Expression, Purification, and Characterization of

0 downloads 0 Views 366KB Size Report
Sepharose Fast Flow column. .... with alkaline phosphatase-labeled goat anti-mouse sec- ... 300 mm G2000SW column (TOSOH Corporation) at a flow.

Mol Biotechnol DOI 10.1007/s12033-009-9170-z

RESEARCH

Expression, Purification, and Characterization of Recombinant Protein GX1-rmhTNFa Shanshan Cao Æ Yan Liu Æ Xiaohua Li Æ Yingqi Zhang Æ Jun Wang Æ Wenqi Du Æ Yu Han Æ Haifeng Jin Æ Lina Zhao Æ Kaichun Wu Æ Daiming Fan

Ó Humana Press 2009

Abstract A phage-displayed peptide CGNSNPKSC (GX1) was obtained previously in our lab, which could specifically bind to the vasculature of human gastric cancer. GX1-rmhTNFa was a fusion protein of GX1 and recombinant mutant human tumor necrosis factor a (rmhTNFa), which was designed by us with the expectation of enhancing selectivity of rmhTNFa. The DNA fragment encoding GX1 was cloned into the vector pBV220 with rmhTNFa between the EcoRI site and the BamHI site, and then expressed in Escherichia coli DH5a by temperature induction. Subsequently, E. coli DH5a was lysed, and the GX1-rmhTNFa protein was found in both soluble form and inclusion bodies. The protein was fractionated with ammonium sulfate deposition from 30% to 60%, and purified by cation and anion exchange chromatography using SP Sepharose Fast Flow column and Q Sepharose Fast Flow column. The purity of protein was then identified by SDS-PAGE and HPLC. Subsequent studies showed that GX1-rmhTNFa had high bioactivity of 5.65 9 108 IU/ml, which was similar with natural human TNFa and could reach the tumor site relatively faster than rmhTNFa. Shanshan Cao and Yan Liu contribute equally to this manuscript. S. Cao  X. Li  J. Wang  W. Du  Y. Han  H. Jin  L. Zhao  K. Wu (&)  D. Fan State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, Xi’an 710032, Shaanxi Province, People’s Republic of China e-mail: [email protected] Y. Liu  Y. Zhang State Key Laboratory of Cancer Biology and Biotechnology Center, The Fourth Military Medical University, Xi’an, Shaanxi, China

Keywords GX1-rmhTNFa  Tumor vasculature treatment  Protein expression  Protein purification  Recombinant protein Abbreviations HPLC High performance liquid chromatography FMMU The fourth military medical university ELISA Enzyme-linked immunosorbent assay PBST Phosphate buffer solution tween-20 HRP Horse radish peroxidase SPECT Single photon emission computed tomography

Introduction Tumor angiogenesis research has become one of the most promising fields under exploration for new anticancer strategies. Anti-angiogenesis therapy has two significant advantages: easy accessibility of drugs to tumor site; and non-resistance to drugs. More importantly, both structural and functional differences exist among blood vessels in different tissues and tumor types. Some specific surface proteins called vascular zip codes are expressed in cell surface of vascular beds. These ‘‘addresses’’ proteins are overexpressed in tumor sites, which provide a novel antitumor strategy, e.g., anti-angiogenesis therapy, in which by systemic administration of antagonists or ligands of the addresses proteins can be targeted to tumor sites specifically [1–4]. So the molecules that are able to effectively deliver therapeutic agents to the tumor microenvironment may become promising and important novel tools for cancer therapy. A small peptide GX1 which could target gastric cancer was obtained in our lab using phage-displayed peptide library screening in vivo. Immunohistochemistry staining

