Expression, purification, and characterization of the ...

Protein Expression and Purification 143 (2018) 57–61

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Expression, purification, and characterization of the TRIM49 protein Dimitrius Santiago Guimarães, Marcelo Damário Gomes

T

∗

Department of Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, Brazil

A B S T R A C T Autophagy is the process of degradation of intracellular proteins through the lysosome. Members of the tripartite motif (TRIM) proteins have shown to directly recognize autophagic cargo and also to act as a hub for the phagophore nucleation complex. The TRIM proteins are classically characterized by the presence of an aminoterminal RING domain and a B-box domain followed by a coiled coil domain. Although regarded as ubiquitin E3 ligases, this activity has been shown only for a minor set of the 79 human TRIM proteins. Additionally, the role of each domain in the E3 ligase activity is unknown. We investigated the role of the SPRY and RING domains of the human TRIM49 protein in its E3 ubiquitin ligase activity. Wild-type and mutant constructs of tagged TRIM49 were expressed in E. coli or mammalian cells, and the autoubiquitination activity of the purified protein was assessed. The purified TRIM49 showed no ubiquitin E3 ligase activity in vitro. However, cells transfected with the wild-type or mutant protein showed increased levels of lower mass polyubiquitinated proteins and both proteins copurified with polyubiquitinated proteins. Taken together, these results indicate that the TRIM49 protein plays a role in autophagic protein degradation independently of an ubiquitin E3 ligase activity.

1. Introduction Cell's ability to adapt to biotic and abiotic stresses is supported by the capacity of changing its macromolecular composition in response to environmental changes through synthesis and degradation of cellular structures. Two major systems are responsible for intracellular protein degradation: the ubiquitin-proteasome system (UPS) and the endosomelysosome pathway [15]. Proteins degraded by the UPS are targeted to the proteasome by covalent attachment of ubiquitin, a small and highly conserved protein in eukaryotes. The isopeptide bond between the ubiquitin carboxy-terminal glycine residue and an amino group in the targeted protein, or in a previously bound ubiquitin, is catalyzed by a cascade of three proteins acting in sequence. The ubiquitin-activating enzyme (E1) performs an ATP-dependent thioesterification between the carboxy-terminus of ubiquitin and a cysteine residue in the active site. The ubiquitin bound to E1 is then transferred to a cysteine residue of the ubiquitinconjugating enzyme (E2) and, finally, the ubiquitin ligase enzyme (E3) recognizes the target protein and transfers the E2 bound ubiquitin to an amino group in the substrate [16]. This cycle can repeatedly occur, producing polyubiquitin chains which are recognized by ubiquitin receptors in the proteasome 19S cap. The really interesting new gene (RING) class of E3 ubiquitin ligase proteins is a highly diverse group of proteins, which interacts with E2 enzymes through its RING domain. RING proteins are involved in a plethora of cellular processes such as signal transduction, cell cycle, regulation of transcription and protein traffic [6]; [4]. ∗

Macroautophagy, henceforth autophagy, is the degradation process of cytoplasmic components by which the targets, e.g., protein aggregates, organelles, viruses, are isolated by a lipid vesicle, named autophagosome, before being delivered to the lysosome [18]. Although autophagy is classically regarded as a non-selective process, recent findings have shown that autophagic cargo can be selectively targeted for lysosomal degradation by direct or indirect recognition during autophagosome formation. Members of the tripartite motif (TRIM) proteins have shown to be capable of direct cargo recognition and also to assemble autophagic factors during the autophagosome formation [17]. The TRIM proteins are traditionally characterized by RING domain in the amino-terminal region, followed by one or two B-box domains, a coiled-coil domain, and a modular carboxy-terminal domain, usually a SPRY/B30.2 domain, but several other domains such as BROMO [13], NHL [23] and FIL [25] can also be found in some members. Although conserved throughout the metazoan kingdom, there are species-specific TRIM proteins and TRIM orthologs may have different functions [22]. Functionally, this diverse family of proteins is implicated in antiviral response, cell growth, differentiation [8], and mutations in several TRIM genes are associated with carcinogenesis, muscular dystrophies [7]; [3], familial Mediterranean fever [2], Opitz syndrome [21], among other diseases. The presence of the RING domain indicates that TRIM proteins may act as E3 ubiquitin ligases. However, just a few proteins were proven to require this activity to their biological function [10]; [8]. Additionally,

Corresponding author. E-mail address: [email protected] (M.D. Gomes).

http://dx.doi.org/10.1016/j.pep.2017.10.014 Received 9 August 2017; Received in revised form 25 September 2017; Accepted 24 October 2017 Available online 05 November 2017 1046-5928/ © 2017 Elsevier Inc. All rights reserved.


