Factors Involved in Entry of the Human Immunodeficiency ... - NCBI - NIH

JOURNAL OF VIROLOGY, Oct. 1994, p. 6535-6546

Vol. 68, No. 10

0022-538X/94/$04.00+0 Copyright C) 1994, American Society for Microbiology

Factors Involved in Entry of the Human Immunodeficiency Virus Type 1 into Permissive Cells: Lack of Evidence of a Role for CD26 ICIAR LAZARO,1 DENISE NANICHE,' NATHALIE SIGNORET,1 ANNE-MARIE BERNARD,' DIDIER MARGUET,1 DAVID KLATZMANN,2 TATJANA DRAGIC,3 MARC ALIZON,3 AND QUENTIN SATTENTAUl* Centre d'Immunologie de Marseille-Luminy, Marseille, 1 Laboratoire de Biologie et Genetique des Pathologies Immunitaires, Centre National de la Recherche Scientifique URA 1463, Hopital de la Pitie-Salpetriere, Paris,2 and Institut National de la Sante et de la Recherche Medicale U332, Institut Cochin de Genetique Moleculaire, Paris,3 France Received 2 May 1994/Accepted 18 July 1994

It has been proposed recently that the cell surface peptidase CD26 acts in concert with CD4, the human immunodeficiency virus (HIV) primary receptor molecule, to mediate HIV entry into permissive cells. We have failed to detect significant levels of CD26 cell surface expression and enzymatic activity in a number of commonly propagated human CD4+ cell lines, although CD26 mRNA was present at very low levels, as detected by reverse transcription PCR. No relationship existed between the expression of CD26 and the ability of these cells to be infected with HIV or to fuse to form syncytia. We have tested two inhibitors of CD26 enzymatic activity and several anti-CD26 monoclonal antibodies and found that they inhibit neither HIV infection nor HIV-induced syncytium formation. NIH 3T3 cells stably transfected with the cDNAs for human CD4 and CD26 expressed these molecules at the cell surface and had CD26 enzymatic activity. Inoculation of the double transfectants with HIV did not result in virus entry above the background level, as verified by PCR amplification of viral DNA. We were unable to recover infectious virus from the HIV-inoculated NIH 3T3 double transfectants either by transfer of supernatants or by cocultivation with human CD4+ indicator cells. Moreover, the transfectants did not fuse with HIV-infected cells to form syncytia, nor were syncytia observed in HIV-inoculated cultures. These results are inconsistent with the CD26 molecule being a cofactor for entry of HIV in CD4+ cells.

Infection of cells by the human immunodeficiency virus (HIV) is initiated by an interaction between the virus receptor, CD4, and the virus surface envelope glycoprotein, gpl20. The initial step of virus-receptor binding is well understood; gpl20 binds with high affinity to a region located on the first domain of CD4 known as the CDR-2 loop (reviewed in reference 56), which projects from the surface of CD4 domain 1 and probably inserts into a cleft in gp120 (reviewed in references 41 and 56). Subsequent interactions leading to virus-cell membrane fusion are less well understood; gpl2O-CD4 binding leads to conformational changes in gpl20 which result, in cell line-adapted isolates of HIV type 1 (HIV-1), in the complete dissociation of gpl20 from the transmembrane glycoprotein gp4l and the exposure of masked epitopes of gp4l (29, 43, 51, 52). It is thought that these conformational changes represent the initiation of HIV entry by a process termed receptor-mediated activation of virus fusion (2, 42) (reviewed in references 50 and

subsequently been confirmed in a number of laboratories and extended to include cell lines from a variety of species including certain human lines (7, 15-18, 26). Recently, it has been demonstrated that hybridomas formed from fusion of CD4+ HIV-resistant cell lines with HIV-susceptible cell lines are permissive for HIV entry and infection, strongly implying that the inability of HIV to enter certain cells is due to the lack of an accessory factor rather than the presence of a factor conferring resistance (8, 23, 24, 28). Several molecules have surfaced as potential candidates for accessory factors in HIV infection, including major histocompatibility complex class I (20, 27) and class-II (40), LFA-1 (34), undefined molecules of 45 and 80 kDa (33, 49) and 44, 98, and 108 kDa (14, 25), a protease termed tryptase II (30), and most recently, the cell surface peptidase CD26 (12). That the putative accessory factor might have enzymatic activity is an attractive hypothesis for the following reasons. (i) Proteolytic cleavage is implicated in the fusion of other retroviruses (5, 6) (reviewed in reference 60). (ii) Sequence homology exists between the gp120 V3 loop (the HIV major neutralization domain which is involved in HIV entry [reviewed in reference 44]) and a protease inhibitor, trypstatin (30). (iii) There are conserved motifs in the otherwise hypervariable gpl20 V3 loop which correspond to cleavage sites for tryptic or chymotryptic proteases (19, 55), and mutations which disrupt these motifs destroy virus infectivity (47). (iv) The gp120 V3 loop becomes more susceptible to enzymatic cleavage by exogenous proteases after CD4 binding (19, 50, 61). However, aside from the well-characterized cleavage of the gp160 precursor into gp120 and gp4l (reviewed in reference 41), there is no direct

54).

It has been clear for some time, however, that the presence of human CD4 at the surface of a cell is not sufficient for HIV-cell membrane fusion to proceed to the point at which the virion nucleocapsid enters the cell and the infectious cycle begins. This was first demonstrated by Maddon and colleagues (38), who showed that the expression of human CD4 at the surface of transfected murine cells is sufficient to allow virus binding to the cells but not virus entry. This finding has * Corresponding author. Mailing address: Centre d'Immunologie de Marseille-Luminy, Case 906, 13288 Marseille Cedex 9, France. Phone: (33) 91 26 94 94. Fax: (33) 91 26 94 30.

6535

6536

LAZARO ET AL.

evidence demonstrating a requirement for proteolytic cleavage in HIV-induced membrane fusion and virus entry. A very recent report (12), however, implicates the human CD26 molecule as a cofactor of CD4 in the HIV entry pathway. CD26, also known as dipeptidyl peptidase IV (EC 3.4.14.5), is a serine ectopeptidase present in activated CD4+ lymphocytes, which cleaves N-terminal dipeptides with either L-proline or L-alanine at the penultimate position (32, 59, 63). The involvement of this molecule was proposed on the basis of the following experimental data: inhibition of HIV capsid entry into cells by an enzymatic inhibitor of CD26, by gpl20 V3 loop-derived peptides which contain the CD26 cleavage motif, and by anti-CD26 monoclonal antibodies (MAbs) and transfer of HIV permissivity to murine cells by transient transfection with human CD4 and human CD26 cDNAs. In an attempt to confirm these findings, we have investigated the putative role of CD26 in HIV entry using a variety of assay systems. We show that the stable transfection of human CD26 into murine, human CD4-expressing NIH 3T3 cells does not confer susceptibility to HIV infection or HIV-induced membrane fusion and that HIV infection of CD26+ permissive cells cannot be blocked with enzymatic inhibitors of CD26 or anti-CD26 MAbs. In conclusion, our results are inconsistent with a role for CD26 in HIV entry or HIV-induced membrane fusion. MATERIALS AND METHODS

