Fibroproliferation in LPS-induced airway remodeling and bleomycin ...

Immunogenetics (2008) 60:353–369 DOI 10.1007/s00251-008-0293-3

ORIGINAL PAPER

Fibroproliferation in LPS-induced airway remodeling and bleomycin-induced fibrosis share common patterns of gene expression David M. Brass & Ivana V. Yang & Marcus P. Kennedy & Gregory S. Whitehead & Holly Rutledge & Lauranell H. Burch & David A. Schwartz

Received: 17 December 2007 / Accepted: 13 March 2008 / Published online: 13 June 2008 # Springer-Verlag 2008

Abstract Chronic LPS inhalation causes submucosal thickening and airway narrowing. To address the hypothesis that environmental airway disease is, in part, a fibroproliferative lung disease, we exposed C57BL/6 mice daily to LPS by inhalation for up to 2 months followed by 1 month of recovery. C57BL/6 mice exposed to daily inhaled LPS Brass and Yang contributed equally to this work and should be considered co-first authors. This work was funded by the Department of Veterans’ Affairs (Merit Review), extramural grants (ES11375, ES07498, and ES09607), and the intramural research programs at NIEHS and NHLBI. Electronic supplementary material The online version of this article (doi:10.1007/s00251-008-0293-3) contains supplementary material, which is available to authorized users. I. V. Yang : H. Rutledge : D. A. Schwartz Laboratory of Environmental Lung Diseases, National Heart, Lung and Blood Institute at the National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709, USA M. P. Kennedy Pulmonary and Critical Care Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA G. S. Whitehead : L. H. Burch Laboratory of Respiratory Biology, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709, USA D. M. Brass (*) Department of Pediatrics/Neonatology, Duke University Medical Center, 403 Alex R. Sands Laboratory Building, DUMC 3373, Durham, NC 27710, USA e-mail: [email protected]

had significantly enhanced mRNA expression of TGF-β1, TIMP-1, fibronectin-1, and pro-collagen types I, III, and IV and show prominent submucosal expression of the myofibroblast markers desmin and α-smooth muscle actin. To further characterize global gene expression in airway fibroproliferation, we performed microarray analysis on total lung RNA from mice exposed to LPS both acutely and chronically. This analysis revealed a subset of genes typically associated with lung injury and repair, and ECM homeostasis. To further identify candidate genes specifically involved in generic fibroproliferation, we interrogated this analysis with genes induced in C57BL/6 mouse lung by bleomycin. This analysis yielded a list of 212 genes in common suggesting that there is a common subset of genes that regulate fibroproliferation in the lung independent of etiologic agent and site of injury. Keywords Extracellular matrix . Lipopolysaccharide . Transforming growth factor beta 1 (TGF-β1) . Asthma . Microarray . Fibrosis . Airway disease

Introduction In a well-established mouse model of environmental airways disease, we have demonstrated that chronic exposure to organic dusts (George et al. 2001) or to lipopolysaccharide (LPS) alone (Brass et al. 2003; Savov et al. 2002) causes repeated episodes of reversible neutrophilic inflammation that results in persistent submucosal thickening and airway remodeling. This mouse model has allowed us to explore the mechanisms that may be associated with airway remodeling in humans observed in chronic inflammatory diseases such as chronic obstructive

354

pulmonary disease (COPD; Hogg et al. 1968) and asthma (Hackett and Knight 2007; Postma and Timens 2006). We have previously hypothesized that the physiological and biological changes in remodeled murine airways resulting from LPS inhalation challenge are dependent on neutrophilic inflammation (Savov et al. 2002). TGF-β is prominently expressed in whole lung lavage fluid (Brass et al. 2003) and in the affected areas of the lung (Savov et al. 2002), and we have also shown significantly elevated cell proliferation in the submucosa of remodeled airways (Brass et al. 2003, 2004) and the involvement of extravascular coagulation in the disease process (Savov et al. 2003). Because these biological features of LPS-induced airway remodeling are also common features of mouse models of lung fibrosis and human idiopathic pulmonary fibrosis (IPF), we hypothesized that the genes in common between localized airway remodeling and parenchymal fibrosis are critical to a generalized fibroproliferative response in the lung. To investigate this hypothesis, we evaluated the transcriptional response in the lung of C57BL/6 mice exposed to LPS by inhalation daily for up to 2 months. Next, we evaluated the transcriptional response induced in C57BL/6 mouse lung by intratracheal bleomycin, and then, to identify genes that might be critical to fibroproliferation, we interrogated the LPS gene expression data with this data set. These data reveal prominent expression of negative regulators of fibroproliferation such as cathepsin K and CXCL10 typically associated with macrophage biology as well as the osteoclast regulators, osteoprotegerin and CCL-9, suggesting the hypothesis that genes involved in bone homeostasis may be involved in ECM homeostasis in the lung.