D.S. Guimarães, M.D. Gomes

it is not well defined if the RING and the carboxy-terminal domains are required for E3 ligase activity [1]. The TRIM49 protein is an autophagic TRIM, i.e., it interacts with the autophagic factors ULK1, Beclin-1, GABARAP, and LC3, bringing these proteins together during the expansion of the autophagic membrane [17]. TRIM49 transcript levels are increased in THP-1 cells following tool like receptors stimulation [11] however, its biological role is still unknown. In this report, we describe the purification and functional characterization of the TRIM49 protein as an E3 ubiquitin ligase.

2.3. Site-directed mutagenesis

2. Materials and methods

2.4. Expression and purification from E. coli

2.1. Vector, strains, and antibodies

E. coli BL21 Origami™ B was transformed with the TRIM49 wildtype or C35S constructs and grown on LB agar containing 50 μg/mL gentamycin, 15 μg/mL kanamycin and 12.5 μg/mL tetracycline. Five colonies were inoculated in LB medium containing the described antibiotics and cultured overnight at 37 °C and 225 RPM. The starter culture was inoculated into LB broth and grown until OD600 reaches 0.6, the culture was then chilled to 28 °C, added of 50 μM ZnCl2 and induced with 0.15 mM IPTG for 3 h. Cells were pelleted at 7500 × g for 15 min, washed with 50 mM Tris-HCl pH 7.6 and stored overnight at −80 °C. 10 mL of pre-chilled lysis buffer (50 mM Tris-HCl pH 7.6, 0.5% TritonX100 and 0.15 mM PMSF) was added to the cells, and the suspension was sonicated. The lysate was centrifuged at 20000×g for 25 min at 4 °C and the supernatant used for affinity purification. GST tagged proteins were purified by chromatography using 1 mL glutathione Sepharose 4 Fast Flow column coupled to an FLPC system. The protein extract was loaded at a 0.2 mL/min flow rate, and the column was washed with buffer A (25 mM Tris-HCl pH 8) at a 1 mL/ min flow rate until A280 reaches the baseline. Non-specific proteins were removed with buffer B gradient (25 mM Tris-HCl pH 8, 5 mM MgCl2, 300 mM KCl) 0–100% over 15 mL, 100% buffer B over 3 mL and 100-0% over 4 mL. GST tagged TRIM49 was eluted with buffer A added of 50 mM reduced glutathione over 5 mL, and the fractions of the elution were verified by SDS-PAGE. Relevant fractions were pooled together and concentrated using a Centriprep device (Millipore, USA) with a 10 kDa cutoff membrane. Glycerol was added to the concentrate to a final concentration of 20%, and the aliquots of purified proteins were stored at −80 °C.

The TRIM49 RING domain mutant (C35S TRIM49) was produced by site-directed mutagenesis using the pair of primers 5′-GGCACA GCTTTAGCAGGCCTTGTTTCTACC-3′ and 5′-GGCCTGCTAAAGCTGTG CCCACAGTC-3′, inserting a missense mutation which changes the codon of the cysteine 35 to serine. The PCR reaction was performed as follows: 98 °C for 10 s, 18 cycles at 95 °C for 20 s, 68 °C for 30 s and 72 °C for 110 s, followed by the last extension of 5 min at 72 °C. The parental plasmid was digested with the DpnI enzyme.