Cell culture. The following nonadherent cell lines were maintained in suspension culture in RPMI 1640 medium supplemented with 10% fetal calf serum (Gibco BRL, Eragny, France) and penicillin and streptomycin at 100 ,ug and 100 U/ml respectively (complete RPMI): human T-cell lines H9 and c8166 (from R. Gallo and M. Popovic, National Institutes of Health, Bethesda, Md.), HPB-ALL (from the Medical Research Council AIDS Directed Programme, London, United Kingdom), MOLT-4 (from P. Beverley, Imperial Cancer Research Fund, London, United Kingdom), Jurkat-TAT (from the NIH AIDS Research and Reference Reagent Program, Rockville, Md.); A3.01 (from T. Folks, Centers for Disease Control and Prevention, Atlanta, Ga.), the Burkitt's lymphoma B-cell line Daudi, stably transfected with the human CD4 cDNA (from D. Blanc and P. Clapham, Chester Beatty Laboratories, London, United Kingdom [16]), and the monocytic/macrophage lines U937 and HL60 (from P. Beverley). Human peripheral blood lymphocytes were cultured in the presence of 1 ,ug of phytohemagglutinin (Welcome Diagnostics, Dartford, United Kingdom) per ml for 5 days and then were enriched for CD4+ cells by magnetic sorting after incubation with a CD4 MAb (IOAT4a; Immunotech, Marseille, France) followed by incubation with sterile anti-mouse immunoglobulin-coated magnetic beads (Immunotech). Other cell lines maintained as monolayer cultures in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (Gibco), penicillin, and streptomycin (complete DMEM) were HeLa (human epidermal carcinoma) cells stably transfected with human CD4 cDNA and the HIV-1 long terminal repeat (LTR) fused to the lacZ indicator gene (4), supplied by the Medical Research Council AIDS Directed Programme, a HeLa env-expressing line stably transfected with the LAI provirus lacking the gag/pol and nef genes (53), NIH 3T3 murine fibroblasts stably transfected with the cDNAs for human CD4 and the HIV-1 LTR-lacZ indicator gene construct termed SC6 (24) and further transfected with the human CD26 cDNA as described below, and a clone of LMTK- murine fibroblasts untransfected or stably transfected with murine CD26 cDNA

J. VIROL.

(22). For detection of cell surface protein or enzymatic activity, all adherent cells were either washed and trypsinized the day before analysis and reseeded in non-tissue culture-treated petri dishes, from which they were easily detachable by gentle pipetting, or suspended directly by treatment with phosphatebuffered saline (PBS) containing 10 mM EDTA. Transfection of SC6 cells with CD26 cDNA. A CD26 expression vector (kindly donated by B. Seed [57]) was cotransfected with PGK-neo (24) (ratio, 20:1) into SC6 cells by calcium phosphate precipitation, and G418-resistant colonies were selected. The SC6 CD26 clone 6 was selected for its high and stable expression of CD26. The SC6 CD26 pool was prepared from about 1,000 discrete colonies and enriched for CD26 expression by indirect immunofluorescent staining and fluorescence-activated cell sorting. Detection of CD26 mRNA. Total RNA from cell lines was isolated by a standard guanidinium thiocyanate method. Then, RNA was phenol extracted and precipitated. For reverse transcription PCR (RT-PCR) amplification of the RNA, 2.5 ,ug of total RNA from different cell lines was transcribed with the Moloney murine leukemia virus RNase H- reverse transcriptase (Gibco BRL) and random hexamer primers (Pharmacia, Uppsala, Sweden) in a 20-,ul reaction volume for 1 h at 42°C. The enzyme was inactivated at 85°C for 5 min, after which 20 pmol of specific oligonucleotide primers was added to the reaction mixture, and the final volume was adjusted to 100 ,ll before addition of Taq DNA polymerase. An initial denaturation step (4 min at 94°C) was followed by 30 cycles of 30 s at 94°C, 2 min at the annealing temperature, and 2 min at 72°C. For each oligonucleotide pair, the annealing temperature was established to avoid background in the controls. The PCR product was separated by agarose gel electrophoresis and visualized by ethidium bromide staining. The primers correspond to positions 1723 to 1742 and 2124 to 2103 of the published human cDNA sequence (21). The gel was blotted and hybridized by conventional techniques (39) using the complete cDNA for murine CD26, which has high sequence homology (96.7%) with human CD26 (22). Cell surface staining of CD26 and detection of CD26 enzymatic activity. The following MAbs were used in this study: anti-CD26 MAbs BA5 (a kind gift from A. van Agthoven [Immunotech]), 4ELIC7 (57) (kindly donated by F. Gotch, Institute of Molecular Medicine, Oxford, United Kingdom), and TA5.9 (33a), MA261 (44a), BG69 (44a), and 134-2C2 (48a) (obtained at the Vth International Workshop on Human Leukocyte Differentiation Antigens, Boston, Mass., 1993); anti-CD4 MAbs IOT4a (Immunotech) and Q4120 (31); and anti-gpl20 V3 loop MAb 110.5 (Genetic Systems, Seattle, Wash.). For surface staining, suspension or adherent cells treated as described above were pelleted and resuspended at 2 x 106/ml in PBS containing 1% fetal calf serum and 0.02% sodium azide (wash buffer) and then added to U-bottom 96-well microtiter plates at 50 [lI per well, and the appropriate dilution of MAb was added. After a 1-h incubation, cells were washed twice in wash buffer and resuspended at a 1/200 dilution of anti-mouse immunoglobulin coupled to phycoerythrin (Immunotech). Following a further 1-h incubation, the cells were washed twice as before and then analyzed on a FACScan (Becton Dickinson) with Consort 30 or Lysis II software. All incubations and washes were carried out on ice or at 4°C. Results were expressed as the mean fluorescence intensity of 10,000 accumulated events. For detection of cell surface enzymatic activity, cells were washed twice in PBS and added to a V-bottom 96-well microtiter plate at 2 x 105 per well in 50 ,ul of PBS. The substrate, 1 mM Gly-Pro p-nitroanalide (46) in 0.1 M Tris, pH

VOL. 68, 1994

8.0, was then added in the absence or presence of 1 mM diprotin A (isoleucyl-prolyl-isoleucine) (58), giving a final reaction volume of 150 RI. Incubation at 37°C for 2 h was terminated by centrifugation and transfer of 100,u of the supernatant to flat-bottom enzyme-linked immunosorbent assay (ELISA) plates. Substrate hydrolysis was determined by measuring optical A405 on an automated microplate spectrophotometer. Infectivity and syncytium formation assays. For the detection of HIV infection of cell lines, 2 x 104 cells (adherent or suspension) were added to U-bottom microtiter plates and pelleted by centrifugation, and the medium was removed. Fifty microliters of a stock of virus-containing supernatant (HX10; obtained from P.-J. Klasse, Chester Beatty Laboratories) was titrated onto the different cell lines to give a multiplicity of infection of approximately 0.1. After a 12-h incubation at 37°C, the cells were washed twice in PBS-10 mM EDTA, treated with EDTA-trypsin (Gibco) for 15 min, washed twice in complete RPMI medium, resuspended in either complete RPMI medium or complete DMEM, transferred to a flatbottom microtiter plate, and incubated at 37°C. Supernatants were removed after 24 h and 4, 8, and 12 days postinfection, and 50 ,u was transferred to replicate plates containing the CD4+ indicator cell line c8166 at 2 x 104 cells per well. At each time point, the cells were washed and trypsinized as described above, and half of the cells were transferred in 50,u of complete medium to a replicate flat-bottom 96-well microtiter plate containing 2 x 104 c8166 cells per well. The c8166 cells cultured in the presence of supematants from the virusinoculated cells or cocultured directly with virus-inoculated cells were grown for 5 days, after which the wells were examined visually for syncytium formation and the supernatants were tested for soluble p24 by a standard p24 ELISA carried out as previously described (43). To measure the ability of the different cell lines to undergo HIV-induced syncytium formation, 50 ,ul of cells at a concentration of 106/ml in either complete RPMI medium or DMEM was added to flat-bottom 96-well microtiter plates. The same number of HIV-1-infected H9 cells at the peak of envelope glycoprotein expression as determined by flow-cytometric analysis (52) was added to each well in 50 RI of medium. The cocultures were examined for cell-cell fusion at various times up to 48 h as determined by the formation of syncytia with more than three nuclei or with a diameter greater than three normal cell diameters. In addition, after 72 h, HeLa CD4 LTR-lacZ cells and SC6 CD26 cells were fixed with 1% formaldehyde for 10 min and stained in a solution of 5-bromo4-chloro-3-indolyl-13-D-galactopyranoside (X-Gal) (Gibco BRL) buffer to locate the transactivation of the HIV LTR by the Tat protein present in the HIV-infected cells. Alternatively, HeLa env-expressing cells were cocultured at a 1:1 ratio with HeLa CD4 LTR-lacZ transfectants or SC6 CD26 transfectants overnight and stained with X-Gal as described above. Detection of HIV entry by PCR amplification of proviral DNA. HeLa CD4 cells were or were not preincubated for 30 min at 4°C with MAb Q4120 (CD4) or BA5 (CD26) at 10 and 100 ,ug/ml, respectively. DNase (Boehringer GmbH, Mannheim, Germany)-treated virus (IIIB isolate) was then added at a multiplicity of infection of 0.01, and the cells were incubated at 37°C for 2 h. The cells were subsequently washed twice in PBS, trypsinized, washed, resuspended in complete DMEM, and incubated at 37°C for 48 h. Two hundred thousand cells were then lysed in 25 mM Tris-125 mM KCl-1% Nonidet P-40-2.5 mg of proteinase K per ml for 2 h at 56°C. PCR amplification using the HIV LTR primers U5-/596 (GATCTC TAGTTIACCAGAGTCAC) and U3+/57 (CACACAAGGC