Materials and methods Study design Mice were obtained from Jackson Laboratories (Bar Harbor, ME) and were housed under pathogen-free conditions in accordance with guidelines set forth by the Duke University Animal Care and Use committee.

Immunogenetics (2008) 60:353–369

LPS preparation, aerosol exposures, and assay LPS (Escherichia coli serotype 0111:B4 from Sigma, St. Louis, MO) preparation and aerosol exposures were as previously described (Hollingsworth et al. 2005) The concentration of airborne LPS was assessed by analyzing air drawn from the exposure chamber as previously described (Hollingsworth et al. 2005) and analyzed for endotoxin using a chromogenic Limulus amoebocyte lysate assay (QCL-1000, BioWhittaker, Walkersville, MD) according to manufacturer’s instructions. Mean daily LPS concentration (EU/m3) was determined to be 4.50±0.20 μg/m3. Tissue preparation Following sacrifice, lungs were perfused with 0.9% saline through the pulmonary artery to remove blood from the vascular bed. The whole right lung was removed and snapfrozen in liquid nitrogen and stored at −70°C for later use. Morphometric analysis The methods used by our laboratory for morphometric analysis has been described previously (Brass et al. 2003, 2004). Briefly, images of all airways from equivalent Masson Trichrome stained transverse bronchial sections were captured using Image-Pro Plus software (Media Cybernetics; Silver Spring MD). Internal airway perimeter, external airway perimeter, and basement membrane perimeter were measured and the area of airway subepithelial tissue was calculated. All airway profiles were divided into three groups—small (≤90 μm), medium (>90–129 μm), and large (>129 μm)—based upon the airway lumen diameter (George et al. 2001). Subepithelial area was normalized to the length of the adjacent basal membrane for every profile. Measurements in each group were then averaged per animal. Data are reported as group mean ± SEM for each airway size of these average values obtained in all animals analyzed. Lung RNA isolation Total RNA was isolated from individual LPS-exposed, bleomycin-exposed, or saline-exposed-control mouse lungs using TRIzol Reagent (Invitrogen Corporation, Carlsbad, CA) according to manufacturer’s instructions.

LPS exposures We exposed male C57BL/6 mice to 5 μg/m3 of inhaled LPS or filtered air for 1 day, 1 week or 4 weeks. Mice exposed for 4 weeks were sacrificed 3 days or 4 weeks after the end of the last day of exposure. Mice were sacrificed as described below.

Real-time (RT) quantitative PCR for mRNA expression

Bleomycin exposures We exposed male C57BL/6 mice to 2 U/kg of intratracheal bleomycin or vehicle alone via oropharyngeal aspiration as previously described (Foster et al. 2001).

RT-PCR was performed using primers specific for mouse procollagen (type Iα2, IIIα1 and type IVα3), TIMP-1, TGF-β1, and Fibronectin 1, (Table 1). 18s RNA primers were used as an internal control. Samples were assayed in


355

Table 1 Primer sequences for RT-PCR Target Collagen I, alpha 2 (Col1a2) Collagen III, alpha 1 (Col3a1) Collagen IV, alpha 3 (Col4a3) Fibronectin 1 (Fn1) Transforming Growth Factor β1 (TGFβ1) Tissue Inhibitor of Metalloproteinase 1 (TIMP-1) 18s rRNA

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Primer sequences

Annealing temp

AACACTGGTAGAGATGGTGCTCGT CACCACGTTCACCAGGGCTA CCCTGGTCCACAAGGATTACA CTCCAGGTGCACCAGAATCA ATGTTCGCAATGACTGGGAAA CTCTGAGAAGCGGGCCATACT AGACAATGCCGTGGTCCTAACA GAGTTGGCGGTGATATCAGAAGA AAGTGTGGAGCAACATGTGGAA CAAGAGCAGTGAGCGCTGAA ATAGCTTCCAGTAAGGCCTGTAGCT GTACCGGATATCTGCGGCATT CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT

60 60 60 62 59 59 58–62

triplicate for each primer set and the value was normalized to the internal control for both the LPS-exposed and airexposed mice.

Midas for lowess normalization. Lowess-normalized data were used in further statistical and clustering analyses carried out in TIGR MeV.