TOPO 2.1 vector was purchased from Thermo Fisher Scientific. pGEX-4T1 vector and Glutathione Sepharose 4FF resin were purchased from GE Healthcare, pCDNA 3.1 was purchased from Addgene. pmCherry N1 and C1 vectors and anti-mCherry antibody were gently provided by Dr. Luis L. P. Silva (FMRP/USP). Plasmid DNA purification kits were purchased from Qiagen. The BL21 Origami™ B strain was kindly provided by Dr. Richard John Ward (FCFRP/USP). Mouse antiFLAG antibody (1:500) was acquired from Sigma (F1804), rabbit antiFLAG antibody (1:1000) was from Abcam (ab1162), mouse anti-GFP (1:500) was from Santa Cruz Biotechnology, mouse anti-GST (1:200) was from Sigma (G1160) and mouse anti-ubiquitinated proteins FK2 clone (1:1000) was from Enzo Life Sciences. Secondary antibodies (1:2000) were purchased from KPL. All the reagents used in the in vitro ubiquitination assays were purchased from Boston Biochem.

2.2. Cloning and PCR The fully sequenced human TRIM49 coding sequence acquired from the I.M.A.G.E was used as the template for mutagenesis and cloning. TRIM49 CDS was subcloned into pCDNA3.1 (3xFLAG tag at the aminoterminus) vector, pGEX4T1 (GST tag at amino-terminus) vector and pmCherry N1/C1 (mCherry tag at the carboxy or amino termini, respectively) using Phusion High-Fidelity PCR Master Mix (Thermo Fisher Scientific) with the primers described in Table 1. PCR reaction proceeded as follows: 98 °C for 10 s, 5 cycles at 95 °C for 20 s, 60 °C for 30 s and 72 °C for 35 s, 20 cycles at 95 °C for 20 s, 65 °C for 20 s and 72 °C for 35 s, followed by a final extension at 72 °C for 5 min. To generate a TRIM49 protein lacking the SPRY domain (TRIM49 ΔSPRY), we used the primers described in Table 1 and the same PCR protocol described above, except for the first five cycles. PCR amplicons were purified using QIAquick Gel Extraction kit. Purified amplicons and destination vectors were digested with the enzymes described in Table 1 and the cohesive ends ligated using T4 ligase.

2.5. Expression and purification from mammalian cells Human HEK293T cells were transfected for 48 h with pCDNA3.1 3xFLAG-TRIM49 wild-type or C35S constructs using polyethyleneimine. Cells were lysed with hypotonic buffer (25 mM Tris-HCl pH 7.5, 225 mM KCl, 1% NP-40), added of protease and phosphatase inhibitors cocktails, at 4 °C for 30 min. The lysate was centrifuged at 20100×g for 20 min, and the 3xFLAG tagged proteins in the supernatant were immunopurified using anti-FLAG agarose M2 resin (Sigma,

Table 1 Primers and enzymes used in TRIM49 subcloning.

FWD REV WD REV FWD REV FWD REV FWD REV FWD REV

Primers (5′-3′)

Restriction enzyme

Amplicon

Destination vector

CGGGATCCAATTCTGGAATCTTACAGG GGAATTCTCAGAAGTGAATACAGCAAAAGATAGG CGGGATCCAATTCTGGAATCTTACAGG GGAATTCCTACAGAGTAATATGCACTCGGAATTGG GGAATTCATGAACTCTGGAATCTTACAGGTCTTTCAGGG CGGGATCCAAGTGAATACAGCAAAAGATAGG GGAATTCATGAACTCTGGAATCTTACAGGTCTTTCAGGG CGGGATCCAGAGTAATATGCACTCGGAATTGG GGAATTCATGAACTCTGGAATCTTACAGGTCTTTCAGGG CGGGATCCTCAGAAGTGAATACAGCAAAAGATAGG GGAATTCTTCTGGAATCTTACAGGTCTTTCAGGG CGGGATCCCTACAGAGTAATATGCACTCGGAATTGG

BamHI EcoRI BamHI EcoRI EcoRi BamHI EcoRI BamHI EcoRI BamHI EcoRI BamHI

WT

WT

pCDNA3.1/ pGEX4T1 pCDNA3.1 pGEX4T1 pmCherry-N1

ΔSPRY

pmCherry-C1

WT

pmCherry-N1

ΔSPRY

pmCherry-C1

58

ΔSPRY



Fig. 1. Expression and purification of GSTTRIM49 by affinity chromatography. (A) Cell extracts from BL21 Origami™ B overexpressing wild-type, or C35S GST-TRIM49 were loaded on a glutathione Sepharose 4 Fast Flow column and eluted with 50 mM reduced glutathione; Samples of different purification stages were analyzed by SDS-PAGE (B) and immunoblot (C). U: uninduced cells; T:total extract of the induced cell; S: soluble extract; P: pooled eluate fractions; W: last column wash fraction.