CD26 AND HIV ENTRY

6537

TACT1TCCCTGA) was performed with 10 [lI of each lysate, giving a PCR product of 540 bp. To estimate the amount of DNA in each sample, PCR amplification of 30 cycles was performed on a further 10,u of the same lysates with,-actin primers. The PCR products were analyzed on an ethidium bromide-stained agarose gel, which was subsequently blotted and hybridized by using the oligonucleotide probe LTR1/R: 496 (GGCTAACTAGGGAACCCACTG). Effects of inhibitors of CD26 enzymatic activity and CD26 MAbs on HIV-induced syncytium formation and infection. To investigate the effect of inhibitors of CD26 enzymatic activity and CD26 MAbs on HIV-induced syncytium formation, semiconfluent monolayers of HeLa CD4 LTR-lacZ cells in flatbottom 96-well microtiter plates were incubated with twofold the final concentration of diprotin A, val-boroPro (a CD26 inhibitor kindly given by J. Adams, Boehringer Ingelheim, Ridgefield, Conn.), or anti-CD26 MAbs in the form of purified immunoglobulin G or ascites for 15 min at 37°C. Ten thousand HIV-1-infected H9 cells were then added to the wells in an equal volume, and the plates incubated at 37°C for 72 h. Cell-cell fusion was determined by incubating the cells with X-Gal as described above and counting the number of bluestaining cells present in each well. To investigate the effects of inhibitors or MAbs on cell-free HIV infection, the following protocol was used. Ten thousand HeLa LTR-lacZ cells in round-bottom 96-well microtiter plates were washed twice in DMEM without fetal calf serum and then incubated with different concentrations of the inhibitors or MAbs in a total volume of 95 ,ul of DMEM (without fetal calf serum) for 30 min at room temperature before the addition of a suspension of HIV in a volume of 5 [lI to give a multiplicity of infection of 0.01. After a 2-h incubation, the cells were washed in PBS and trypsinized as described above and then resuspended in complete DMEM in flat-bottom microtiter plates. After 48 h the cells were fixed and stained with X-Gal as described above, and the number of blue cells in each well was counted. RESULTS Expression of CD26 on human CD4+ cell lines. A number of human CD4+ cell lines which are readily infectable with HIV have previously been reported to be negative for CD26 protein and mRNA by MAb staining and Northern (RNA) blotting respectively (45, 57). We therefore tested these and other human CD4+ cell lines for their CD26 expression and their susceptibility to HIV infection. Included in the panel were seven CD4+ T-cell lines and one B-cell line (Daudi) stably transfected with CD4 (16). As shown in Fig. 1, all cell lines expressed readily detectable quantities of CD4, but only the H9 cells gave a significant signal with the three anti-CD26 MAbs shown. The same pattern of staining was obtained with three other anti-CD26 MAbs (MA261, 134-2C2, and BG69) (data not shown). MAb BA5 gave a weak signal on certain cell lines, an observation reproduced in several experiments and also observed by other workers (61a). This result may explain the previously reported CD26 positivity (12) in lines which we find negative for cell surface protein using anti-CD26 MAbs other than BA5. Note, however, that the data in Fig. 1 are expressed on a logarithmic scale and that the signal with BA5 does not exceed 5 and 6 mean fluorescence units for A3.01 and CEM, respectively, compared with about 30 for H9. In order to demonstrate that the CD26 present on the surface of H9 cells had enzymatic activity, we used a colorimetric assay. Since there is low-level nonspecific cleavage of the enzyme substrate (Gly-Pro p-nitroanalide) by certain cell lines, we used the CD26 enzyme inhibitor diprotin A (58); the

J. VIROL.

LAZARO ET AL.

6538

*0

1000-

0

n U

0

100-

*

04120(CD4)

._

0

0

0

._

0 0

10 -

BA5 (CD26) 4ELIC7(CD26) TA5 (CD26)

I~

cis

O.- o

-

0e

4c

0;

I

-13

0.

cell

line

0r

a

FIG. 1. Expression of CD4 and CD26 on the surface of human cell lines. A panel of human cell lines was labeled by indirect immunofluorescent staining with MAbs to CD4 (Q4120) and CD26 (BA5, 4ELIC7, and TA5.9). Staining was analyzed by flow cytometry using a FACScan with Consort 30 software. The data are mean fluorescence intensities for 10,000 accumulated events.

difference between the values obtained in the presence and

absence of the inhibitor gives the CD26 enzymatic activity. All tests were done in the absence of fetal calf serum since it contains soluble CD26 enzyme activity. The phytohemagglutinin-activated CD4-enriched peripheral blood lymphocytes were used as a positive control for CD26 activity and gave a signal 3.5 times that obtained in the presence of the inhibitor

PBL A3.01 0

H9

=

-I

Jurkat =)

c8166 *

M

Daudi CD4

Diprofn A None

HPB-ALL 0 ,0

0,1

0

,2

0,3

OD 405 FIG. 2. Cell surface CD26 enzymatic activity. Selected human cell lines were incubated with the CD26 (dipeptidyl peptidase IV)-specific chromogenic substrate Gly-Pro p-nitroanalide in the presence or absence of 1 mM diprotin A, an inhibitor of CD26 enzymatic activity. The differential in signal between the untreated and the inhibitortreated cells gives the CD26-specific signal as measured by optical density at 405 nm (OD 405). The data are means for three replicate wells. Error bars, 1 standard deviation.

(Fig. 2). The only other cell lines which gave consistently positive results in three representative experiments were H9, with a specific activity of about twice the background (Fig. 2), and HeLa (Fig. 5). Although the results from the cell surface staining and enzymatic activity strongly suggested that H9 was the only CD26 positive cell line in this panel, it seemed important to verify this at the mRNA level since very low levels of protein expression might not be detectable by these techniques. We therefore probed for CD26 mRNA in these cell lines using RT-PCR. DNA was then amplified with a primer pair spanning two distant exons to avoid amplification of genomic DNA. The results presented in Fig. 3A confirm that H9 contained CD26 mRNA; Jurkat-TAT and A3.01 cells also contained a low-level CD26 message, despite having undetectable cell surface protein. Considering that very low levels of CD26 mRNA might be undetectable by ethidium bromide staining of the agarose gel, it was blotted and hybridized with a probe consisting of the entire murine CD26 cDNA. As shown in Fig. 3B, bands corresponding to the PCR-amplified fragment of CD26 mRNA are present in all cell lines. Precise quantification of CD26 mRNA has not been performed, but only very low levels, the functional significance of which is unclear, are observed in cells such as Daudi CD4. Infection and fusion of human cell lines. The human cell lines which we found to be negative for CD26 cell surface protein expression and enzymatic activity are commonly used in HIV infection. However, since there is variation among different clones of these lines and their passage history varies among laboratories, we thought it advisable to test them for infection and HIV-induced syncytium formation. Cells were infected with HIV-1 for 2 h at 37°C, washed, trypsinized to remove noninternalized virus, and cultured for 12 days. At various time points the cells were examined for syncytium formation, and supernatant was taken for soluble p24 measurement; the results for day 8 postinfection are shown in Table 1. In addition, syncytium formation by the different lines upon coculture for 48 h with HIV-infected H9 cells was assayed. It is clear from both assays that all lines tested were

CD26 AND HIV ENTRY

VOL. 68, 1994 7

8

. -_ MD to_ vf

sw

1

3

2

4

5

6

9 10 11 12 13 14 15

A

699

bp

B

507

a.) _ ....