Mol Biotechnol

in mouse and human tissue showed that this phage peptide could specifically bind to the endothelial cells of human gastric cancer [5]. We have also labeled GX1 with 99 TcmO4- for in vivo dynamic imaging of tumor xenografts using SPECT, and the results provided an imaging evidence for gastric cancer angiogenesis-targeted radiotherapy as well as other therapeutic strategies based on specific vascular markers [6]. The observations paved the way for the selective delivery of toxic agents or drugs to gastric tumor vasculature. Tumor necrosis factor a (TNFa) is a pleiotropic cytokine with antitumoral activity composed of three non-covalentlinked TNFa monomers. TNFa exerts its effects in tumors mainly on the endothelium of the tumor-associated vasculature, with increased permeability, upregulation of tissue factor, fibrin deposition, thrombosis, and destruction of the endothelial cells, including alteration of endothelial barrier function, reduction of tumor interstitial pressure, and endothelial cell damage [7–11]. The systemic administration of large, therapeutically effective doses of TNFa is not possible because of the unacceptably high levels of systemic toxicity it induces. The systemic toxicity includes shock, renal insufficiency, and disseminated intravascular coagulation (DIC). For this reason, only loco-regional therapies such as ‘‘isolated limb perfusion’’, have been used with TNFa [12–16]. A number of approaches are presently under investigation to improve the efficacy and reduce the severe systemic toxicity of systemically administered TNFa. These strategies include the production of engineered TNFa mutants, the encapsulation of TNFa in long-circulating liposomes, and the selective delivery to and concentration in tumors of TNFa through its coupling to specific ligand [17–19]. The recombinant mutant human TNFa (rmhTNFa) was created by the Biotechnology Center of FMMU in order to enhance the anti-tumor effects while reducing the side effects [20, 21]. It has been approved in small-cell lung cancer treatment in China. However, lack of tumor targeting still limits its application. Based on the finding of GX1, we developed a fusion protein containing both GX1 and rmhTNFa to improve the tumor treatment by targeting delivery of rmhTNFa. In this study, we report the construction, expression, purification, and characterization of fusion protein GX1rmhTNFa.

phenylmethylsulfonyl fluoride (PMSF), Triton X-100, and Tris were purchased from Serva (Germany); The plasmid pBV220 containing the PR and PL promoters, the rmhTNFa gene, and two strong transcription terminators were kindly gifted by the State Key Laboratory of Cancer Biology and Biotechnology Center, FMMU. Coomassie Brilliant Blue R-250 was purchased from Bio-Rad Laboratories, Hercules, CA. All other chemicals were of analytical grade. Healthy male BALB/c nude mice (7 weeks old) were purchased from the National Rodent Laboratory Animal Resource, Shanghai, China. Plasmid Construction of GX1- rmhTNFa The GX1 peptide DNA was synthesized by Beijing Sunbiotech Company. It encoded the GX1 (forward sequence, 50 aattcatgtgtggtaattctaatcctaagtcgtgcg30 ) and contained the BamHI and EcoRI restriction enzyme sequences. The DNA fragment was then cloned into the vector PBV220 and its C-terminus fused with rmhTNFa. The plasmid was used to transform the Escherichia coli DH5a to generate ampicillin-resistant colonies. Bacterial colonies were cultured in LB culture medium supplemented with ampicillin. Plasmid DNA was isolated using plasmid minipreps kit (Anhui Ugene biotechnology CO. LTD), and verified by sequencing. The structure of the fusion protein GX1-rmhTNFa was shown in Fig. 1. Expression and Extraction of GX1- rmhTNFa One colony of E. coli DH5a bearing plasmid pBV220GX1- rmhTNFa was grown at 30°C in 5-ml LB medium overnight supplemented with 100 lg/ml ampicillin. The cells were added to inoculate nine 500 ml flasks, each containing 300 ml of seed culture and 100 lg/ml ampicillin. The cultures were grown at 30°C until the OD value at 600-nm wave length reached 0.5. Bacterial cells were induced at 42°C for 4 h and then harvested by centrifugation at 4000 rpm for 30 min. The cell pellets were either immediately used or stored frozen at -20°C. The GX1rmhTNFa cell pellets were resuspended in lysis buffer (50 mM Tris–HCl, 200 mM NaCl, 1 mM DTT, and 0.1 mM PMSF, pH 6.5). After sonication on ice (Branson Sonifier 450), the cell lysate was centrifuged at 15,000 rpm for 30 min at 4°C to separate the soluble and insoluble fractions. The supernatants (soluble fraction) were collected and used for protein purification.