Microarray analysis

Immunohistochemistry

Samples from unexposed animals (n=24), and 1 week LPSexposed mice (n=24) were pooled into groups of three animals each. For microarray analysis of LPS-exposed mice we performed two-color microarray analysis on eight pools of mRNA from three LPS-exposed mice per group and compared these to similar pools from unexposed mice. Each comparison was dye-swap replicated. The microarray results represent 16 microarray hybridizations of a total of eight sample replicates. For microarray analysis of bleomycin treated mice we performed the same analysis as for LPS-exposed mice using four pools of mRNA from two bleomycin treated mice per group and two pools of mRNA from two saline-exposed mice per group. Fluorescently labeled cDNA targets were prepared by reverse transcribing 5 μg of pooled total RNA in the presence of aminoallyldUTP followed by chemical coupling of NHS-esters of cyanine 3 (Cy3) and cyanine (Cy5) to the aminoallyl linker, according to published protocols (Yang et al. 2002). All samples were co-hybridized with the Mouse Universal Cell Line Reference RNA (Stratagene, La Jolla, CA) and hybridizations replicated with the two dyes swapped. We used microarrays containing in situ synthesized 60-mer oligonucleotides with sequences that represent over 20,000 unique well-characterized mouse genes (Agilent Technologies mouse oligo array). Arrays were washed using the recommended SSC washes and scanned on the DNA Microarray Scanner (Agilent Technologies). TIGR TM4 suite of software was used for all analyses (Saeed et al. 2006, 2003). Image analysis was performed using TIGR Spotfinder and integrated intensities exported to TIGR

Immunohistochemistry was performed using the Vectastain ABC Elite goat kit (Vector Laboratories, Burlingame, CA), according to the manufacturers instructions. Cathepsin K (sc-6506) and MMP 12 (sc-8839) were detected using goat polyclonal antisera obtained from Santa Cruz (Santa Cruz Biotechnology, Inc; Santa Cruz, CA). Desmin and αsmooth muscle actin were detected using monoclonal antibodies from Dako (Clone D33) and Sigma (Clone 1A4), respectively. ELISA CXCL9, CXCL10, Osteoprotegerin (OPG), and CCL-9 were detected in whole lung lavage samples as previously described (Brass et al. 2004) using ELISA or duo-set kits (R & D Systems; Minneapolis, MN). Statistical analysis Transcripts that varied in response to LPS or bleomycin compared to indicated controls were identified using significance analysis of microarrays (SAM) with 100 permutations (Tusher et al. 2001). We used k-means clustering to group significant genes into clusters with similar expression patterns. All genes in our analysis that are significantly differentially expressed (either up- or down-regulated) are presented in Tables 2 and 3. All mRNA expression results from RT-PCR (LPS compared to saline controls) are presented as means ± standard error (SEM) and two-way ANOVA analysis was

356


Table 2 Gene induction in the lung 1 week LPS

Genbank Acc

Gene Symbol

Gene Name

NM_011315 NM_021274 NM_008768 BC020275 NM_031167 NM_011990 NM_008599 NM_008039 NM_011409 NM_054098 NM_011337 NM_013623 NM_009117 NM_009140 NM_011593 NM_016960 NM_011016 NM_011338 NM_010260 NM_008198 NM_010819

Saa3 Cxcl10 Orm1 Lcn2 Il1rn Slc7a11 Cxcl9 Fprl1 Slfn3 Abcb1a Ccl3 Orm3 Saa1 Cxcl2 Timp1 Scya20 Orm2 Ccl9 Gbp2 H2-Bf Clecsf8

NM_008605 BF134814

Mmp12 Csf2rb1

NM_021893 NM_009912 L38281 NM_020509 NM_007534 NM_013650 NM_026405 NM_010554 NM_010185 NM_007514 NM_009397 NM_011260 NM_007969 AK002567 AF099976 NM_011157 M64085 NM_020008 AF218265 NM_009137 AK088315 NM_011082 NM_172648 NM_021792 NM_007972 NM_009139 NM_153106 NM_018734 NM_011607 NM_019948

