Institute of Cancer Research, Fulham Road,London SW3. 6JB, UK. Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an ...
Nucleic Acids Research, Vol. 18, No. 19 5917
RFLP for the human prothrombin (F2) gene
Dinucleotide repeat polymorphism at the SIS locus
M.de Vetten, H.K.Ploos van Amstel* and P.H.Reitsma Haemostasis and Thrombosis Research Unit, University Hospital, PO Box 9600, 2300 RC Leiden, The Netherlands
H.Patterson*, P.J.Mitchell, C.S.Cooper and M.R.Stratton+ Institute of Cancer Research, Fulham Road, London SW3 6JB, UK
Source/Description: Clone pTL contains the cDNA for the complete coding sequence of the human prothrombin mRNA. A 704 bp AvaI fragment that codes for amino acid Pro53 to Asp265 of the mature prothrombin (1) was used as probe. Polymorphism: PstI digestion detects a 0.8 kb polymorphic insertion or deletion yielding PstI fragments of 9.2 kb and 10 kb. The polymorphism has been localized between the TaqI restriction site at position 2022 and the EcoRI restriction site at position 3464 of the human prothrombin gene, i.e. between exon IV and V (1). Frequency: 9.2 kb allele 0.72 10 kb allele 0.28 studied in 18 unrelated European Caucasians. Chromosomal Localisation: The human prothrombin gene has been localised on chromosome llpll.ql2 (2). Mendelian Inheritance: Demonstrated in four families. Probe Availability: Contact Pieter Reitsma. Acknowledgements: We thank R.Cortese for providing a prothrombin partial cDNA clone. Supported in part by Sanofi B.V. References: 1) Friezner-Degen,S.J. and Davie,E.W. (1987) Biochemistry 22, 2087-2097. 2) Royle,N.J., Irwin,D.M., Koschinsky,K.L., McGillivray,R.T.A. and Hamilton,J.C. (1987) Somat. Cell. Molec. Genet. 13, 285 -292.
Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an important new pool of genetic markers. Using the polymerase chain reaction and primers flanking the (G-T)n region, one of which is end-labelled with 'y32P dATP, these polymorphic alleles can be amplified and distinguished by electrophoresis in polyacrylamide gels. Primer Sequences: AGAGGTGAATTTGCAAGTGA (GT strand); AGTGATGGTTATTACTGCAG (CA strand). PCR Conditions: PCR was carried out in a total volume of 100 /d containing 1 itg genomic DNA; 25 pmols of each primer with an additional 0.2 pmol of radiolabelled CA strand primer; 400 AtM of each dNTP's; 50 mM KCI, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 0.01% w/v gelatin; 2 units Taq polymerase (Cetus). Each amplification was performed for 30 cycles, 1 minute at 93°C, 1 minute at 570C and 1 minute at 720C. Polymorphism: PCR detects five alleles. Sequencing of two subcloned alleles revealed that the variation in size results from changes in the length of the (G-T)n region and of an adjacent (G-C)n region. Allele Al (G-T)12 (G-C)4 (G-A)2Allele A4 (G-T)17 (G-C)4C (G-A)2 Chromosomal Localization: 4.7 kb upstream of the 'TATA' box of the c-sis proto-oncogene on chromosome 22 (1). Frequency: Allele frequencies were calculated from 28 unrelated individuals. Mendelian Inheritance: Codominant segregation was shown in 1 informative two generation family (14 individuals). Al
A2 A3 A4 A5
PstI
Heterozygosity in our sample
10 9.2
Frequency
Allele (bp) 85 87 89 96 98
Allele
=
0.64 0.07 0.04 0.20 0.05 57%.
Acknowledgements: We thank Bruce Ponder for DNA samples. This work was supported by grants from the Cancer Research Campaign and the Medical Research Council. References: 1) Van den Ouweland,A.M.W., van Groningen,J.J.M., Hendricksen,P.J.M., Bloemers,H.P.J. and Van de Ven,W.J.M. (1987) Nucl. Acids Res. 15, 4349. 2) Litt,M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. .i
Z+2Z--,
_
i t A
B
C
D
E
....
F
t
4tW
*
Z+4 Z
G
Autoradiograph of DNA sequencing gel showing the alleles of the PCR-amplified microsatellite in specimens A-G, run alongside DNA sequencing ladder. Minor bands running ahead of allele bands are thought to be due to slippage during PCR
(2).
*
To whom correspondence should be addressed
+Present address: Department of Neuropathology, Institute of Psychiatry, De-Crespigny Park, Denmark Hill, London SE5 8AF, UK * To whom correspondence should be addressed