Materials and Methods Isolation and Purification of GX1-rmhTNFa Reagents and Animals Restriction endonucleases and T4 DNA ligase were purchased from Takara (Dalian, China); ammonium sulfate,

Ammonium sulfate was added to the supernatant to give 30% saturation; the precipitate was removed by centrifugation (15,000 g for 15 min). The supernatant was added

Mol Biotechnol Fig. 1 The structure of the pBV220-GX1-rmhTNFa expression vector

with ammonium sulfate for the second time to give 60% saturation, and centrifuged again (15,000 g for 15 min). The supernatant was discarded. The precipitate was dissolved and equilibrated in buffer A1 (20 mM sodium phosphate pH6.5), then loaded onto ¨ KTA purifier, the SP Sepharose Fast Flow column (A Amersham Pharcacia Biotech. USA). The column was preequilibrated in buffer A1 with flowing rate of 3 ml/min and eluted with buffer B1 (1 M NaCl, 20 mM sodium phosphate pH6.5). After elution, cellular DNA and positively charged alkaline proteins were removed. Subsequently, Q Sepharose column (anion-exchange ¨ KTA purifier, Amersham chromatography column. A Pharcacia Biotech. USA) was used to remove negatively charged acidic proteins. In brief, the elution including target protein was equilibrated in buffer A2 (20 mM Tris– HCl pH8.5), and loaded onto the Q Sepharose Fast Flow column. The column was pre-equilibrated in buffer A2 at 3 ml/min and eluted with buffer B2 (1 M NaCl 20 mM Tris–HCl pH8.5). Thus, the recombinant protein GX1rmhTNFa was purified successively. The purity of GX1-rmhTNFa was assayed by SDSPAGE and HPLC. Protein concentration was determined by Bradford Protein Determination using bovine serum albumin (BSA) as a standard [22]. SDS-PAGE and Western Blot Protein samples were dissociated into monomers on the addition of the nonionic detergent Triton X-100 and bmercaptoethanol, analyzed using 15% (w/v) tricine SDSPAGE gel and stained with Coomassie Brilliant Blue R-250 for 4 h in room temperature [23]. Western blot was performed as described previously [24]. Protein samples (5 lg) were separated by SDSPAGE, blotted onto nitrocellulose membrane, and incubated 1 h with 2% BSA (bovine serum albumin) in room

temperature for blocking step. After repeated washing by PBST, the membranes were incubated with a primary antibody: mouse monoclonal anti-human TNF (diluted 1:1000; Santa Cruz Biotechnology) for 12 h in 4°C. After repeated washing by PBST, the membranes were incubated with alkaline phosphatase-labeled goat anti-mouse secondary antibody (Boster, China) diluted 1:2000 for 2 h in room temperature. The bands were visualized using the Western Blue Stabilized Substrate (Promega Co. USA). HPLC SEC–HPLC (Size Exclusion Chromatography–High Performance Liquid Chromatography) analyses were performed on a Beckman’s HPLC system. The purified protein GX1rmhTNFa (5 lg) in PBS was injected onto a 7.5 mm 9 300 mm G2000SW column (TOSOH Corporation) at a flow rate of 0.5 ml/min. Peaks were detected by monitoring at a wavelength of 275 nm. The purity of GX1-rmhTNFa was calculated as a percentage of the total peak area detected. Bioactivity of GX1-rmhTNFa GX1-rmhTNFa activity was assayed by crystal violet staining of L929 cell cultures. Then, 200-ll L929 cells (5 9 105/ml) were seeded in each well of 96-well plates and cultured in 5% CO2 at 37°C for 20 h. Triplicate wells were used for each experimental condition. At intervals, plates were removed from incubator, and the medium was removed rapidly. The 100-ll RPMI-1640 medium contained actinomycin D (1 ll/ml). From one to eight 10-fold dilutions of GX1-rmhTNFa and standard TNF (initial concentration 100 IU/ml) were added into wells (100 ll/ well). Plates were re-incubated for 20 h and stained with 0.5% crystal violet for 20 min. The optical density at 570 nm was measured with microplate reader (Bio-Rad 550, USA). The bioactivity of GX1-rmhTNFa was

Mol Biotechnol ODtest determined with the following formula: ODcon  100%: ODcon ODcon: Absorbance in control well. ODtest: Absorbance at a particular dilution of test sample. GX1-rmhTNFa (U/ml): a unit is defined on that amount of cytotoxin necessary to cause 50% destruction of the cell-culture.