Pdcd1lg1 Ccr1 Irg1 Retnla Bcl2a1a S100a8 Rab32 Il1a Fcer1g Slc7a2 Tnfaip3 Reg3g Expi Mt2 Slfn4 Prg1 Serpina3g Clecsf12 Muc4 Ccl22 Igtp Pigr Ifi205 Lcp1 F10 Ccl6 Padi5 Gbp3 Tnc Clecsf9

serum amyloid A 3 chemokine (C-X-C motif) ligand 10 orosomucoid 1 lipocalin 2 interleukin 1 receptor antagonist solute carrier family 7 member 11 Chemokine (C-X-C motif) ligand 9 formyl peptide receptor-like 1 schlafen 3 ATP-binding cassette, sub-family B (MDR/TAP), member 1A Chemokine (C-C motif) ligand 3 orosomucoid 3 serum amyloid A 1 Chemokine (C-X-C motif) ligand 2 tissue inhibitor of metalloproteinase 1 small inducible cytokine subfamily A20 orosomucoid 2 Chemokine (C-C motif) ligand 9 guanylate nucleotide binding protein 2 histocompatibility 2, complement component factor B C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 8 matrix metalloproteinase 12 colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) programmed cell death 1 ligand 1 chemokine (C-C motif) receptor 1 immunoresponsive gene 1 resistin like alpha B-cell leukemia/lymphoma 2 related protein A1a S100 calcium binding protein A8 (calgranulin A) RAB32, member RAS oncogene family interleukin 1 alpha Fc receptor, IgE, high affinity I, gamma polypeptide solute carrier family 7 member 2 tumor necrosis factor, alpha-induced protein 3 regenerating islet-derived 3 gamma extracellular proteinase inhibitor metallothionein 2 schlafen 4 proteoglycan, secretory granule serine (or cysteine) proteinase inhibitor, clade A, member 3G C-type lectin, superfamily member 12 mucin 4 chemokine (C-C motif) ligand 22 interferon gamma induced GTPase polymeric immunoglobulin receptor interferon activated gene 205 lymphocyte cytosolic protein 1 coagulation factor X chemokine (C-C motif) ligand 6 peptidyl arginine deiminase, egg and embryo abundant guanylate nucleotide binding protein 3 tenascin C C-type lectin, superfamily member 9

Fold Change Over Unexposed 63.74 38.75 31.13 23.05 22.62 17.14 15.85 14.14 13.80 12.45 11.89 11.09 10.36 9.62 9.33 8.45 8.36 7.94 7.89 7.70 7.19 6.72 6.39 6.32 6.02 5.92 5.91 5.77 5.75 5.49 5.48 5.47 5.42 5.26 5.18 5.13 5.06 4.98 4.80 4.73 4.70 4.69 4.62 4.60 4.58 4.56 4.53 4.46 4.32 4.29 4.29 4.24 4.15


357

Table 2 (continued)

Genbank Acc

Gene Symbol

Gene Name

NM_010187 NM_009763 NM_021281 NM_007651 NM_011662 NM_009114 NM_007707 AK082931 NM_031181 NM_008331 NM_009705 NM_011408 NM_009892 BC019382 NM_011331 M92418 AK032547 NM_009252 U96693 AK081783 NM_021364

Fcgr2b Bst1 Ctss Cd53 Tyrobp S100a9 Socs3 Fbxl5 Siglecl1 Ifit1 Arg2 Slfn2 Chi3l3 Pip5k1b Ccl12 Stfa2 Ptafr Serpina3n Pirb Il1f9 Clecsf5

NM_017370 NM_010751 AK009012 NM_010807 NM_009369 NM_010501 NM_013532 NM_019549 NM_020001 AK008013 NM_009841 BC008626 BB475830 NM_009890 NM_013683 NM_008330 L20315 NM_009283 NM_008522 NM_007802 NM_007781

Hp Mad Chit1 Mlp Tgfbi Ifit3 Gp49b Plek Clecsf10 Gpr86 Cd14 Icam1 Ncf2 Ch25h Tap1 Olfr56 Mpeg1 Stat1 Ltf Ctsk Csf2rb2

