxigenin labeling system (Roche Diagnostics Canada, Laval, Quebec, Canada) according to the instructions of the manufacturer. To prepare sections for in situ hybridization, lymphoid tissues collected from embryos and chicks at different

2406

KANG ET AL.

stage of development were fixed overnight with rotation in 4% paraformaldehyde in PBS (pH 7.4) at 4°C. Fixed tissues were rinsed in PBS, transferred to a 30% sucrose solution (pH 7.4) in PBS, and rotated overnight at 4°C. Tissues were then transferred into a Cryomatrix solution (Thermo Fisher Scientific Inc., Waltham, MA) and rotated overnight at 4°C. Finally, tissues were embedded in fresh Cryomatrix in a dry-ice-ethanol bath, and frozen blocks were stored at −80°C. For tissue sectioning, blocks previously equilibrated at −20°C were sliced into 12-␮m sections using a Cryostat Leica CM3050S (Leica Microsystems Canada Inc., Richmond Hill, Ontario, Canada), and sections were mounted on Superfrost Plus slides (Fisher Scientific Company, Ottawa, Ontario, Canada). In situ hybridization was performed as previously described by Shen (2001). All images were taken using brightfield microscopy (Nikon Type 108, Nikon Canada, Mississauga, Ontario, Canada) equipped with a digital camera (Q Imaging QICAM).

Statistical Analysis Levels of PRLR mRNA in lymphoid tissues were expressed as copy number per microgram of total RNA, and values were compared by 1-way ANOVA (P < 0.05) followed by a Tukey posthoc test (P < 0.05).

RESULTS Validation of the Real-Time PCR Quantification Assay Melting curve analysis and agarose gel electrophoresis revealed that real-time PCR amplification resulted in a single amplicon with a melting temperature of 79.7°C. Based on the 5 assays used for this study, the average PCR efficiency derived from standard curves was 95 ± 5%, whereas the interassay CV calculated from values obtained for the pool sample was 20%.

Levels of PRLR mRNA Fluctuate During Development Changes in PRLR mRNA levels in lymphoid tissues are shown in Figure 1. In the bursa of Fabricius (Figure 1, panel A), PRLR mRNA was detected as early as ED8. However, because RNA was extracted on pooled samples from ED8 to ED14, statistical analysis could only be performed on later development stages. Nonetheless, levels of mRNA appeared to be stable until ED18, significantly increased on ED19 (P < 0.05), then significantly decreased back to lower levels on ED20 (P < 0.05). Subsequently, levels progressively increased until 7 d posthatch, and thereafter, mRNA levels significantly decreased (P < 0.05). As observed in the bursa, levels of PRLR mRNA also changed in the thymus during development (Figure 1, panel B). Interestingly, levels were about 10-fold lower than in bursas. Due to their small size, we were unable to isolate individual thymus before ED14. However, mea-

sured levels of mRNA remained low and fairly constant from ED14 to ED20, significantly increased by 7 d of age (P < 0.05), and decreased thereafter. The lowest overall levels of PRLR mRNA were observed in the spleen (Figure 1, panel C). Due to the size of the organs, RNA was extracted from pooled samples from ED8 to ED14. Levels of mRNA remained low from ED10 to ED18, slightly increased at ED19, and significantly increased on hatching day (P < 0.05). Levels then significantly (P < 0.05) dropped the day after hatch.

Localization of PRLR mRNA by In Situ Hybridization In situ hybridization further confirmed the expression of the PRLR gene in lymphoid tissues. The specificity of hybridization signals obtained with the antisense probe was verified by the absence of signals on the sections hybridized with the sense probe. As shown in Figure 2 and 3, the PRLR gene is expressed mainly in bursa follicles, thymus lobules, and throughout the splenic pulp. In the bursa, PRLR mRNA signal could be seen in scattered cells of the anlage as early as ED8 (data not shown). By ED10 to ED14, the bursa lumen enlarges, and longitudinal folds (primary plicae) form from the inner surface. During that phase, specific signal was observed on the surface of plicae, with PRLR mRNA being more abundant in the surface epithelium cells (Figure 2, panels A and B). Toward ED16, the primitive epithelium thickens, and buds project into the tunica propria to gradually form lymphoid follicles. At that stage, PRLR mRNA signal appeared to be stronger within forming follicles (Figure 2, panels D and E). After ED18, the bursa is populated with numerous lymphoid follicles, and a strong signal could be observed in and around maturing follicles (Figure 2, panels I and J). At later stages, a positive signal was found mainly within follicles (data not shown). Because of their small size, we were unable to obtain thymus before ED16. However, at later stages of embryonic development and after hatch, mRNA encoding PRLR was mainly observed in forming lobulation (Figure 3, panels A and B). In the spleen, PRLR mRNA appeared to be diffused throughout the pulp at all stages examined (Figure 3, panels D and E).