.. bp

FIG. 3. RT-PCR analysis of CD26 mRNA in human cell lines. Equal numbers of the cell lines listed were lysed, and the lysates were subjected to RT-PCR analysis using CD26-specific primers from two different exons to avoid amplification of genomic DNA. (A) The PCR products were analyzed on an agarose gel and stained with ethidium bromide. (B) The gel was blotted onto nitrocellulose, probed with full-length murine CD26 cDNA, and exposed to film for 4 h. (C) The lysates were PCR amplified with P-actin primers to estimate the quantity of cellular RNA in each lysate. The lanes were loaded with the cell lysates as follows: 1, LMTK-; 2, no-lysate control; 3, LMTK-; 4, c8166; 5, HPB-ALL; 6, MOLT-4; 7, HL60; 8, U937; 9, molecular weight markers; 10, CEM; 11, Daudi CD4; 12, A3.01; 13, Jurkat; 14, H9; 15, M14T murine CD26+ BALB/c thymoma.

highly permissive for HIV infection with the exception of the negative-control CD4- T-cell line A2.01 (Table 1). Variation was observed in the ability of the different lines to produce new virus and to undergo cell-cell fusion when they were cocultivated with HIV-infected cells, but this was not related to CD26 expression. Effects of CD26 inhibitors and MAbs on HIV infection. Undetectable CD26 expression or activity at the surface of HIV-permissive cell lines implies that CD26 may not be required for HIV entry. However, considering that CD26 mRNA was present in all lines, it could be argued that low-level surface protein, undetectable by conventional means, could be sufficient to allow HIV infection. Additional evidence supporting a role for CD26 in the infection of CD4+ cells by HIV is the previously reported interference of CD26 inhibitors with HIV infection (12). In order to investigate this effect, we have tested two enzymatic inhibitors of CD26, diprotin A and TABLE 1. HIV infection of human CD4+ cell lines Cell line

CD4 expression'

CD26 expressione

Virus titerb (10-3/ml)

Syncytium formationc

c8166 H9 A3.01 HPB-ALL Jurkat MOLT-4 CEM Daudi CD4 A2.01

++ + +++

-

6.25 1.25 31.25

+++ +

+++ ++ ++

+ -

-

1.25 6.25

+ +++

1.25

+ ++

++

-

6.25

++

+

-

6.25 0

++ -

-

I Measured by immunofluorescent staining and flow cytometry. Mean fluorescence units: +++, >400; ++, 100 to 400; +, 5 to 100; -, 80%; ++, 25 to 80%; +, 5 to 25%; -, none.

6539

a novel inhibitor, val-boroPro (35), and several anti-CD26 MAbs. We also included an anti-CD4 MAb (Q4120) which blocks HIV-CD4 binding (31) and dextran sulfate, a sulfated polysaccharide which is thought to interfere with HIV infection at both the virus-binding step and the post-virus-binding step (10, 36). For the HIV inhibition studies, we used HeLa CD4 LTR-lacZ cells since they express CD26 protein and enzymatic activity and allow quantification of HIV infection inhibition within one cycle of infection without the requirement for the production and release of new virions. This represents an important advantage over conventional tests that require measurement of soluble p24 after several days, since in such assays inhibitors might interfere with virus replication postentry or may be cytostatic or cytotoxic. The results are summarized in Fig. 4. Unlike the potent inhibition of HIV infection observed with the anti-CD4 MAb Q4120, the antiCD26 MAb BAS had no effect. We have tested five other anti-CD26 MAbs (TA5.9, 4ELIC7, MA261, BG-69, and 1342C2), none of which had any specific inhibitory activity with respect to HIV infection in this system (data not shown). Diprotin A is a competitive inhibitor of CD26 enzymatic activity and, in our hands, inhibits cell surface CD26 activity in the high micromolar range. We were unable to demonstrate any interference of HIV infection of the HeLa CD4 LTR-lacZ cells with concentrations of this inhibitor as high as 10 mM (Fig. 4). val-boroPro, a highly potent inhibitor of CD26 activity (35), induces complete inhibition of H9 and HeLa CD26 activity within the high nanomolar range. In some experiments, including that of Fig. 4, we found a partial effect of this compound on HIV infection of HeLa CD4 LTR-lacZ cells at the highest dose used (30 ,uM). It seems unlikely, however, that this effect is specific, since at doses 3- to 300-fold less, which completely inhibit the enzymatic activity, we saw no effect on HIV infection. Dextran sulfate completely inhibited HIV infection of the HeLa CD4 LTR-lacZ cells at 10 jiM (Fig. 4). Therefore, no evidence was found for a direct effect of the inhibitors on HIV entry and replication. Additionally, we tested the effects of the inhibitors and the four anti-CD26 MAbs described above on HIV-induced syncytium formation in a cocultivation assay between HIV-infected H9 cells and uninfected H9 or HeLa CD4 LTR-lacZ cells; no syncytium inhibition was observed (data not shown). Expression of CD4 and CD26 in murine NIH 3T3 cells. The initial observation suggesting that a cofactor additional to CD4 is required for HIV entry came from studies in which transfection of CD4 into murine cell lines resulted in CD4 expression and virus binding but did not confer permissivity to virus entry (38). Recently, Callebaut et al. (12) reported that the transient cotransfection of the cDNAs for CD4 and CD26 into the murine cell line NIH 3T3 resulted in permissivity for virus entry and low-level replication. Since the levels of protein expression achieved by the transient transfection protocol are relatively low and reproducibility from one experiment to another can be poor, we made stable transfectants of the same cell line with the CD4 and CD26 cDNAs. A derivative of the parental NIH 3T3 line called SC6, which is stably transfected with the cDNA for CD4 (24), was cotransfected with the CD26 cDNA. The expression of the CD4 and CD26 proteins was verified as previously described. Figure 5 shows the flowcytometric profiles of the SC6 transfectants stained with an anti-CD4 MAb (13B.8.2) or with three anti-CD26 MAbs (TAS.9, 4ELIC7, and BA5). The SC6 parental line was completely negative for CD26 expression, whereas a clone (clone 6) of the double transfectants (SC6 CD26) was 90% positive for CD4 and 84% positive for CD26 (stained with TA5.9). Moreover, the fluorescence intensity for CD26 staining was

6540

LAZARO ET AL.

..

J. VIROL.

120- BA5 100so

60-

....,-..,................ :.

.......

40-

.,,.. .........

..

...........

40-

10

1

O,1

z

......

.

........-.

50

5

...............

0,5

1201 Dextran sulphate

120- val-boroPro

100-

T

6

U

w-

s0-

w-

60-

Q.-

40 -

0 CL

.

... ...

(jig/mi)

0

> 0

............

......

....

500

0,01

Concentration

......

.,...,....... .......

0

20 0

1

0-

30

3

1 00

0,3 0,03

Concentration

1o

1

0,1

(gM)

120- Diprotin A 100-

20

60

10

1

0,1

Concentratlon

0,01

(mM)

FIG. 4. Effects of CD26 inhibitors on HIV infection of HeLa cells. HeLa CD4 LTR-lacZ cells were incubated with the concentrations of inhibitors or MAbs shown and then with HIV plus inhibitors. Two hours later the cells were trypsinized to remove noninternalized virus and cultured for 48 h before being stained with X-Gal. The data are numbers of blue-staining foci per three replicate wells. Error bars, 1 standard deviation.