AJ251594 NM_013825 AB067535 NM_031195 NM_007752 K02782 NM_013671 NM_029796 NM_022415 NM_031198 NM_013612

Cd44 Ly75 Oas2 Msr1 Cp C3 Sod2 Lrg1 Ptges Tcfec Slc11a1

Fc receptor, IgG, low affinity IIb bone marrow stromal cell antigen 1 cathepsin S CD53 antigen TYRO protein tyrosine kinase binding protein S100 calcium binding protein A9 (calgranulin B) suppressor of cytokine signaling 3 F-box and leucine-rich repeat protein 5 SIGLEC-like 1 interferon-induced protein with tetratricopeptide repeats 1 arginase type II schlafen 2 chitinase 3-like 3 phosphatidylinositol-4-phosphate 5-kinase, type 1 beta chemokine (C-C motif) ligand 12 stefin A2 platelet-activating factor receptor serine (or cysteine) proteinase inhibitor, clade A, member 3N paired-Ig-like receptor B interleukin 1 family, member 9 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 Haptoglobin Max dimerization protein chitinase 1 (chitotriosidase) MARCKS-like protein transforming growth factor, beta induced interferon-induced protein with tetratricopeptide repeats 3 glycoprotein 49 B pleckstrin C-type lectin, superfamily member 10 G protein-coupled receptor 86 CD14 antigen intercellular adhesion molecule neutrophil cytosolic factor 2 cholesterol 25-hydroxylase transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) olfactory receptor 56 macrophage expressed gene 1 signal transducer and activator of transcription 1 Lactotransferrin cathepsin K colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) CD44 antigen lymphocyte antigen 75 2′-5′ oligoadenylate synthetase 2 macrophage scavenger receptor 1 ceruloplasmin complement component 3 superoxide dismutase 2, mitochondrial leucine-rich alpha-2-glycoprotein 1 prostaglandin E synthase transcription factor EC solute carrier family 11 member 1

Fold Change Over Unexposed 4.11 4.09 3.93 3.91 3.91 3.90 3.88 3.87 3.81 3.79 3.77 3.77 3.69 3.69 3.69 3.67 3.63 3.62 3.57 3.56 3.56 3.56 3.56 3.55 3.54 3.52 3.45 3.41 3.41 3.41 3.38 3.27 3.22 3.22 3.21 3.18 3.18 3.16 3.15 3.14 3.07 3.06 3.04 2.96 2.95 2.94 2.94 2.93 2.91 2.89 2.87 2.83 2.80

358


Table 2 (continued)

Genbank Acc

Gene Symbol

Gene Name

Fold Change Over Unexposed

NM_133888 NM_013602 NM_011314 NM_008380 NM_177356 NM_010741 NM_009373 AK041115 NM_011681 NM_017372 NM_010730 X93167 NM_013703 NM_010358 AF357384 NM_134042 BC005685 AF357396 NM_010570 NM_011067 AK081525 NM_008184 NM_008344 AK029236 BC025575 AK009689 AK010249 NM_023617 NM_013467 J03953 AK045991 NM_016771 NM_008728 AK053187 AK009042 NM_008086 AK007422 NM_009992 NM_010145 NM_010356 AF336977 NM_011134 NM_013674 NM_009997 NM_010279

Smpdl3b Mt1 Saa2 Inhba Lamp3 Ly6c Tgm2 Col3a1 Scgb1a1 Lyzs Anxa1 Fn1 Vldlr Gstm1

sphingomyelin phosphodiesterase, acid-like 3B metallothionein 1 serum amyloid A 2 inhibin beta-A lysosomal-associated membrane protein 3 lymphocyte antigen 6 complex, locus C transglutaminase 2, C polypeptide procollagen, type III, alpha 1 secretoglobin, family 1A, member 1 (uteroglobin) lysozyme annexin A1 fibronectin 1 very low density lipoprotein receptor glutathione S-transferase, mu 1 clone MBI-3 H/ACA box snoRNA, partial sequence aldehyde dehydrogenase family 6, subfamily A1 similar to dexamethasone induced product [Mus musculus] (LOC212970) RIKEN cDNA 2310037I24 gene insulin receptor substrate 1 period homolog 3 (Drosophila) C130031J23; hypothetical protein C130031J23 glutathione S-transferase, mu 6 keratin complex 2, basic, gene 8 myosin heavy chain 10, non-muscle cDNA sequence BC025575 RIKEN cDNA 2310039D24 gene procollagen C-endopeptidase enhancer 2 RIKEN cDNA 1200011D03 gene aldehyde dehydrogenase family 1, subfamily A1 glutathione S-transferase, mu 3 RIKEN cDNA B230331L10 gene sulfotransferase family 1D, member 1 natriuretic peptide receptor 3 G protein-coupled receptor 77 creatine kinase, mitochondrial 2 growth arrest specific 1 hypothetical LOC328023 cytochrome P450, family 1, subfamily a, polypeptide 1 epoxide hydrolase 1, microsomal glutathione S-transferase, alpha 3 RIKEN cDNA 4832426G23 gene paraoxonase 1 interferon regulatory factor 4 cytochrome P450, family 2, subfamily a, polypeptide 4 glial cell line derived neurotrophic factor family receptor alpha 1