Animal Tumor models Thirty BALB/c nude mice were included in the experiment. A total of 5 9 106 growing human gastric cancer cells (SGC7901) were trypsinized and resuspended in 0.1ml RPMI1640 medium, and were injected subcutaneously into mice. Each experimental group consisted of 10 mice. All the mice were raised in the Laboratory Animal Research Center of FMMU. All the studies were performed when the tumors reached a volume of about 1–2 cm3. The tumor volume was determined with the following formula (d)2 9 D 9 0.52, where d and D are the short and long dimensions (centimeters) of the tumor, respectively, measured with a caliper. Housing, treatment, and killing of animals followed the national legislative provisions for the protection of animals used for scientific purposes. Biodistribution of GX1-rmhTNFa by ELISA To confirm that the selective protein homing was due to the GX1 peptide sequences, the localization of GX1rmhTNFa, rmhTNFa, and normal saline (NS) after intravenous injection was observed. GX1-rmhTNFa (263 mg/kg), rmhTNFa (246 mg/kg), and NS were, respectively, injected intravenously into the tail vein of mice. The GX1-rmhTNFa protein and the controls were allowed to circulate for 2 h. The tumors and control organs (brain, kidney, liver, lung, lung, and spleen) were removed, washed, and ground with 1 9 PBS. The precipitate was removed by centrifugation (12,000 g for 10 min). Supernatant samples were used for ELISA. The amount of GX1-rmhTNFa or rmhTNFa in tumor and other organs of BALB/c nude mice were quantified by commercially available ELISA kits (Department of Immunology, FMMU, Xi’an, Shannxi, China). Ninety-sixwell microtitre plates were coated overnight at 4°C with 100 ll of anti-human TNFa monoclonal antibody for 48 h. The supernatant samples were diluted 1:100 in PBST containing 0.1% BSA, and 100 ll of diluted sample was added to the antibody-coated wells in duplicate and incubated for 30 min at RT. The plates were washed six times with PBST and then incubated with 100 ll of 1:100 dilution of HRP-conjugated anti-human TNFa monoclonal antibody for 1 h at 37°C. The optical density at 490 nm was measured with a microplate reader (Bio-Rad 550, BioRad Laboratories, Hercules, CA).

Results Plasmid Construction and Expression of GX1-rmhTNFa The plasmid PBV220 was constructed for the preparation of GX1-rmhTNFa. The plasmid finally included GX1 and rmhTNFa (Fig. 1). The sequencing result was verified by restriction endonucleases BamHI, EcoRI, and PstI (Takara Biotec). The DNA, which was cut from the plasmid, is 501 base pair as expected. Isolation and Purification of GX1-rmhTNFa The recombinant protein GX1-rmhTNFa was expressed by temperature induction in 42°C for 4 h. Cells were sonicated and the recombinant protein was found expression in both solubility and deposition. Solubility was used for the purification step. The preliminary purification is salting-out by ammonium sulfate to remove some of the mixed protein. The last precipitate was purified by two steps, the first one is SP Sepharose Fast Flow column (Fig. 2a and b). The next step is Q Sepharose Fast Flow column (Fig. 2c and d). The fusion protein migrated as monomer, dimer, and trimer with the expected size of about 18, 36, and 54 kDa, respectively (Fig. 2d). The purity of the fusion protein was then detected by HPLC. It was shown that the purification was satisfying and the purity of the protein was [95% (Fig. 3a). Western blot was further performed using TNF-a antibody, which confirmed that the purified protein was GX1-rmhTNFa (Fig. 3b). Bioactivity and Biodistribution of GX1-rmhTNFa The biological activity of purified GX1-rmhTNFa was detected in L929 cell line. The cytotoxic response was found on cells. The maximum specific bioactivity of GX1rmhTNFa was estimated to be 5.65 9 108 IU/ml (Fig. 4a). The biodistribution of the target proteins were then observed in tumor-bearing nude mice. The amount of GX1rmhTNFa in tumor was increased by 3.83 folds in comparison with that of rmhTNFa. No significant targeting to the tumor was found in rmhTNFa groups and NS groups (Fig. 4b).