DISCUSSION In chickens, PRL has been shown to possess a mitogenic effect on the bursa in vivo (Bhat et al., 1983), on thymocytes and splenocytes in vitro (Skwarlo-Sonta, 1990), and to play a stimulatory role upon T-cell maturation (Moreno et al., 1994) and thymus development (Herradoń et al., 1991). However, although Di Carlo et al. (1996) reported that PRL binding sites could be observed in the bursa after hatch, the expression of the PRLR gene in organs and cells from the immune system has so far not been reported. Conversely, in humans, PRLR was shown to be present in hematopoietic and lymphoblastoid cells (Russell et al., 1985), and PRLR mRNA was detected in thymo-


2407

Figure 1. Levels of prolactin receptor (PRLR) mRNA in chicken lymphoid tissues during development. Levels of mRNA were quantified by real-time PCR, and results are expressed as number of molecules per microgram of total RNA. The x-axis corresponds to developmental stages with hatching day being D0. Each time point corresponds to 5 separate individuals assayed in duplicate, except for bursas from embryonic day (ED) 8 to ED14, spleens from ED8 to ED16, and thymus at ED14, which were assayed in duplicate on a single pooled sample. Data points correspond to the mean ± SEM. Panel A corresponds to levels of PRLR mRNA in the bursa of Fabricius. Levels at ED19 were significantly higher than at surrounding days (P < 0.05). Panel B corresponds to levels of PRLR mRNA in the thymus. Levels at D7 were significantly higher than from ED18 to ED20 (P < 0.05). Panel C corresponds to levels of PRLR mRNA in the spleen. Levels on D0 were significantly higher than that at ED20 and D1 (P < 0.05).

2408

KANG ET AL.

Figure 2. Prolactin receptor mRNA in developing follicles in the chicken bursa. At embryonic day (ED) 12 (panels A, B, and C) and ED14 (panels D, E, and F), bursa follicles are not formed, and epithelial cells from the plicae (pl) proliferate to form a reticulum (rt). Bursa lumen (lm) can also be identified between forming follicles. Panels A and D correspond to hybridization performed with the antisense probe, whereas panels C and F correspond to an adjacent section hybridized with the sense probe (negative control). The boxed areas in panel A and D approximate the regions shown in panel B and E, respectively. Scale bars correspond to 450 ␮m (A, C, D, and F) and 150 ␮m (B and E). Arrows point at positive cells located in the plicae. At ED16 (panels G, H, and I), the sites of lymphoid follicle (f) formation are established. Panel G corresponds to hybridization performed with the antisense probe, whereas panel I corresponds to an adjacent section hybridized with the sense probe (negative control). The boxed area in panel G approximates the region shown in panel H. Scale bars correspond to 900 ␮m (G and I) and 150 ␮m (H). Arrows point at the plicae and forming follicles where positive cells can be observed. At ED19 (panels J, K, and L), follicles (f) are clearly identifiable and are surrounded by the tunica propria (tp). Panel J corresponds to hybridization performed with the antisense probe, whereas panel L corresponds to an adjacent section hybridized with the sense probe (negative control). The boxed area in panel J corresponds to the region shown in panel K. Scale bars correspond to 900 ␮m (panels J and L) and 150 ␮m (panel K). Arrows point at follicles that display a strong distinct signal.