function of the SPRY and RING domains in TRIM49 ubiquitin E3 ligase activity, we produced mutants lacking the SPRY domain, possibly its substrate recognition domain, or with a defective RING domain, incapable of binding to E2. In a first attempt at obtaining the TRIM49 protein in its active soluble form, GST tagged TRIM49 was expressed in BL21 Origami™ B strain, which enhances protein solubility and proper folding by facilitating the formation of disulfide bonds, additionally, before induction, the culture was added of Zn2+, a cofactor of the RING domain. Previous results in our lab showed a high level of contamination with bacterial chaperonins after affinity chromatography elution. Therefore we used a MgCl2/KCl gradient to wash out co-eluting proteins. The expression yielded a soluble protein, and only a minor contaminant of approximately 55 kDa was observed (Fig. 1 A, B). Protein identity was further confirmed by immunoblot (Fig. 1 C), and no trace of proteolysis during the purification process was detected. Previous reports have shown that a given TRIM protein may be active only with a subset of E2 enzymes [19], therefore, to determine background ubiquitination levels, we tested the intrinsic autoubiquitination activity of multiple E2 enzymes (Fig. 2 B). The classical UbcH5b and UbcH6 enzymes were chosen for further assays. TRIM49 overexpressed in E. coli cells showed no autoubiquitination activity with the tested E2 pairs, and it also did not appear to enhance E2 autoubiquitination, a feature of some RING E3 ubiquitin ligases. To overcome prokaryotic expression system limitations and verify whether the missing activity of TRIM49 protein purified from E. coli was caused by misfolding or by a lack of post-translational modifications and additional protein partners, we immunopurified 3xFLAG

USA). The resin was washed and proteins eluted with 300 ng/mL 3xFLAG peptide in elution buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 0.1% NP-40, 225 mM KCl). 2.6. In vitro E3 ubiquitin ligase activity assay Autoubiquitination activity of TRIM49 protein purified from E. coli or HEK293T cells was assessed in a reaction containing 0,5 μL ubiquitination buffer 10×, 2 mM ATP, 0.2 mM MgCl2, 0.37 mM N-terminal biotinylated ubiquitin,1.48 mM ubiquitin, 0.17 μM E1 enzyme,1 μM E2 enzymes and 3 μL of purified TRIM49. TP53 ubiquitination by MDM2 was used as a positive control. The reaction proceeded at 37 °C for 60 min, stopped with 2× Laemlli buffer and protein ubiquitination assessed by immunoblot using HRP-streptavidin conjugate. 2.7. In vivo TRIM49 E3 ligase activity HEK293T cells were co-transfected for 48 h with one of the mCherry TRIM49 constructs and the TR-TUBE plasmid. FLAG-tagged proteins were affinity purified as described before and ubiquitination was verified by immunoblot. 3. Results and discussion The role of the RING and SPRY domains in the enzymatic activity of TRIM proteins is still elusive, and a soluble purified protein is required for the fully functional characterization of these. To investigate the 59



Fig. 3. Autoubiquitination assays with 3xFLAG-TRIM49 overexpressed in HEK293T cells. (A) 3xFLAG-TRIM49 constructs were transfected into HEK293T cells and immunopurified using agarose anti-FLAG resin. The purified TRIM49 was used for in vitro autoubiquitination assays in reactions containing biotinylated ubiquitin. Polyubiquitinated proteins were visualized by chemiluminescence using streptavidinHRP and ECL. (B) Autoubiquitination of the wild-type TRIM49 was assessed with different E2 enzymes. Reactions without the E1 enzyme or without the purified protein were used as negative controls.