relatively high, comparable in our hands to that obtained with phytohemagglutinin-activated human CD4+ peripheral blood lymphocytes (data not shown). We also tested the transfectants for CD26 enzyme activity as described above; HeLa CD4 LTR-lacZ cells were used as a positive control for human CD26 activity, and the murine fibroblast line LMTK-, either untransfected or transfected with the murine CD26 cDNA, was used as an internal reference (22). As expected, the LMTK- transfectants were positive for enzymatic activity, and low-level activity was also detected on HeLa cells (Fig. 5). It is noteworthy that in our hands diprotin A is a potent and specific inhibitor of murine CD26 enzymatic activity (Fig. 5; also unpublished data for recombinant, soluble murine CD26), an observation in conflict with that recently reported by Callebaut et al. (12). The parental SC6 cells were negative, whereas the CD4 CD26 clone (clone 6) and an SC6 CD26 pool enriched for CD26 expression were positive (Fig. 6), a result confirmed in three

independent experiments. Additionally, the presence of CD26specific mRNA was verified by RT-PCR as described for the human cell lines; both the SC6 CD26 clone and the pool were clearly positive (data not shown). Infection and fusion of transfectants. Our initial test for HIV entry was to use PCR amplification of infectious viral DNA after incubation of the cells with HIV. Its advantages over those relying on infectious-virus production are (i) high sensitivity and (ii) the lack of influence of a cellular block to HIV replication post-RT on the readout. Analysis of the PCR products by agarose gel staining revealed that, at 48 h postinfection, only the HeLa CD4 cells contained detectable levels of HIV DNA (Fig. 7A). Preincubation of HeLa CD4 cells with the anti-CD4 MAb Q4120 completely inhibited the signal, whereas the CD26 MAb BA5 had no obvious effect. Blotting of the gel followed by hybridization to an oligonucleotide probe corresponding to a conserved region of the HIV LTR confirmed the specificity of the bands and, in addition, revealed a

VOL. 68, 1994

CD26 AND HIV ENTRY

6541

B

0,

0

S-

2

C

D no mAb

4Elic7 AC ;/0~~IlSAZ

._

TA5.9

I-

fluorescence

intensity

FIG. 5. Expression of CD4 and CD26 at the surface of transfected NIH 3T3 cells. H9 cells or NIH 3T3 cells previously resuspended by trypsinization were labeled with a MAb to CD4 (13B.8.2) or MAbs to CD26 (BA5, 4ELIC7, and TA5.9) by indirect immunofluorescent staining and analyzed by flow cytometry on a FACScan using Lysis II software. The histograms represent the acquisition of 10,000 events for each of the different MAbs. (A) H9 stained with anti-CD26 MAbs; (B) H9 stained with the anti-CD4 MAb; (C) SC6 parental line stained with anti-CD26 MAbs; (D) SC6 parental line stained for CD4; (E) SC6 cotransfected with the human CD26 cDNA (clone 6) stained with anti-CD26 MAbs; (F) SC6 cotransfected with the human CD26 cDNA (clone 6) stained for CD4.

faint band in the lane containing the HeLa (CD4-) sample (Fig. 7B). It is unlikely that this represents contamination of the cell lysates with HIV DNA from the input virus, since at earlier time points (time zero and 24 h) such bands were not present (data not shown). Thus, there may be a low level of very inefficient HIV entry and replication in normal HeLa cells. Whether or not this is the case, we found no evidence from this experiment that the expression of CD26 influenced HIV entry. An event taking place prior to HIV nucleocapsid entry into the cell cytoplasm is virus-cell membrane fusion. HIV-induced cell-cell fusion resulting in syncytium formation is generally thought to proceed by essentially the same mechanism (41, 54) and thus provides a rapid test for receptor-specific, virus-

induced membrane fusion. Syncytium formation was readily apparent when HIV env-expressing HeLa cells were cocultured with HeLa CD4 LTR-lacZ cells but not when they were cocultured with SC6 cells or SC6 CD26 cells (Fig. 8). To control for LTR-lacZ activity in NIH 3T3 cells, HeLa env cells were fused with the NIH 3T3 transfectants by using polyethylene glycol; blue foci were clearly evident (Fig. 8). The same pattern of results was obtained when HeLa env cells were substituted by HIV-1-infected H9 cells (data not shown). Callebaut et al. (12) reported that HIV inoculation of NIH 3T3 cells transiently transfected with the CD26 and CD4 cDNAs resulted in virus entry and low-level virus replication. The detection of infectious virus in these cultures implies that the cells were permissive for productive HIV infection. We

J. VIROL.

LAZARO ET AL.

6542

SC6 WT SC6-CD26 clone #6 U, c

SC6-CD26 pool

._

U

Hela CD4 LMTK-WT

0

Diprotin A

*

none

LMTK-CD26 I

I

I

I

I

0,0

0,1

0,2

0,3

0,4

H 0,5

OD 405 FIG. 6. CD26-specific enzymatic activity associated with the NIH 3T3 transfectants. NIH 3T3 cells transfected with CD4 (SC6 parental) or CD4 and CD26 (clone 6 and pool) were incubated with the CD26-specific chromogenic substrate Gly-Pro p-nitroanalide in the presence or absence of 1 mM diprotin A, an inhibitor of CD26 enzymatic activity. The differential between the inhibitor-treated- and the untreated-cell values gives the CD26-specific signal as measured by optical density at 405 nm (OD 405). The data are means for three replicate wells. Error bars, 1 standard deviation.

find that NIH 3T3 CD4 (SC6) cells are relatively refractile to HIV replication even after transfection with an infectious provirus (24; unpublished data). However, we felt it important to attempt to reproduce the results described by Callebaut and colleagues. We therefore inoculated with HIV-1 cultures of CD26-transfected or untransfected SC6 cells in parallel with 1

B

2

3

4

5

6

7

8

9 10

11 12 13 14

[

IL.,% 507bp FIG. 7. PCR detection of HIV DNA. Cells were preincubated in the presence or absence of the anti-CD4 MAb Q4120 or the anti-CD26 MAb BA5 before incubation with DNase-treated HIV at a multiplicity of infection of 0.01 for 2 h at 37°C. After washing and trypsinization, the cells were cultured for 48 h before further trypsinization and lysis. After the PCR (30 cycles) the samples were analyzed on 1.5% agarose gels containing ethidium bromide. (A) The lysates were PCR amplified with HIV-specific primers. (B) The gel was blotted by using an HIV-specific probe, and the blot was autoradiographed. (C) The lysates were PCR amplified with ,-actin primers to estimate total cellular DNA. Lanes: 1, 4 x 104 8E5 cells (containing one copy of HIV proviral DNA per cell); 2, internal PCR control; 3, uninfected HeLa cells (CD4-); 4, infected HeLa cells (CD4-); 5, uninfected HeLa CD4 cells; 6, infected HeLa CD4 cells; 7, infected HeLa CD4 cells pretreated with the anti-CD4 MAb Q4120 (10 ,ug/ml); 8, infected HeLa CD4 cells pretreated with the anti-CD26 MAb BA5 (100 ,ug/ml); 9, uninfected NIH 3T3 cells; 10, infected NIH 3T3 cells; 11, uninfected SC6 cells (NIH 3T3 CD4); 12, infected SC6 cells; 13, uninfected SC6 CD26 cells; 14, infected SC6 CD26 cells. Note that the DNA from lane 9 (panel C) was undetectable in this experiment.

HeLa CD4+ cells as a positive control. Despite using a relatively high multiplicity of infection of 1 for an extended period of inoculation to allow for slow rates of entry before washing and trypsinization of the cells and cocultivation of the supernatants and cells with the indicator line c8166, we were unable to detect any virus production at any time postinoculation in either of the CD26-transfected SC6 lines, with the exception of certain lines on day 1 postinfection (Table 2). HIV was detected on day 1 at a very low titer in HeLa cells, SC6 parental cells, and the SC6 CD26 pool, but not the SC6 CD26 clone, and only in the context of the cells, not the supernatant. Thus, the presence of CD26 does not appear to influence the production of virus at this early time point, and the presence of low levels of infectious HIV recovered 24 h after infection probably represents a small population of virions protected from trypsinization but not necessarily internalized by the normal route of HIV entry. DISCUSSION According to the current concept of accessory factors which might act to complement CD4 in mediating HIV infection, they should satisfy the following criteria: they should consist of a family of molecules or a single polymorphic species in order to account for the large variation in the permissivity of HIV for different cell types of human origin or of different species (41, 54, 62), they should be expressed on all but very few primate cells (15, 16, 60) but not expressed on most nonprimate cells (7, 16, 37, 38), and coexpression of such factors with human CD4 in cells nonpermissive for HIV entry should confer permissivity to HIV entry and susceptibility to HIV-induced cell-cell fusion (8, 23, 24, 28). CD26 alone fails to meet the first criterion and, as presented here, appears to fulfill neither the second nor the third. Our finding that a number of CD4+ human cell lines which are commonly used for HIV infection express undetectable levels of CD26 protein and enzymatic activity but are weakly positive for CD26 mRNA does not allow us to draw unequivocal conclusions concerning the role of CD26 in HIV infection; these lines may express undetectable but sufficient CD26 to allow infection. One finding which argues against a critical role of CD26 in HIV infection of these cells is that the variation observed in their permissivity to HIV infection and syncytium formation does not correlate with the levels of CD26 expression; H9 cells which express readily detectable levels of CD26 protein are not more permissive for HIV infection and HIVinduced syncytium formation than other lines such as MOLT-4, c8166, HPB-ALL, Daudi CD4, and A3.01, which express no detectable CD26. Our observation that all of the human cell lines tested in this study contain CD26 mRNA is not in agreement with a previous report (57) in which mRNA was detected in H9 cells but not in two other lines used in our study, MOLT-4 and Daudi. This inconsistency probably reflects the higher sensitivity of the PCR method for detecting mRNA than the conventional Northern blotting used previously (57). In another investigation (45), cell surface CD26 expression was detected by immunofluorescent staining with a MAb (1F7) on H9 cells but not on CEM, HPB-ALL, or Jurkat cells, in agreement with our findings. Weak staining was, however, seen on Daudi and MOLT-4, cell lines which we find negative. It therefore seems likely either that there is variability in CD26 expression between different clones of these cell lines, which may explain the discrepancy between our study and that of Callebaut et al. (12), who reported CD26 protein expression on three lines (CEM, MOLT-4, and Jurkat) that we find negative, or that