2409

Figure 3. Prolactin receptor mRNA distribution in the chicken spleen and thymus. Panels A, B, and C correspond to hybridizations performed on sections from a thymus at embryonic day (ED) 19, whereas panels D, E, and F correspond to hybridizations performed on sections from a spleen at ED19. On panels C and F, tissue slices were hybridized with the sense probe and serve as negative control. The boxed areas in A and D correspond to the region shown in B and E, respectively. A weak positive signal can be observed diffused throughout thymus lobules (lb; panels A and B) and throughout the splenic pulp (panels D and E). Scale bars correspond to 450 ␮m (panels A, C, D, and F) and 150 ␮m (panels B and E).

cytes (Pellegrini et al., 1992) as well as in rat Nb2 cells and concanavalin A-stimulated T cells from mice thymus and spleen (O’Neal et al., 1991). Our results indicate that as observed in mammals, PRLR mRNA is also present in chicken lymphoid tissues at all stages of development examined. Interestingly, levels of PRLR mRNA were higher in the bursa of Fabricius than other lymphoid tissues. Comparable observations have previously been reported in mammals with PRLR gene expression levels and PRLR density higher in B cells than T cells in lymphoid organs and peripheral blood (Dardenne et al., 1994; Leite De Moraes et al., 1995). In mice, PRLR density also appears to be lower on thymocytes than on bone marrow cells (Gagnerault et al., 1993), and the majority of peripheral lymphocytes expressing PRLR are B cells (Gunes and Mastro, 1997). Absolute quantification using real-time PCR revealed that levels of mRNA fluctuate during embryonic development, and in the bursa, a significant increase could be observed at ED19. After the initial stem cell migration into the bursa, lymphocyte precursors undergo differentiation from ED11 to ED18. This stage is characterized by the creation of a diversified immunoglobulin repertoire by gene conversion, and by ED19, this process is virtually

complete (Ratcliffe et al., 1986; McCormack et al., 1989a,b; Masteller and Thompson, 1994). In addition to cell differentiation, this stage also corresponds to the development of the cortex in bursal follicles (Ackerman and Knouff, 1959; Reynolds, 1987; Paramithiotis and Ratcliffe, 1994; Otsubo et al., 2001), with cortical lymphocytes being more densely packed and more rapidly dividing than medullary ones (Pink et al., 1985; Reynolds, 1987). Because our in situ hybridization study shows specific expression in and around forming follicles, and because circulating PRL and pituitary PRL mRNA levels were reported to significantly increase at ED19 in the chicken (Ishida et al., 1991; Leclerc et al., 2007), it is likely that PRL plays an important role during that critical stage of bursal development. After hatch, PRLR mRNA levels increased until 7 d of age then decreased by 14 d of age. Newly hatched chicks have a higher risk of infection by opportunistic pathogens. Thereafter, the immune system of young birds becomes more mature and is constantly challenged to protect from infections. It is thus possible that the increase in PRLR expression levels observed from hatching day until 7 d of age corresponds to a needed increased effect of PRL on immune defense during the first week of life. It is also worth mentioning that starting at hatch, mature B cells

2410

KANG ET AL.