Discussion A large number of animal studies have shown that clinical use of TNFa as an anticancer drug is hampered by severe systemic toxicity. The rmhTNFa was produced to enhance

Mol Biotechnol

Fig. 2 The expression of the recombinant protein GX1-rmhTNFa. a SDS-PAGE for expression and purification of GX1-rmhTNFa after SP Sepharose Fast Flow column. Lane 1, molecular weight standards (kDa); lane 2, inclusion body after cell lysate; lane 3, supernatant after cell lysate; lanes 4, 5, 6, and 7, miscellaneous proteins (corresponding to the peaks 1, 2, 3, and 4,respectively, in b); lane 8, purified protein GX1-rmhTNFa after SP Sepharose Fast Flow column (corresponding to the peak 5 in b). The target protein GX1-rmhTNFa indicated by the black arrow. b Elution profile of GX1-rmhTNFa by SP Sepharose

Fig. 3 The characterization of GX1-rmhTNFa by HPLC and western blot. a HPLC analysis of purified GX1-rmhTNFa after refolding. The sample (5 lg) in PBS was injected onto a 7.5 mm 9 300 mm G2000SW column (TOSOH Corporation) at a low rate of 0.5 ml/min. Peaks were detected by monitoring at a wavelength of 280 nm. b Recombinant protein GX1-rmhTNFa detected by Western blotting using antiTNF monoclonal antibodies. Lane M, molecular weight standards (kDa); lane 1, Purified GX1-rmhTNFa

Fast Flow column. The peak 5 included the target protein. c SDSPAGE analysis of GX1-rmhTNFa after Q Sepharose Fast Flow column. Lane 1, molecular weight standards (kDa); lane 2, purified GX1-rmhTNFa of monomer; lane 3, purified GX1-rmhTNFa of trimer, lane 4, SDS-PAGE analysis of GX1-rmhTNFa after temperature inducing. The target protein GX1-rmhTNFa indicated by the black arrow. d Elution profile of GX1-rmhTNFa by Q Sepharose Fast Flow column. GX1-rmhTNFa was eluted with B2 buffer. The peak 1 is the target protein

Mol Biotechnol

Fig. 4 Bioactivity and biodistribution of recombinant protein GX1rmhTNFa. a Bioactivity of GX1-rmhTNFa. The abscissa is the dilution from 10- to 80-folds of GX1-rmhTNFa and standard TNF. Sample GX1-rmhTNFa, purified protein washed off after Q Sepharose Fast Flow column: 5.65 9 108 IU/ml. Sample standard

TNFa: 3.59 9 108 IU/ml. b Distribution of GX1-rmhTNFa and rmhTNFa at different organs after necropsy at 2 h post-intravenous injection. The organ data are expressed as mean ± S.D. Black bar: GX1-rmhTNFa group; black bias bar: rmhTNFa group; white bar: NS group. *P \ 0.05

the anti-tumor effects while reducing the side-effects. However, lack of tumor-targeting still limits its application. Based on the finding of tumor vasculature targeting peptide GX1, we developed the fusion protein GX1-rmhTNFa to improve the efficacy by targeting delivery of rmhTNFa. In our study, high level expression of GX1-rmhTNFa was obtained by 42°C induction (Fig. 1). The expression of GX1-rmhTNFa was under the control of inducing time. Four hours of inducing time is proved optimal for GX1rmhTNFa expression. The 5–L fermentation strategy allowed cultures to grow to final OD600 of 40–50 and gave cell wet weights of 30–40 g/l cultures. After cell lysis, the GX1-rmhTNFa found expression in both solubility and inclusion body. The amount of GX1rmhTNFa in solubility fraction was much less than in the inclusion body. However, the former was chosen for the next purification step with the nature of an efficient and convenient purification system, that is, the solubility is easier to purify and renaturate than the inclusion body. The ammonium sulfate was added into supernatant of lysed cells for the initial purification step. It was found that the recombinant protein GX1-rmhTNFa was salted out more effectively between 30% and 60% concentrations of ammonium sulfate. So the 30% and 60% concentration were selected ultimately for purification. The SP Sepharose Fast Flow column and the Q Sepharose Fast Flow column were performed for the next purification step. The elution gradient of the NaCl solution is very critical for these purification procedures. Different pH values of NaCl solution in both columns were tested: pH 5.5, 6.0, and 6.5 for SP Sepharose Fast Flow column, and pH 7.5, 8.0, and 8.5 for Q Sepharose Fast Flow column. The result showed that pH 6.5 for the former column and pH 8.5 for the latter column was optimal to remove mixed protein. The purity of GX1-rmhTNFa protein was over 95%, indicating that our purification process was effective. The purification system we established is stable,