VOL. 68, 1994

-JaX~ .*;

a

h

v

:

l,,;-

..

*

FIG. 8. Syncytium formation in NIH 3T3 transfectants. HeLa env-expressing cells were cocultured with the following cells for 48 h before fixation and staining with X-Gal: HeLa CD4 LTR-lacZ (a), NIH 3T3 CD4 SC6 cells (c and d), NIH 3T3 CD4 LTR-lacZ CD26 cells (clone 6) (e and f), NIH 3T3 CD4 LTR-lacZ CD26 cells (pooled population) (g and h), and HeLa CD4 LTR-lacZ cells alone (b). Cocultures d, f, and h were treated with polyethylene glycol to induce HIV-independent fusion.

CD26 MAbs give different staining patterns on different human cell lines. A second line of evidence implicating CD26 in HIV entry comes from the demonstration that an inhibitor of CD26 enzymatic activity, diprotin A, and anti-CD26 MAbs interfered with HIV replication (12). We have tested diprotin A and another novel and far more potent inhibitor of CD26 activity, val-boroPro, and find no evidence of specific inhibition of HIV infectivity or HIV-induced syncytium formation. Additionally, we find no effect of CD26 MAbs, including MAb BA5, reported by Callebaut et al. to inhibit HIV entry (12), on the virus life cycle. It should be noted that at high concentration, such as that used in the previous study (12), relatively hydro-

phobic compounds such as diprotin A may interact directly with the cell and virus membranes and thus may influence virus infection in ways unrelated to CD26 function. The final piece of evidence supporting the role of CD26 as a CD4 cofactor in cellular permissivity to HIV is the previously reported ability of this molecule to render murine NIH 3T3 cells permissive to HIV infection (12). In the present study we have attempted to reproduce this finding by stably transfecting NIH 3T3 cells with the CD4 and CD26 cDNAs, and we have tested them for HIV entry by PCR amplification of viral DNA, HIV infection, and HIV-induced cell-cell fusion. We find no evidence that the expression of CD26 influences these events in any way.

6544

J. VIROL.

LAZARO ET AL. TABLE 2. HIV infection of transfected cell lines Virus titer" (10-1/ml) the following number of days postinfection: 1 4 12

Cell line

HeLa HeLa CD4 SC6 SC6 CD26 poold

SUPb

Cellsc

SUP

Cells

SUP

Cells

0

1 1 1 1

0 5 0 0

0 125 0 0

0 125 0 0

0 125 0 0

1 0

0

a Derived from the final dilution of virus inoculated into the target cells giving syncytia and a positive p24 signal in the c8166 cell cultures. b Cells were infected, washed, and trypsinized as described in the text. Then, at the times indicated, supernatants (SUP) were taken from the cultures and incubated with c8166 cells. After 5 days, the c8166 cells were examined visually for the presence of syncytia, and the supernatants from the c8166 cultures were tested for soluble p24 activity. c Cells were infected, washed, and trypsinized as described in the text. Then, at the times indicated, the cells were again trypsinized and cocultured with c8166 cells. After 5 days the c8166 cells were examined visually for syncytium formation, and the supernatants from the cocultures were tested for p24 activity. d All titers for the SC6 CD26 clone 6 were 0.

It is difficult to reconcile our data with those of Callebaut et al., who reported inhibition of HIV entry by CD26 inhibitors and CD26 MAbs and significant levels of HIV entry into NIH 3T3 cells only when they coexpress human CD4 and CD26. One important difference is that the assay system used by Callebaut et al. to measure HIV entry, in which virus nucleocapsid entry into the cells was detected by direct assay of viral p24 in cell lysates 24 h after inoculation (12), differs significantly from our assays. These authors detected infectious virus in the supernatants of the transfected NIH 3T3 cells at 24 h after the inoculation, implying that infectious virions were being released from the cells. Although these experiments apparently contained the appropriate controls, we are nevertheless concerned that, since the transfected NIH 3T3 cells in their study were incubated with a very large amount of virus for 6 h, much of this inoculum will have been protected from the action of trypsin by endocytosis into cytoplasmic vesicles (endosomes) following virus binding to CD4 and/or nonspecific uptake of virus or virion components. The fate of virus particles internalized by this route is unclear, but they may be degraded within lysosomes, retained in a viable state within endosomes, or both. Either of these possibilities could account for the detection of viral core protein inside the cell after inoculation, and endosomal recycling to the cell surface could explain the release of infectious virus particles at extended times after inoculation. High concentrations of agents such as diprotin A might inhibit the endocytic pathway and thus give the impression of interfering with HIV entry. Whether or not this is the case, our finding that NIH 3T3 cells stably expressing high levels of CD4 and CD26 are refractile to relatively high doses of infectious virus argues strongly against productive entry of virions into these cells. At a theoretical level, it is unclear how CD26 could be envisaged to cleave the V3 loop of gpl20, as proposed by Callebaut et al., for the following reasons. (i) CD26 has exoprotease activity, cleaving two amino acids from the amino terminus of a peptide chain (32, 59, 63). This has been experimentally demonstrated in the HIV system, since purified human CD26 neither cleaves (12) nor binds to (52a) recombinant gp120. (ii) The amino acid sequence of the active site of CD26 is highly conserved between humans and mice, both molecules have the same substrate specificity, and the activities of both are blocked by the same inhibitors (22; unpublished

data). Murine CD26 is, however, unable to promote HIV infection when coexpressed in murine cells with human CD4 (unpublished data). (iii) Anti-CD26 MAbs which were reported to inhibit HIV entry into CD4+ CD26+ cells do not interfere with the enzymatic activity of this molecule (45). Very recently four groups presented evidence that CD26 is not a cofactor for HIV entry into CD4+ cells (1, 9, 13, 48). Broder and colleagues (9) demonstrate that transient, vaccinia virus-driven expression of human CD4 and CD26 in NIH 3T3 does not render these cells permissive for gpl60-induced syncytium formation and that enzymatic inhibitors of CD26 activity do not interfere with gp160-induced syncytia in human CD4+ cells. Patience et al. (48) showed that mink and cat cell lines stably expressing human CD4 and CD26 are nonpermissive for HIV-1 infection and that the presence of human CD26 does not influence HIV-2 infection. Camerini et al. (13) demonstrated the lack of permissivity for HIV infection or syncytium formation in murine or simian cell lines transiently expressing CD4 and CD26, and Alizon and Dragic (1) presented negative data concerning PCR detection of HIV entry in CD4 and CD26 stably transfected NIH 3T3 cells. Although each of these studies is limited and has been criticized (11), taken together they present a very strong case against a role for CD26 involvement in HIV entry. Although we are unable to formally conclude in the present study that human CD26 plays no role in the entry of HIV into CD4+ cells, we demonstrate that any involvement must be at a subtle and dispensable level. Since the putative CD4 accessory factors involved in HIV entry have been refractile to cloning by conventional molecular biology techniques (3), it seems likely that they either may be proteins consisting of more than one polypeptide chain or may not be proteinaceous in nature. Indeed, recent evidence from our laboratory suggests that these accessory factors are likely to be nonproteinaceous, since human CD4+ murine NIH 3T3 cells can be rendered susceptible to HIV-induced membrane fusion by fusion with pronasetreated human erythrocyte ghosts (23a). ACKNOWLEDGMENTS We thank A. van Agthoven for the kind gift of MAb BA5, F. Gotch for MAb 4ELIC7, J. Adams and T. A. Kelly for val-boroPro, and B. Seed for the CD26 plasmid. I.L. is in receipt of a European Community grant. This work was supported jointly by CNRS and INSERM and by grants from ANRS.