2.76 2.74 2.73 2.66 2.64 2.56 2.53 2.50 2.41 2.37 2.32 1.68 0.51 0.50 0.50 0.50 0.50 0.49 0.49 0.48 0.48 0.48 0.48 0.48 0.48 0.48 0.47 0.47 0.47 0.44 0.44 0.43 0.43 0.43 0.42 0.39 0.37 0.37 0.36 0.36 0.34 0.26 0.26 0.23 0.22

Aldh6a1 2310037I24Rik Irs1 Per3 Gstm6 Krt2–8 Myh10 BC025575 2310039D24Rik Pcolce2 1200011D03Rik Aldh1a1 Gstm3 B230331L10Rik Sult1d1 Npr3 Gpr77 Ckmt2 Gas1 LOC328023 Cyp1a1 Ephx1 Gsta3 4832426G23Rik Pon1 Irf4 Cyp2a4 Gfra1


359

Table 3 Gene induction in the lung in both chronic LPS Gene induction in the lung in both chronic LPS (>2-fold) and bleomycin

Genbank Acc

Gene Symbol

Gene Name

NM_011315 NM_021274 BC020275 NM_031167 NM_011990 NM_011593 NM_026835 NM_011338 NM_010819 NM_008605 BF134814

Saa3 Cxcl10 Lcn2 Il1rn Slc7a11 Timp1 Ms4a6d Ccl9 Clecsf8 Mmp12 Csf2rb1

NM_021384 NM_026405 NM_010185 AK002567 NM_011157 NM_020008 NM_009137 NM_008879 NM_009139 NM_011607 NM_010187 NM_021281 NM_007651 NM_011662 AK035610 NM_007707 NM_009252 NM_007654 NM_021364

Rsad2 Rab32 Fcer1g Mt2 Prg1 Clecsf12 Ccl22 Lcp1 Ccl6 Tnc Fcgr2b Ctss Cd53 Tyrobp 9530076L18 Socs3 Serpina3n Cd72 Clecsf5

AK009012 NM_013532

Chit1 Lilrb4

NM_020001 BB475830 NM_013683 AK089313 NM_008522 NM_007802 AJ251594 AK054438 NM_031195 NM_013671 AI835480 NM_029796 NM_022415 NM_011171 NM_013612 NM_033075 NM_013602 NM_010431 NM_011103

Clecsf10 BB475830 Tap1 F730004D16Rik Ltf Ctsk Cd44 AI607873 Msr1 Sod2 Ptpns1 Lrg1 Ptges Procr Slc11a1 D17H6S56E-5 Mt1 Hif1a Prkcd

serum amyloid A 3 chemokine (C-X-C motif) ligand 10 lipocalin 2 interleukin 1 receptor antagonist solute carrier family 7 member 11 tissue inhibitor of metalloproteinase 1 membrane-spanning 4-domains, subfamily A, member 6D chemokine (C-C motif) ligand 9 C-type lectin, superfamily member 8 matrix metalloproteinase 12 colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) radical S-adenosyl methionine domain containing 2 RAB32, member RAS oncogene family Fc receptor, IgE, high affinity I, gamma polypeptide metallothionein 2 proteoglycan 1, secretory granule C-type lectin, superfamily member 12 chemokine (C-C motif) ligand 22 lymphocyte cytosolic protein 1 chemokine (C-C motif) ligand 6 tenascin C Fc receptor, IgG, low affinity Iib cathepsin S CD53 antigen TYRO protein tyrosine kinase binding protein hypothetical protein 9530076L18 suppressor of cytokine signaling 3 serine (or cysteine) proteinase inhibitor, clade A, member 3N CD72 antigen C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 chitinase 1 (chitotriosidase) leukocyte immunoglobulin-like receptor, subfamily B, member 4 C-type lectin, superfamily member 10 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) RIKEN cDNA F730004D16 gene lactotransferrin cathepsin K CD44 antigen expressed sequence AI607873 macrophage scavenger receptor 1 superoxide dismutase 2, mitochondrial protein tyrosine phosphatase, non-receptor type substrate 1 leucine-rich alpha-2-glycoprotein 1 prostaglandin E synthase protein C receptor, endothelial solute carrier family 11 member 1 DNA segment, Chr 17, human D6S56E 5 metallothionein 1 hypoxia inducible factor 1, alpha subunit protein kinase C, delta

Bleomycin Bleomycin Bleomycin LPS 1 Week 2 Weeks 3 Weeks 1 Week 5.20 186.38 5.13 1.59 14.86 7.55 2.21 3.63 1.88 14.07 1.30