highly effective and economical, so it is expected to be applied at a larger scale. The biological features of GX1-rmhTNFa were initially explored. It was shown that the maximum bioactivity of GX1-rmhTNFa was estimated to be 5.65 9 108 IU/ml, and it could target the tumor more than rmhTNFa in vivo. Thus, our data suggest that GX1-rmhTNFa may be used as a promising candidate for tumor-targeting treatment. Acknowledgments We thank Yingqi Zhang (Professor, Biotechnology Center of FMMU, China) for the new recombinant human TNFa. This study was supported by the National High-Tech Project of China 2006AA02Z103, 2006AA02A402; the Key Project of PLA 06G087; the National Key Project of Basic Research 2004CB518702.

References 1. Folkman, J. (2003). Angiogenesis and apoptosis. Seminars in Cancer Biology, 13, 159–167. doi:10.1016/S1044-579X(02) 00133-5. 2. Pastorino, F., Paolo, D., Di Piccardi, F., Nico, B., Ribatti, D., Daga, A., et al. (2008). Enhanced antitumor efficacy of clinicalgrade vasculature-targeted liposomal Doxorubicin. Clinical Cancer Research, 14, 7320–7329. doi:10.1158/1078-0432.CCR08-0804. 3. Norden, A. D., Drappatz, J., & Wen, P. Y. (2008). Novel antiangiogenic therapies for malignant gliomas. The Lancet Neurology, 7, 1152–1160. doi:10.1016/S1474-4422(08)70260-6. 4. Kamba, T., & McDonald, D. M. (2007). Mechanisms of adverse effects of anti-VEGF therapy for cancer. British Journal of Cancer, 96, 1788–1795. doi:10.1038/sj.bjc.6603813. 5. Zhi, M., Wu, K. C., Dong, L., Hao, Z. M., Deng, T. Z., Hong, L., et al. (2004). Characterization of a specific phage-displayed peptide binding to vasculature of human gastric cancer. Cancer Biology & Therapy, 3, 1232–1235. 6. Hui, X. L., Han, Y., Liang, S. H., Liu, Z. G., Liu, J., Hong, L., et al. (2008). Specific targeting of the vasculature of gastric cancer by a new tumor-homing peptide CGNSNPKSC. Journal of Controlled Release, 131, 86–93. doi:10.1016/j.jconrel.2008. 07.024. 7. Old, L. J. (1985). Tumor necrosis factor (TNF). Science, 230, 630–632. doi:10.1126/science.2413547.