REFERENCES 1. Alizon, M., and T. Dragic. 1994. CD26 antigen and HIV fusion? Science 264:1161-1162. 2. Allan, J. S. 1991. Receptor-mediated activation of immunodeficiency viruses in viral fusion. Science 252:1322. 3. Allen, J. K. Unpublished data. 4. Akrigg, A., G. W. G. Wilkinson, S. Angliss, and P. J. Greenaway. 1991. HIV-1 indicator cell lines. AIDS 5:153-158. 5. Andersen, K. B. 1987. Cleavage fragments of the retrovirus surface protein gp7O during virus entry. J. Gen. Virol. 68:2193-2202. 6. Andersen, K. B. 1987. Leupeptin inhibits retrovirus infection in mouse fibroblasts. J. Virol. 48:765-769. 7. Ashorn, P. A., E. A. Berger, and B. Moss. 1990. Human immunodeficiency virus envelope glycoprotein/CD4 mediated fusion of nonprimate cells with human cells. J. Virol. 64:2149-2156. 8. Broder, C. C., D. S. Dimitrov, R. Blumenthal, and E. A. Berger. 1993. The block to HIV-1 envelope glycoprotein-mediated membrane fusion in animal cells expressing human CD4 can be overcome by a human cell component(s). Virology 193:483-491. 9. Broder, C. C., 0. Nussbaum, W. G. Gutheil, W. W. Bachovchin, and E. A. Berger. 1994. CD26 antigen and HIV fusion? Science 264:1156-1159. 10. Callahan, L. N., M. Phelan, M. Mallison, and M. A. Norcross.

VOL. 68, 1994

1991. Dextran sulfate blocks antibody binding to the principal neutralizing domain of human immunodeficiency virus type 1 without interfering with gpl20-CD4 interactions. J. Virol. 65: 1543-1550. 11. Callebaut, C., E. Jacotot, B. Krust, and A. G. Hovanessian. 1994. CD26 antigen and HIV fusion? Science 264:1162-1165. 12. Callebaut, C., B. Krust, E. Jacotot, and A. G. Hovanessian. 1993. T cell activation antigen CD26 as a cofactor for entry of HIV in CD4+ cells. Science 262:2045-2050. 13. Camerini, D., V. Planelles, and L. S. Y. Chen. 1994. CD26 antigen and HIV fusion? Science 264:1160-1161. 14. Chen, Y.-H., C. Ebenrichler, R Vornhagen, T. F. Schulz, F. Steindl, G. Bock, H. Katinger, and M. P. Dierich. 1992. HIV-1 gp4l contains two sites for interaction with several proteins on the helper T-lymphoid cell line, H9. AIDS 6:533-539. 15. Chesebro, B., R Buller, J. Portis, and K. Wehrly. 1990. Failure of human immunodeficiency virus entry and infection in CD4-positive human brain and skin cells. J. Virol. 64:215-221. 16. Clapham, P. R, D. Blanc, and R A. Weiss. 1991. Specific cell surface requirements for infection of CD4 positive cells by human immunodeficiency virus type 1, type 2 and simian immunodeficiency virus. Virology 181:703-715. 17. Clapham, P. R, A. McKnight, and R A. Weiss. 1992. Human immunodeficiency virus type 2 infection and fusion of CD4negative human cell lines: induction and enhancement by soluble CD4. J. Virol. 66:3531-3537. 18. Clapham, P. R, J. N. Weber, D. Whitby, K. McIntosh, A. G. Dalgleish, P. J. Maddon, K. C. Deen, R W. Sweet, and R A. Weiss. 1989. Soluble CD4 blocks the infectivity of diverse strains of HIV and SIV for T cells and monocytes but not for brain and muscle cells. Nature (London) 337:368-370. 19. Clements, G. J., M. Price-Jones, P. E. Stephens, C. Sutton, T. F. Schultz, P. R Clapham, J. A. McKeating, M. 0. McClure, S. Thompson, M. Marsh, J. Kay, R A. Weiss, and J. P. Moore. 1991. The V3 loops of the HIV-1 and HIV-2 surface glycoproteins contain proteolytic cleavage sites: a possible function in viral fusion? AIDS Res. Hum. Retroviruses 7:3-16. 20. Corbeau, P., D. Olive, and C. Deveaux. 1991. Anti-HLA class-I heavy chain monoclonal antibodies inhibit human immunodeficiency virus production by peripheral blood mononuclear cells. Eur. J. Immunol. 21:865-871. 21. Darmoul, D., M. Lacasa, L. Baricault, D. Marguet, C. Sapin, P. Trotot, A. Barbat, and G. Trugnan. 1992. Dipeptidyl peptidase IV (CD26) gene expression in enterocyte-like colon cancer cell lines HT-29 and Caco-2. J. Biol. Chem. 267:4824-4833. 22. David, F., A.-M. Bernard, M. Pierres, and D. Marguet. 1993. Identification of serine 624, aspartic acid 702 and histidine 734 as the catalytic triad residues of mouse dipeptidyl-peptidase IV (CD26). J. Biol. Chem. 268:17247-17252. 23. Dragic, T., and M. Alizon. 1993. Different requirements for membrane fusion mediated by the envelopes of human immunodeficiency virus types 1 and 2. J. Virol. 67:2355-2359. 23a.Dragic, T., and M. Alizon. Unpublished data. 24. Dragic, T., P. Charneau, F. Clavel, and M. Alizon. 1992. Complementation of murine cells for human immunodeficiency virus envelope/CD4-mediated fusion in human-murine heterokaryons. J. Virol. 66:4794-4802. 25. Ebenbichler, C. F., C. Roder, R Vornhagen, L Ratner, and M. P. Dierich. 1993. Cell surface proteins binding to recombinant soluble HIV-1 and HIV-2 transmembrane proteins. AIDS 7:489495. 26. Evans, L. A., T. M. McHugh, D. P. Stites, and J. A. Levy. 1987. Differential ability of human immunodeficiency virus isolates to productively infect human cells. J. Immunol. 138:3415-3418. 27. Grassi, F., R Meneveri, G. Gullberg, L. Lopalco, G. B. Rossi, P. Lanza, C. DeSantis, G. Brattsand, S. Butto, E. Ginelli, A. Beretta, and A. G. Siccardi. 1991. Human immunodeficiency virus type 1 gpl20 mimics a hidden monomorphic epitope borne by class-I major histocompatibility complex heavy chains. J. Exp. Med. 174: 53-62. 28. Harrington, R D., and A. P. Geballe. 1993. Cofactor requirement for human immunodeficiency virus type 1 entry into a CD4expressing human cell line. J. Virol. 67:5939-5947.