Fig. 2. Autoubiquitination assays with GST-TRIM49 overexpressed in E. coli. (A) The autoubiquitination activity of different E2 enzymes was assessed in reactions containing amino-terminal biotinylated ubiquitin and polyubiquitinated proteins visualized by chemiluminescence using streptavidin conjugated with horseradish peroxidase (HRP) and enhanced chemiluminescence (ECL). (B) Affinity purified wild-type, and C35S GSTTRIM49 were used for in vitro autoubiquitination assays with the selected E2 enzymes, as described above. In parallel, polyubiquitination of TP53 by MDM2 was used as a positive control. Reactions without the E2 enzyme were used as a negative control.

mCherry-TRIM49 constructs and the wild-type or mutant TR-TUBE (Fig. 4). An increase in lower molecular weight ubiquitin conjugates was observed in cells transfected with wild-type and ΔSPRY TRIM49 when compared to cells transfected with empty vector. Interestingly, the wild-type and ΔSPRY mutant were co-purified in lysates of cells expressing the wild-type TUBE, but not in the mutant TUBE co-transfected cells. These findings indicate that TRIM49 is directly or indirectly involved with the UPS and that this interaction is not dependent on the SPRY domain or RING domains. However, it is unlikely that TRIM49 acts as an E3 ubiquitin ligase in vivo. Some members of the TRIM family have E3 ligase activity for other ubiquitin-like modifiers, such as SUMO [5] and ISG15 [20]. Therefore the possibility of TRIM49 possessing E3 ligase activity for these substrates is remaining.

tagged TRIM49 overexpressed in human HEK293T cells. In vitro autoubiquitination activity was assessed for wild-type and RING domain mutant TRIM49. However no further ubiquitination in the wild-type TRIM49 reaction was observed, when compared to the RING mutant or the negative control without the purified protein (Fig. 3 A). In fact, any of the tested E2 enzymes (Fig. 3 B) pairs showed ubiquitination bands above 3xFLAG tagged TRIM49 protein molecular weight (54 kDa). Although some members of the TRIM proteins form catalytic active homo or hetero-oligomers [12,14], during the purification of TRIM49 from eukaryotic or prokaryotic systems, no oligomerization in the form of high molecular weight bands was observed. Next, we used the Tandem Ubiquitin Binding Entities (TUBE) approach to verify whether TRIM49 could increase total ubiquitination levels in vivo and also if TRIM49 could interact with ubiquitinated proteins. The TUBE constructs were developed to isolate and protect ubiquitinated proteins from degradation and deubiquitinating enzymes [9]. The wild-type TR-TUBE [24] construct consists of four ubiquitinassociated (UBA) domains in tandem, which bind and protect the polyubiquitin chain, and an amino-terminal FLAG tag. Point mutations inserted in the TR-TUBE UBA domains yields a mutant incapable of binding to ubiquitin chains. TR-TUBE bound proteins were immunopurified from lysates of HEK293T cells co-transfected with

4. Conclusion We described the first functional characterization of the domains of human TRIM49 and its possible E3 ubiquitin ligase activity. As TRIM49 from different sources showed no in vitro E3 ubiquitin ligase activity with the various E2 enzymes tested, it is unlikely that its biological role is dependent on its ubiquitination activity. However, TRIM49 appear to interact with ubiquitinated proteins in vivo, as seen in the TR-TUBE immunoprecipitation experiments. This study reinforces the fact that the presence of a RING domain is not sufficient for classification of TRIM proteins as E3 ubiquitin ligases. Evaluation of the TRIM49 E3 activity towards other small ubiquitin-like modifiers may enlighten whether the E3 activity is a general characteristic of the TRIM proteins.

60



[7]

[8]

[9]

[10]

[11]

[12]

[13]

Fig. 4. Effect of TRIM49 on total ubiquitination levels using TUBE approach. HEK293T cells were co-transfected with mCherry-TRIM49 constructs and TR-TUBE plasmids and polyubiquitinated proteins captured by immunopurification of TR-TUBE using anti-FLAG resin. Mutant TR-TUBE, which is incapable of binding to polyubiquitin chains was used as negative control.

[14]

[15]

Acknowledgements [16]

This work was supported by FAPESP grant 2014/108988-7. We thank Dr. Yukiko Yoshida (Tokyo Metropolitan Institute of Medical Science, Japan) for providing us with the TR-TUBE plasmid. We are grateful to Mrs. Cacilda Dias Pereira for excellent technical support. During these studies, D.S. Guimaraes was recipient of a CPNq fellowship.