progressively emigrate from the bursa to peripheral organs (Cooper et al., 1969; Paramithiotis and Ratcliffe, 1993), and the lower PRLR mRNA levels observed in the bursa at 2 wk of age are concomitant with the decrease in progenitors present in that organ (Funk and Thompson, 1996). Several studies have shown that PRLR is expressed in the thymus of mammals (Freemark et al., 1995; Royster et al., 1995; Tzeng and Linzer, 1997), and proliferation of thymic lymphocytes in response to cytokines such as interleukin (IL) 2 can be prevented by antisera raised against PRL or PRLR (Hartmann et al., 1989; Clevenger et al., 1990; Gala, 1991). Because the percentage of T lymphocytes increases after PRL stimulation (Viselli et al., 1991), it is likely that PRL regulates their proliferation directly and indirectly via cytokines. Similarly in the chicken, PRL plays an important role in the early maturation of thymocytes (Pierpaoli et al., 1976; Hooghe et al., 1993), and injection of recombinant PRL into an allantoic vein into turkey eggs at ED21 results in a significant increase in lymphocytes (Be´dećarrats et al., 2000). In addition, decapitation of ED2 embryos in chickens results in abrogation of T-cell maturation, an effect which was reversed by the injection of recombinant PRL or grafting of embryonic pituitary gland onto the chorioallantoic membrane (Moreno et al., 1998). This effect is likely mediated through IL2 and its receptor, because antibodies directed against PRL, IL2, or IL2R significantly inhibited Tcell development (Carreno et al., 2005). Our results clearly show that PRLR is expressed early during thymic development and further suggest PRL may play an important role in T-cell differentiation, thymus development, or both, during early ontogeny. Levels of PRLR mRNA in the thymus remained low until hatch then significantly increased during the first week of age. These changes might be related to lymphocyte migration, because the chicken thymus is also a peripheral lymphoid organ, and B cells emigrate from bursa after hatch (Woods and Linna, 1965; Jotereau et al., 1980). It is pertinent to note that development of the immune system in PRL or PRLR null mice is apparently normal (Horseman et al., 1997; Bouchard et al., 1999). However, this may be due to redundancy within the growth hormone-PRL signal transduction axis, because circulating levels of PRL are elevated more than 30-fold in PRLR knockout mice (Binart et al., 2000), and the increased levels of PRL may be signaling through alternative pathways. As for primary lymphoid organs, in rodents, PRLR has been shown to be expressed in secondary organs such as the spleen (Gagnerault et al., 1993; Gunes and Mastro, 1997). Although we also detected PRLR mRNA in avian spleens, levels were extremely low when compared with primary lymphoid organs (bursa and thymus). Nonetheless, during embryonic development, levels appeared to be higher at ED8, decrease and remain low until ED18, then peaked around hatching day. These changes may be related to the movement of lymphocytes in and out of this organ as B cell progenitors start immigrating to the bursa from the spleen at around ED8 (Houssaint et

al., 1976) and mature B cells begin emigrating from the bursa to peripheral organs (including the spleen) around hatching time (Cooper et al., 1969; Paramithiotis and Ratcliffe, 1993). Because the overall increases in PRLR mRNA levels in lymphoid organs (especially the bursa) appear to be concomitant with an increase in circulating PRL levels (Ishida et al., 1991), it is also possible that PRL may upregulate the expression of its own receptor. However, because no change in PRLR mRNA was observed in the kidney, intestine, and allantoic membrane around that time (Yamamoto et al., 2003), any effect of PRL on the gene expression of its own receptor is likely dependent on tissue-specific transcription factors. In summary, this study is the first to demonstrate that the PRLR gene is expressed in the chicken immune system during embryogenesis, mainly in bursa follicles, thymus lobules, and throughout splenic pulp. Furthermore, mRNA levels fluctuate during the development and significantly differ between tissues. These results lead us to suggest that PRL may be involved in the movement of B-cell precursors in and out of the bursa and in B- and T-cell proliferation and maturation, supporting the observation that in ovo injection of recombinant PRL increases the percentage of lymphocytes at 14 d of age in turkeys (Be´dećarrats et al., 2000).

ACKNOWLEDGMENTS This research was in part supported by the Poultry Industry Council (GYB), the Natural Sciences and Engineering Research Council of Canada (CRDPJ 298383-03, GYB), and the Ontario Ministry of Agriculture Food and Rural Affairs (project 025958, GYB).

REFERENCES Ackerman, G. A., and R. A. Knouff. 1959. Lymphocytopoiesis in the bursa of Fabricius. Am. J. Anat. 104:163–205. Be´dećarrats, G., D. Gue´mene´, U. Ku¨hnlein, and D. Zadworny. 1999. Quantification of prolactin messenger ribonucleic acid, pituitary content and plasma levels of prolactin, and detection of immunoreactive isoforms of prolactin in pituitaries from turkey embryos during ontogeny. Biol. Reprod. 61:757–763. Be´dećarrats, G., D. Gue´mene´, and D. Zadworny. 2000. Physiological and morphological post-hatch effects of in ovo injection of recombinant turkey prolactin in turkeys. Br. Poult. Sci. 41:S37–S38. Bhat, G., S. K. Gupta, and B. R. Maiti. 1983. Influence of prolactin on mitotic activity of the bursa of Fabricius of the chick. Gen. Comp. Endocrinol. 52:452–455. Binart, N., C. Helloco, C. J. Ormandy, J. Barra, P. ClementLacroix, N. Baran, and P. A. Kelly. 2000. Rescue of preimplantatory egg development and embryo implantation in prolactin receptor-deficient mice after progesterone administration. Endocrinology 141:2691–2697. Bole-Feysot, C., V. Goffin, M. Edery, N. Binart, and P. A. Kelly. 1998. Prolactin (PRL) and its receptor: Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr. Rev. 19:225–268. Bouchard, B., C. J. Ormandy, J. P. Di Santo, and P. A. Kelly. 1999. Immune system development and function in prolactin receptor-deficient mice. J. Immunol. 163:576–582.