CD26 AND HIV ENTRY

6545

29. Hart, T. K., R Kirsh, H. Ellens, R W. Sweet, D. M. Lambert, S. R Petteway, J. Leary, and P. Bugelski. 1991. Binding of soluble CD4 proteins to human immunodeficiency virus type-1 and infected cells induces release of envelope glycoprotein gpl20. Proc. Natl. Acad. Sci. USA 88:2189-2193. 30. Hattori, T., A. Koito, K. Takasuki, H. Kido, and N. Katanuma. 1989. Involvement of tryptase-related protease(s) in human immunodeficiency type 1 infection. FEBS Letts. 248:48-52. 31. Healey, D., L. Dianda, J. P. Moore, J. S. McDougal, M. J. Moore, P. Estess, D. Buck, P. D. Kwong, P. C. L. Beverley, and Q. J. Sattentau. 1990. Novel anti-CD4 monoclonal antibodies separate human immunodeficiency virus infection and fusion of CD4+ cells from virus binding. J. Exp. Med. 172:1273-1279. 32. Heins, J., P. Welker, C. Scholein, I. Born, B. Hardrodt, K. L. Neubert, D. Tsuru, and A. Barth. 1988. Mechanism of prolinespecific proteinases: substrate specificity of dipeptidyl peptidase IV from kidney and proline-specific endopeptidase from Flavobacterium meningospeticum. Biochim. Biophys. Acta 954:161-169. 33. Henderson, L, A., and M. N. Quershi. 1993. A peptide inhibitor of human immunodeficiency virus infection binds to novel human cell surface polypeptides. J. Biol. Chem. 268:15291-15297. 33a.Heyligen, H., E. Brepoels, C. Thus, E. Bosmans, and J. Raus. 1985. Monoclonal antibodies detecting human T cell activation antigens. Fed. Proc. 44:787. 34. Hildreth, J. E. K., and R J. Orentas. 1989. Involvement of a leukocyte adhesion receptor (LFA-1) in HIV-induced syncytium formation. Science 244:1075-1078. 35. Kelly, T. A., J. Adams, W. W. Bachovchin, R W. Barton, S. J. Campbell, S. J. Coutts, C. A. Kennedy, and R J. Snow. 1993. Immunosuppressive boronic acid dipeptides: correlation between conformation and activity. J. Am. Chem. Soc. 115:12637-12638. 36. Lederman, S., R Gulick, and L. Chess. 1989. Dextran sulfate and heparin interact with CD4 molecules to inhibit the binding of coat protein (gpl20) of HIV. J. Immunol. 143:1149-1154. 37. Levy, J. A. 1993. Pathogenesis of human immunodeficiency virus infection. Microbiol. Rev. 57:183-289. 38. Maddon, P. J., A. G. Dalgleish, J. S. McDougal, P. R. Clapham, R A. Weiss, and R Axel. 1986. The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell 47:333-348. 39. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 40. Mann, D. L., E. Read-Connole, L. 0. Arthur, W. G. Robey, P. Wernet, E. M. Schneider, W. A. Blattner, and M. Popovic. 1988. HLA-DR is involved in the HIV-1 binding site on cells expressing MHC class-II antigens. J. Immunol. 141:1131-1136. 41. Moore, J. P., B. Jameson, R A. Weiss, and Q. J. Sattentau. 1992. The HIV-cell fusion raction, p. 233-289. In J. Bentz (ed.), Viral fusion mechanisms. CRC Press, Boca Raton, Fla. 42. Moore, J. P., J. A. McKeating, R A. Weiss, P. R Clapham, and Q. J. Sattentau. 1991. Model for receptor mediated activation of immunodeficiency viruses in viral fusion. Science 252:13221323. 43. Moore, J. P., J. A. McKeating, R A. Weiss, and Q. J. Sattentau. 1990. Dissociation of gpl20 from HIV-1 virions induced by soluble CD4. Science 250:1139-1142. 44. Moore, J. P., and P. L. Nara. 1991. The role of the V3 loop of gpl20 in HIV infection. AIDS 5(Suppl. 2):S21-S33. 44a.Morimoto, C. Activation antigens report. In S. Schlossman (ed.), Leukocyte typing V, in press. Oxford University Press, Oxford. 45. Morimoto, C., Y. Torimoto, G. Levinson, C. E. Rudd, M. Schreiber, N. H. Dang, N. L. Letvin, and S. F. Schlossman. 1989. IF7, a novel cell surface molecule, involved in helper function of CD4 cells. J. Immunol. 143:3430-3439. 46. Nagatsu, T., M. Hino, H. Fuyamada, T. Hayakawa, S. Sakakibara, Y. Nakagawa, and T. Takemoto. 1976. New chromogenic substrates for X-prolyl dipeptide-aminopeptidase. Anal. Biochem. 74:466-476. 47. Page, K. A., S. M. Stearns, and D. R Littman. 1992. Analysis of mutations in the V3 domain of gp160 that affect fusion and infectivity. J. Virol. 66:524-533. 48. Patience, C., A. McKnight, P. R Clapham, M. T. Boyd, R A.

6546

LAZARO ET AL.

Weiss, and T. F. Schultz. 1994. CD26 antigen and HIV fusion? Science 264:1159-1160. 48a.Plana, M., 0. Vinas, 0. De la Calle-Martin, F. Lozano, J. InglesEsteve, M. Romero, J. Alberola-Ila, J. Yagiie, R. Vilella, and J. Vives. 1991. Induction of interleukin 2 (IL2) and interferon--y and enhancement of IL2 receptor expression by a CD26 monoclonal antibody. Eur. J. Immunol. 21:1085-1088. 49. Quershi, N. M., D. H. Coy, R. F. Garry, and L. A. Henderson. 1990. Characterisation of a putative cellular receptor for HIV-1 transmembrane glycoprotein using synthetic peptides. AIDS 4:553-558. 50. Sattentau, Q. J. 1992. CD4 activation of HIV fusion. Int. J. Cell Cloning 10:323-332. 51. Sattentau, Q. J., and J. P. Moore. 1991. Conformational changes induced in the human immunodeficiency virus envelope glycoprotein by soluble CD4 binding. J. Exp. Med. 174:407-415. 52. Sattentau, Q. J., J. P. Moore, F. Vinaux, F. Traincard, and P. Poignard. 1993. Conformational changes induced in the envelope glycoproteins of the human and simian immunodeficiency viruses by soluble receptor binding. J. Virol. 67:7383-7393. 52a.Schlossman, S. Personal communication. 53. Schwartz, O., M. Alizon, J.-M. Heard, and 0. Danos. 1994. Impairment of T cell receptor-dependent stimulation in CD4+ lymphocytes after contact with membrane-bound HIV-1 envelope glycoprotein. Virology 198:360-365. 54. Signoret, N., P. Poignard, D. Blanc, and Q. J. Sattentau. 1993. Human and simian immunodeficiency viruses: virus-receptor interactions. Trends Microbiol. 1:328-333. 55. Stephens, P. E., G. Clements, G. T. Yarranton, and J. P. Moore.

J. VIROL.

1990. A chink in HIV's armour? Nature (London) 343:219. 56. Sweet, R. W., A. Truneh, and W. A. Hendrickson. 1991. CD4: its structure, role in immune function and AIDS pathogenesis, and potential as a pharmacological target. Curr. Opin. Biotechnol. 2:622-633. 57. Tanaka, T., D. Camerini, B. Seed, Y. Torimoto, N. H. Dang, J. Kameoka, H. N. Dahlberg, S. F. Schlossman, and C. Morimoto. 1992. Cloning and functional expression of the T cell activation antigen CD26. J. Immunol. 149:481-486. 58. Umazawa, H., T. Aoyagi, K Ogawa, H. Naganawa, M. Hamada, and T. Takeuchi. 1984. Diprotins A and B, inhibitors of dipeptidyl peptidase IV, produced by bacteria. J. Antibiot. 37:422-425. 59. Walter, R., W. H. Simmons, and T. Yoshimoto. 1980. Proline specific endo- and exopeptidases. Mol. Cell. Biochem. 30:111-127. 60. Weiss, R. A. 1992. Cellular receptors and viral glycoproteins involved in retrovirus entry, p. 1-108. In J. A. Levy (ed.), The Retroviridae, vol. 2. Plenum Press, New York. 61. Werner, A., and J. A. Levy. 1993. Human immunodeficiency virus type 1 envelope gpl20 is cleaved after incubation with recombinant soluble CD4. J. Virol. 67:2566-2574. 61a.West, W. Personal communication. 62. Williams, L. M., and M. W. Cloyd. 1991. Polymorphic human gene(s) determines differential susceptibility of CD4 lymphocytes to infection by certain HIV-1 isolates. Virology 184:723-728. 63. Yoshimoto, T., M. Fischl, R. C. Orlowski, and R. Walter. 1978. Post-proline cleaving enzyme and post-proline dipeptidyl aminopeptidase. J. Biol. Chem. 253:3706-3716.