Mol Biotechnol 8. Fajardo, L. F., Kwan, H. H., Kowalski, J., Prionas, S. D., & Allison, A. C. (1992). Dual role of tumor necrosis factor-alpha in angiogenesis. American Journal of Pathology, 140, 539–544. 9. Renard, N., Lienard, D., Lespagnard, L., Eggermont, A., Heimann, R., & Lejeune, F. (1994). Early endothelium activation and polymorphonuclear cell invasion precede specific necrosis of human melanoma and sarcoma treated by intravascular high dose tumor necrosis factor alpha (rTNF alpha). International Journal of Cancer, 57, 656–663. doi:10.1002/ijc.2910570508. 10. Mortara, L., Balza, E., Sassi, F., Castellani, P., Carnemolla, B., De Lerma Barbaro, A., et al. (2007). Therapy-induced antitumor vaccination by targeting tumor necrosis factor alpha to tumor vessels in combination with melphalan. European Journal of Immunology, 37, 3381–3392. doi:10.1002/eji.200737450. 11. Baumgarten, A. J., Fiebig, H. H., & Burger, A. M. (2007). Molecular analysis of xenograft models of human cancer cachexia—possibilities for therapeutic intervention. Cancer Genomics & Proteomics, 4, 223–231. 12. Lienard, D., Ewalenko, P., Delmotte, J. J., Renard, N., & Lejeune, F. J. (1992). High-dose recombinant tumor necrosis factor alpha in combination with interferon gamma and melphalan in isolation perfusion of the limbs for melanoma and sarcoma. Journal of Clinical Oncology, 10, 52–60. 13. Cooke, S. P., Pedley, R. B., Boden, R., Begent, R. H., & Chester, K. A. (2002). In vivo tumor delivery of a recombinant single chain fv: tumor necrosis factor-alpha fusion [correction of factor: a fusion] protein. Bioconjugate Chemistry, 13, 7–15. doi:10.1021/ bc000178a. 14. Van der Veen, A. H., Eggermont, A. M., Seynhaeve, A. L., van Tiel, S. T., & ten Hagen, T. L. (1998). Biodistribution and tumor localization of stealth liposomal tumor necrosis factor-alpha in soft tissue sarcoma bearing rats. International Journal of Cancer, 77, 901–906. 15. Curnis, F., Sacchi, A., Borgna, L., Magni, F., Gasparri, A., & Corti, A. (2000). Enhancement of tumor necrosis factor alpha antitumor immunotherapeutic properties by targeted delivery to aminopeptidase N (CD13). Nature Biotechnology, 18, 1185– 1190. doi:10.1038/81183.

16. Menard, L. C., Minns, L. A., Darche, S., Mielcarz, D. W., Foureau, D. M., Roos, D., et al. (2007). B cells amplify IFN-gamma production by T cells via a TNF-alpha-mediated mechanism. Journal of Immunology (Baltimore, MD.: 1950), 179, 4857–4866. 17. Sun, M., & Fink, P. J. (2007). A new class of reverse signaling costimulators belongs to the TNF family. Journal of Immunology (Baltimore, MD.: 1950), 179, 4307–4312. 18. Zheng, L., Yang, Y., Guocai, L., Pauza, C. D., & Salvato, M. S. (2007). HIV Tat protein increases Bcl-2 expression in monocytes which inhibits monocyte apoptosis induced by tumor necrosis factor-alpha-related apoptosis-induced ligand. Intervirology, 50, 224–228. doi:10.1159/000100565. 19. Kanbur, N., Mesci, L., Derman, O., Turul, T., Cuhadarog˘lu, F., Kutluk, T., et al. (2008). Tumor necrosis factor alpha-308 gene polymorphism in patients with anorexia nervosa. The Turkish Journal of Pediatrics, 50, 219–222. 20. Han, W., Zhang, Y., Yan, Z., & Shi, J. (2003). Construction of a new tumour necrosis factor fusion-protein expression vector for high-level expression of heterologous genes in Escherichia coli. Biotechnology and Applied Biochemistry, 37, 109–113. doi: 10.1042/BA20020070. 21. Wang, H., Yan, Z., Shi, J., Han, W., & Zhang, Y. (2006). Expression, purification, and characterization of a neovasculature targeted rmhTNF-alpha in Escherichia coli. Protein Expression and Purification, 45, 60–65. doi:10.1016/j.pep.2005.05.009. 22. Yang, F., Gu, N., Chen, D., Xi, X., Zhang, D., Li, Y., et al. (2008). Experimental study on cell self-sealing during sonoporation. Journal of Controlled Release, 131, 205–210. doi: 10.1016/j.jconrel.2008.07.038. 23. Boulanger, P. (2009). Purification of bacteriophages and SDSPAGE analysis of phage structural proteins from ghost particles. Methods in Molecular Biology (Clifton, N.J.), 502, 227–238. 24. Gilbert, J. S., Gilbert, S. A., Arany, M., & Granger, J. P. (2009). Hypertension produced by placental ischemia in pregnant rats is associated with increased soluble endoglin expression. Hypertension, 53, 399–403. doi:10.1161/HYPERTENSIONAHA.108. 123513.

Suggest Documents