PROLACTIN RECEPTOR IN CHICKEN LYMPHOID ORGANS Carreno, P. C., R. Sacedon, E. Jimenez, A. Vicente, and A. G. Zapata. 2005. Prolactin affects both survival and differentiation of T-cell progenitors. J. Neuroimmunol. 160:135–145. Christensen, V. L. 1985. Supplemental thyroid hormones and hatchability of turkey eggs. Poult. Sci. 64:2202–2210. Clevenger, C. V., D. H. Russell, P. M. Appasamy, and M. D. Prystowsky. 1990. Regulation of interleukin 2-driven T-lymphocyte proliferation by prolactin. Proc. Natl. Acad. Sci. USA 87:6460–6464. Cooper, M. D., W. A. Cain, P. J. Van Alten, and R. A. Good. 1969. Development and function of the immunoglobulin producing system. I. Effect of bursectomy at different stages of development on germinal centers, plasma cells, immunoglobulins and antibody production. Int. Arch. Allergy Appl. Immunol. 35:242–252. Dardenne, M., C. DeMoraes Mdo, P. A. Kelly, and M. C. Gagnerault. 1994. Prolactin receptor expression in human hematopoietic tissues analyzed by flow cytofluorometry. Endocrinology 134:2108–2114. Di Carlo, R., R. Meli, S. Florio, G. Mattace Raso, O. Gualillo, and G. Pagnini. 1996. The effect of age and sex on the expression of prolactin binding activity in the chicken bursa of Fabricius. Life Sci. 59:1803–1808. Doneen, B. A., and T. E. Smith. 1982a. Ontogeny of endocrine control of osmoregulation in chick embryo. I. Role of pituitary gland in distribution of water and ions among embryonic and extraembryonic compartments. Gen. Comp. Endocrinol. 48:300–309. Doneen, B. A., and T. E. Smith. 1982b. Ontogeny of endocrine control of osmoregulation in chick embryo. II. Actions of prolactin, arginine vasopressin, and aldosterone. Gen. Comp. Endocrinol. 48:310–318. Freemark, M., M. Nagano, M. Edery, and P. A. Kelly. 1995. Prolactin receptor gene expression in the fetal rat. J. Endocrinol. 144:285–292. Funk, P. E., and C. B. Thompson. 1996. Current concepts in chicken B cell development. Curr. Top. Microbiol. Immunol. 212:17–28. Gagnerault, M. C., P. Touraine, W. Savino, P. A. Kelly, and M. Dardenne. 1993. Expression of prolactin receptors in murine lymphoid cells in normal and autoimmune situations. J. Immunol. 150:5673–5681. Gala, R. R. 1991. Prolactin and growth hormone in the regulation of the immune system. Proc. Soc. Exp. Biol. Med. 198:513–527. Gue´mene´, D., G. Be´dećarrats, M. Garreau-Mills, and D. Zadworny. 2000. Ontogeny of prolactin and GH secretions in turkey embryos. Br. Poult. Sci. 41:S34–S35. Gunes, H., and A. M. Mastro. 1997. Prolactin receptor gene expression in rat splenocytes and thymocytes during oestrous cycle, pregnancy and lactation. Cell Prolif. 30:219–235. Hartmann, D. P., J. W. Holaday, and E. W. Bernton. 1989. Inhibition of lymphocyte proliferation by antibodies to prolactin. FASEB J. 3:2194–2202. Harvey, S., T. F. Davison, and A. Chadwick. 1979. Ontogeny of growth hormone and prolactin secretion in the domestic fowl (Gallus domesticus). Gen. Comp. Endocrinol. 39:270–273. Herradoń, P. G., B. Razquin, and A. G. Zapata. 1991. Effects of early partial decapitation on the ontogenic development of chicken lymphoid organs. I. Thymus. Am. J. Anat. 191:57–66. Hooghe, R., M. Delhase, P. Vergani, A. Malur, and E. L. HooghePeters. 1993. Growth hormone and prolactin are paracrine growth and differentiation factors in the haemopoietic system. Immunol. Today 14:212–214. Horseman, N. D., W. Zhao, E. Montecino-Rodriguez, M. Tanaka, K. Nakashima, S. J. Engle, F. Smith, E. Markoff, and K. Dorshkind. 1997. Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO J. 16:6926–6935. Houssaint, E., M. Belo, and N. M. LeDouarin. 1976. Investigations on cell lineage and tissue interactions in the developing