[17]

[18] [19]

Appendix A. Supplementary data [20]

Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.pep.2017.10.014.

[21]

References [22] [1] Manuela Antonioli, Rienzo Martina Di, Piacentini Mauro, Maria Fimia Gian, Emerging mechanisms in initiating and terminating autophagy, Trends Biochem. Sci. (2017), http://dx.doi.org/10.1016/j.tibs.2016.09.008. [2] a Bernot, C. da Silva, J.L. Petit, C. Cruaud, C. Caloustian, V. Castet, M. Ahmed-Arab, et al., Non-founder mutations in the MEFV gene establish this gene as the cause of familial Mediterranean fever (FMF), Hum. Mol. Genet. 7 (8) (1998) 1317–1325 doi:9668175. [3] Sue C. Bodine, Leslie M. Baehr, Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1, Am. J. Physiol. Endocrinol. Metabol. 307 (6) (2014) E469–E484, http://dx.doi.org/10.1152/ajpendo.00204.2014. [4] Christos Chasapis, Georgios Spyroulias, RING finger E3 ubiquitin ligases: structure and drug discovery, Curr. Pharm. Des. 15 (31) (2009) 3716–3731, http://dx.doi. org/10.2174/138161209789271825. [5] Y. Chu, X. Yang, SUMO E3 ligase activity of TRIM proteins, Oncogene 30 (9) (2011) 1108–1116, http://dx.doi.org/10.1038/onc.2010.462. [6] Raymond J. Deshaies, Claudio A.P. Joazeiro, RING domain E3 ubiquitin ligases,

[23]

[24]

[25]