6.08 31.35 4.01 2.33 47.84 9.03 3.91 2.96 1.87 29.63 1.46

8.44 45.45 4.26 1.87 44.03 6.19 3.69 2.88 1.85 36.73 2.02

63.74 38.75 23.05 22.62 17.14 9.33 8.28 7.94 7.19 6.72 6.39

1.86 2.33 2.51 2.99 1.35 1.25 19.99 1.89 2.39 6.53 3.67 2.48 1.59 1.42 2.90 2.27 2.78 1.34 2.21

1.69 3.01 2.97 2.47 1.54 1.90 3.76 1.94 2.81 8.43 3.18 4.57 1.95 2.44 6.37 1.61 2.89 1.65 2.12

1.60 2.72 2.79 1.58 1.44 2.66 11.75 1.73 3.40 7.37 2.52 5.04 2.13 2.13 5.31 1.59 2.60 2.05 2.47

6.11 5.49 5.47 5.06 4.80 4.70 4.62 4.55 4.32 4.24 4.11 3.93 3.91 3.91 3.91 3.88 3.62 3.58 3.56

2.24 2.20

1.79 2.65

1.42 2.01

3.55 3.41

1.13 1.41 1.28 1.55 1.26 1.74 1.32 2.12 3.36 1.53 1.42 1.25 1.38 4.65 1.67 3.20 1.36 1.43 1.27

1.72 1.83 1.30 2.38 2.05 2.78 1.48 1.97 3.62 1.54 1.90 1.48 1.42 4.31 2.05 2.87 1.38 1.73 1.39

1.99 1.93 1.37 2.02 2.69 3.47 1.51 1.95 3.21 1.40 1.86 1.81 1.32 4.12 2.03 3.35 1.43 1.90 1.67

3.41 3.22 3.18 3.18 3.14 3.07 3.04 2.97 2.94 2.91 2.89 2.89 2.87 2.86 2.80 2.80 2.74 2.70 2.69

360


Table 3 (continued)

Genbank Acc

Gene Symbol

NM_008380 BC019374 NM_010512 NM_010188 AK028849 NM_007547 NM_013492 AK041115 NM_134102 NM_008404 NM_011019 NM_009853 NM_015766 NM_053108 AK021200 NM_010288 NM_010266 NM_011210 NM_010730 NM_010344 NM_019466 NM_011999

Inhba Gclc Igf1 Fcgr3 Lass6 Ptpns1 Clu Col3a1 Pla1a Itgb2 Osmr Cd68 Ebi3 Glrx1 Cyba Gja1 Gda Ptprc Anxa1 Gsr Dscr1 Clecsf6

AK050053 NM_011179 NM_007599 NM_008485 NM_010161 NM_010186 NM_133897 BC022145 NM_021325 NM_010171 J04694 AK036579 NM_010329 AF020313 BC016624 NM_023118 NM_025961 NM_010128 NM_010728 NM_009593 NM_008677 NM_026369 NM_009256 AK041740 NM_011498 NM_008362 AK005378 AK079685 NM_008098 NM_023409

Gene Name

inhibin beta-A glutamate-cysteine ligase, catalytic subunit insulin-like growth factor 1 Fc receptor, IgG, low affinity III longevity assurance homolog 6 (S. cerevisiae) protein tyrosine phosphatase, non-receptor type substrate 1 clusterin procollagen, type III, alpha 1 phospholipase A1 member A integrin beta 2 oncostatin M receptor CD68 antigen Epstein-Barr virus induced gene 3 glutaredoxin 1 (thioltransferase) cytochrome b-245, alpha polypeptide gap junction membrane channel protein alpha 1 guanine deaminase protein tyrosine phosphatase, receptor type, C annexin A1 glutathione reductase 1 Down syndrome critical region homolog 1 (human) C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 6 Arl11 ADP-ribosylation factor-like 11 Psap prosaposin Capg capping protein (actin filament), gelsolin-like Lamc2 laminin, gamma 2 Evi2a ecotropic viral integration site 2a Fcgr1 Fc receptor, IgG, high affinity I E430036I04Rik RIKEN cDNA E430036I04 gene BC022145 cDNA sequence BC022145 Cd200r1 CD200 receptor 1 F3 coagulation factor III Col4a1 procollagen, type IV, alpha 1 9830137M10Rik RIKEN cDNA 9830137M10 gene Gp38 glycoprotein 38 Apbb1ip amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein 3010001F23Rik RIKEN cDNA 3010001F23 gene Dab2 disabled homolog 2 (Drosophila) Gatm glycine amidinotransferase Emp1 epithelial membrane protein 1 Lox lysyl oxidase Abcg1 ATP-binding cassette, sub-family G (WHITE), member 1 Ncf4 neutrophil cytosolic factor 4 Arpc5 actin related protein 2/3 complex, subunit 5 Serpinb9 serine (or cysteine) proteinase inhibitor, clade B, member 9 A630033H20Rik RIKEN cDNA A630033H20 gene Bhlhb2 basic helix-loop-helix domain containing, class B2 Il1r1 interleukin 1 receptor, type I Arpc1b actin related protein 2/3 complex, subunit 1B Irf7 interferon regulatory factor 7 Mtpn myotrophin Npc2 Niemann Pick type C2