2411

bursa of Fabricius through interspecific chimeras. Dev. Biol. 53:250–264. Ishida, H., K. Shimada, K. Sato, H. Seo, Y. Murata, N. Matsui, and D. Zadworny. 1991. Developmental expression of the prolactin gene in the chicken. Gen. Comp. Endocrinol. 83:463–467. Jotereau, F. V., E. Houssaint, and N. M. LeDouarin. 1980. Lymphoid stem cell homing to the early thymic primordium of the avian embryo. Eur. J. Immunol. 10:620–627. Jozsa, R., C. G. Scanes, S. Vigh, and B. Mess. 1979. Functional differentiation of the embryonic chicken pituitary gland studied by immunohistological approach. Gen. Comp. Endocrinol. 39:158–163. Kansaku, N., K. Shimada, O. Terada, and N. Saito. 1994. Prolactin, growth hormone, and luteinizing hormone-β subunit gene expression in the cephalic and caudal lobes of the anterior pituitary gland during embryogenesis and different reproductive stages in the chicken. Gen. Comp. Endocrinol. 96:197–205. Leclerc, B., D. Zadworny, G. Be´dećarrats, and U. Ku¨hnlein. 2007. Ontogenesis of the expression of prolactin receptor messenger ribonucleic acid during late embryogenesis in turkeys and chickens. Poult. Sci. 86:1174–1179. Leite De Moraes, M. C., P. Touraine, M. C. Gagnerault, W. Savino, P. A. Kelly, and M. Dardenne. 1995. Prolactin receptors and the immune system. Ann. Endocrinol. (Paris) 56:567–570. March, J. B., P. J. Sharp, P. W. Wilson, and H. M. Sang. 1994. Effect of active immunization against recombinant-derived chicken prolactin fusion protein on the onset of broodiness and photoinduced egg laying in bantam hens. J. Reprod. Fertil. 101:227–233. Masteller, E. L., and C. B. Thompson. 1994. B cell development in the chicken. Poult. Sci. 73:998–1011. McCormack, W. T., L. W. Tjoelker, C. F. Barth, L. M. Carlson, B. Petryniak, E. H. Humphries, and C. B. Thompson. 1989a. Selection for B cells with productive IgL gene rearrangements occurs in the bursa of Fabricius during chicken embryonic development. Genes Dev. 3:838–347. McCormack, W. T., L. W. Tjoelker, L. M. Carlson, B. Petryniak, C. F. Barth, E. H. Humphries, and C. B. Thompson. 1989b. Chicken IgL gene rearrangement involves deletion of a circular episome and addition of single nonrandom nucleotides to both coding segments. Cell 56:785–791. Moreno, J., A. Varas, A. Vicente, and A. G. Zapata. 1998. Role of prolactin in the recovered T-cell development of early partially decapitated chicken embryo. Dev. Immunol. 5:183–195. Moreno, J., A. Vicente, I. Heijnen, and A. G. Zapata. 1994. Prolactin and early T-cell development in embryonic chicken. Immunol. Today 15:524–526. Murphy, M. J., P. S. Brown, and S. C. Brown. 1986. Osmoregulatory effects of prolactin and growth hormone in embryonic chicks. Gen. Comp. Endocrinol. 62:485–492. Neidhart, M. 1998. Prolactin in autoimmune diseases. Proc. Soc. Exp. Biol. Med. 217:408–419. Nicoll, C. S., G. L. Mayer, and S. M. Russell. 1986. Structural features of prolactins and growth hormones that can be related to their biological properties. Endocr. Rev. 7:169–203. O’Neal, K. D., L. A. Schwarz, and L. Y. Yu-Lee. 1991. Prolactin receptor gene expression in lymphoid cells. Mol. Cell. Endocrinol. 82:127–135. Otsubo, Y., N. Chen, E. Kajiwara, H. Horiuchi, H. Matsuda, and S. Furusawa. 2001. Role of bursin in the development of B lymphocytes in chicken embryonic bursa of Fabricius. Dev. Comp. Immunol. 25:485–493. Paramithiotis, E., and M. J. Ratcliffe. 1993. Bursa-dependent subpopulations of peripheral B lymphocytes in chicken blood. Eur. J. Immunol. 23:96–102. Paramithiotis, E., and M. J. Ratcliffe. 1994. Survivors of bursal B cell production and emigration. Poult. Sci. 73:991–997.