61

Annu. Rev. Biochem. 78 (1) (2009) 399–434, http://dx.doi.org/10.1146/annurev. biochem.78.101807.093809. Patrick Frosk, Weiler Tracey, Nylen Edward, Sudha Thangirala, R. Greenberg Cheryl, Morgan Kenneth, T. Mary Fujiwara, Klaus Wrogemann, Limbgirdle muscular dystrophy type 2H associated with mutation in TRIM32, a putative E3-ubiquitin–ligase gene, Am. J. Hum. Genet. 70 (3) (2002) 663–672, http://dx. doi.org/10.1086/339083. Shigetsugu Hatakeyama, TRIM family proteins: roles in autophagy, immunity, and carcinogenesis, Trends Biochem. Sci. (2017), http://dx.doi.org/10.1016/j.tibs. 2017.01.002. Roland Hjerpe, Roland Hjerpe, Fabienne Aillet, Fabienne Aillet, Fernando LopitzOtsoa, Fernando Lopitz-Otsoa, Valerie Lang, et al., Efficient protection and isolation of ubiquitylated proteins using tandem ubiquitin-binding entities, EMBO Rep. 10 (11) (2009) 1250–1258, http://dx.doi.org/10.1038/embor.2009.192. Kazuhiro Ikeda, Satoshi Inoue, Trim proteins as ring finger E3 ubiquitin ligases, Adv. Exp. Med. Biol. 770 (2012) 27–37, http://dx.doi.org/10.1007/978-1-46145398-7_3. Mei-Xiu Jiang, Xuan Hong, Bin-Bin Liao, Shui-Zhen Shi, Xiao-Fang Lai, HuaiYu Zheng, Lin Xie, et al., Expression profiling of TRIM protein family in THP1derived macrophages following TLR stimulation, Sci. Rep. 7 (2017) 42781, http:// dx.doi.org/10.1038/srep42781. Marios G. Koliopoulos, Esposito Diego, Christodoulou Evangelos, A Taylor Ian, Rittinger Katrin, Functional role of TRIM E3 ligase oligomerization and regulation of catalytic activity, EMBO J. 35 (11) (2016) 1204–1218, http://dx.doi.org/10. 15252/embj.201593741. Atul Kulkarni, Oza Jay, Yao Ming, Sohail Honeah, Ginjala Vasudeva, TomasLoba Antonia, Horejsi Zuzana, R. Tan Antoinette, J. Boulton Simon, Ganesan Shridar, Tripartite motif-containing 33 (TRIM33) protein functions in the poly(ADP-ribose) polymerase (PARP)-dependent DNA damage response through interaction with amplified in liver cancer 1 (ALC1) protein, J. Biol. Chem. 288 (45) (2013) 32357–32369, http://dx.doi.org/10.1074/jbc.M113.459164. Xing Li, F. Yeung Darwin, M. Fiegen Ann, Sodroski Joseph, Determinants of the higher order association of the restriction factor TRIM5α and other tripartite motif (TRIM) proteins, J. Biol. Chem. 286 (32) (2011) 27959–27970, http://dx.doi.org/ 10.1074/jbc.M111.260406. Kefeng Lu, Psakhye Ivan, Jentsch Stefan, Autophagic clearance of PolyQ proteins mediated by ubiquitin-Atg8 adaptors of the conserved CUET protein family, Cell 158 (3) (2014) 549–563, http://dx.doi.org/10.1016/j.cell.2014.05.048. Y. Lu, B.-h. Lee, R.W. King, D. Finley, M.W. Kirschner, Substrate degradation by the proteasome: a single-molecule kinetic analysis, Science 348 (6231) (2015), http:// dx.doi.org/10.1126/science.1250834 1250834–1250834. Michael A. Mandell, Ashish Jain, John Arko-Mensah, Santosh Chauhan, Tomonori Kimura, Christina Dinkins, Guido Silvestri, et al., TRIM proteins regulate autophagy and can target autophagic substrates by direct recognition, Dev. Cell 30 (4) (2014) 394–409, http://dx.doi.org/10.1016/j.devcel.2014.06.013. Noboru Mizushima, Yoshimori Tamotsu, Levine Beth, Methods in mammalian autophagy research, Cell (2010), http://dx.doi.org/10.1016/j.cell.2010.01.028. Luisa M. Napolitano, G. Jaffray Ellis, T. Hay Ronald, Meroni Germana, Functional interactions between ubiquitin E2 enzymes and TRIM proteins, Biochem. J. 434 (2) (2011) 309–319, http://dx.doi.org/10.1042/BJ20101487. Keiko Ozato, Shin Dong-Mi, Chang Tsung-Hsien, C Morse Herbert III, TRIM family proteins and their emerging roles in innate immunity, Nat. Rev. Immunol. 8 (11) (2008) 849–860, http://dx.doi.org/10.1038/nri2413. N a Quaderi, S. Schweiger, K. Gaudenz, B. Franco, E.I. Rugarli, W. Berger, G. J Feldman, et al., Opitz G/BBB syndrome, a defect of midline development, is due to mutations in a new RING finger gene on Xp22, Nat. Genet. 17 (3) (1997) 285–291, http://dx.doi.org/10.1038/ng1197-285. S.L. Sawyer, L.I. Wu, M. Emerman, H.S. Malik, Positive selection of primate TRIM5 identifies a critical species-specific retroviral restriction domain, Proc. Natl. Acad. Sci. 102 (8) (2005) 2832–2837, http://dx.doi.org/10.1073/pnas.0409853102. Jens C. Schwamborn, Berezikov Eugene, Juergen A. Knoblich, The TRIM-NHL protein TRIM32 activates MicroRNAs and prevents self-renewal in mouse neural progenitors, Cell 136 (5) (2009) 913–925, http://dx.doi.org/10.1016/j.cell.2008. 12.024. Yukiko Yoshida, Saeki Yasushi, Murakami Arisa, Kawawaki Junko, Tsuchiya Hikaru, Yoshihara Hidehito, Shindo Mayumi, Tanaka Keiji, A comprehensive method for detecting ubiquitinated substrates using TR-TUBE, Proc. Natl. Acad. Sci. 112 (15) (2015) 4630–4635, http://dx.doi.org/10.1073/pnas. 1422313112. Jindong Zhang, Zhang Chuanxia, Cui Jun, Ou Jiayu, Han Jing, Qin Yunfei, Zhi Feng, Wang Rong-Fu, TRIM45 functions as a tumor suppressor in the brain via its E3 ligase activity by stabilizing p53 through K63-linked ubiquitination, Cell Death Dis. 8 (5) (2017) e2831, http://dx.doi.org/10.1038/cddis.2017.149.