2412

KANG ET AL.

Pellegrini, I., J. Lebrun, S. Ali, and P. A. Kelly. 1992. Expression of prolactin and its receptor in human lymphoid cells. Mol. Endocrinol. 6:1023–1031. Pierpaoli, W., H. G. Kopp, and E. Bianchi. 1976. Interdependence of thymic and neuroendocrine functions in ontogeny. Clin. Exp. Immunol. 24:501–506. Pink, J. R., M. J. Ratcliffe, and O. Vainio. 1985. Immunoglobulinbearing stem cells for clones of B (bursa-derived) lymphocytes. Eur. J. Immunol. 15:617–620. Ratcliffe, M. J., O. Lassila, J. R. Pink, and O. Vainio. 1986. Avian B cell precursors: Surface immunoglobulin expression is an early, possibly bursa-independent event. Eur. J. Immunol. 16:129–133. Reynolds, J. D. 1987. Mitotic rate maturation in the Peyer’s patches of fetal sheep and in the bursa of Fabricius of the chick embryo. Eur. J. Immunol. 17:503–507. Royster, M., P. Driscoll, P. A. Kelly, and M. Freemark. 1995. The prolactin receptor in the fetal rat: Cellular localization of messenger ribonucleic acid, immunoreactive protein, and ligand-binding activity and induction of expression in late gestation. Endocrinology 136:3892–3900. Russell, D. H., R. Kibler, L. Matrisian, D. F. Larson, B. Poulos, and B. E. Magun. 1985. Prolactin receptors on human T and

B lymphocytes: Antagonism of prolactin binding by cyclosporine. J. Immunol. 134:3027–3031. Scanes, C. G., N. J. Bolton, and A. Chadwick. 1975. Purification and properties of an avian prolactin. Gen. Comp. Endocrinol. 27:371–379. Shen, M. M. 2001. Identification of differentially expressed genes in mouse development using differential display and in situ hybridization. Methods 24:15–27. Sinha, Y. N. 1995. Structural variants of prolactin: Occurrence and physiological significance. Endocr. Rev. 16:354–369. Skwarlo-Sonta, K. 1990. Mitogenic effect of prolactin on chicken lymphocytes in vitro. Immunol. Lett. 24:171–178. Tzeng, S. J., and D. I. Linzer. 1997. Prolactin receptor expression in the developing mouse embryo. Mol. Reprod. Dev. 48:45–52. Viselli, S. M., E. M. Stanek, P. Mukherjee, W. C. Hymer, and A. M. Mastro. 1991. Prolactin-induced mitogenesis of lymphocytes from ovariectomized rats. Endocrinology 129:983–990. Woods, R., and J. Linna. 1965. The transport of cells from the bursa of Fabricius to the spleen and the thymus. Acta Pathol. Microbiol. Scand. 64:470–476. Yamamoto, I., M. Wakita, and M. Tanaka. 2003. Tissue distribution of prolactin receptor mRNA during late stage embryogenesis of the chick. Poult. Sci. 82:155–157.