Bleomycin Bleomycin Bleomycin LPS 1 Week 2 Weeks 3 Weeks 1 Week 5.52 1.75 3.57 1.47 1.69 1.82 1.61 2.47 149.49 1.49 1.92 2.09 1.29 1.76 1.28 1.79 2.16 1.31 2.25 1.28 2.57 1.20

30.25 1.47 4.94 2.04 1.66 2.22 1.79 3.30 17.70 2.20 1.43 2.65 1.51 1.73 1.40 1.91 2.05 1.63 2.37 1.48 2.07 1.78

28.58 1.52 4.83 2.70 1.43 1.86 2.48 2.71 21.49 2.06 1.56 2.92 1.62 1.71 1.53 2.03 1.83 1.95 2.48 1.46 2.26 2.34

2.66 2.57 2.56 2.56 2.55 2.53 2.51 2.50 2.49 2.46 2.46 2.41 2.40 2.39 2.38 2.37 2.37 2.33 2.32 2.28 2.24 2.21

1.92 1.61 1.69 1.94 1.99 1.92 1.95 1.29 39.21 1.83 1.90 2.29 1.46 1.78

2.21 2.06 1.87 2.61 2.30 1.68 1.89 1.44 63.35 1.68 2.36 1.87 1.95 1.97

2.01 2.27 1.94 3.04 2.29 1.92 2.00 1.48 13.74 1.49 2.30 1.79 2.05 1.52

2.18 2.16 2.14 2.14 2.13 2.12 2.10 2.10 2.09 2.09 2.08 2.05 2.01 2.00

1.73 1.63 11.92 1.62 2.23 1.15 1.64 1.37 1.48 7951.82 1.84 1.49 1.83 1.48 1.44 1.62

1.39 2.18 9.04 1.72 3.46 1.65 1.56 1.75 1.56 123.39 1.98 1.57 1.90 1.34 1.61 1.38

1.31 1.80 11.59 1.64 2.60 1.78 1.38 1.68 2.24 227.07 1.73 1.76 2.06 1.55 1.52 1.71

1.95 1.94 1.93 1.92 1.92 1.92 1.92 1.91 1.90 1.90 1.89 1.88 1.88 1.87 1.86 1.84


361

Table 3 (continued)

Genbank Acc

Gene Symbol

Gene Name

NM_031163 NM_011529 NM_008965 NM_010265 NM_009242 AK002490 AK054181 NM_011898

Col2a1 Tank Ptger4 Gcnt1 Sparc AK002490 E230025K15 Spry4 A_51_P419940 Ctsz Tgif Snag1 Slc40a1 Picalm X16074 Ctsb Rhoc Arf4 Ugcg Cstb 1600019O04Rik Lpl Acp2 Ifi30 Col5a2 Laptm5 Lap3 Ddx58 Grcc3f Fn1 C230088H06Rik Vav1 Zfpn1a1 Akr1b8 Cd84 Capza1 Glipr2 Ctsd Crlf1 Rab20 Gadd45g Casp8 Igfbp7 Evi2a Mafb

procollagen, type II, alpha 1 TRAF family member-associated Nf-kappa B activator prostaglandin E receptor 4 (subtype EP4) glucosaminyl (N-acetyl) transferase 1, core 2 secreted acidic cysteine rich glycoprotein

NM_022325 NM_009372 NM_130796 NM_016917 BC021491 X16074 AK083393 NM_007484 NM_007479 NM_011673 NM_007793 AK005500 NM_008509 BC013495 NM_023065 NM_007737 NM_010686 NM_024434 BC027369 AK083687 X93167 AK011687 NM_011691 NM_009578 NM_008012 NM_013489 BC016232 AK089960 NM_009983 NM_018827 X80332 NM_011817 BC006737 NM_008048 NM_146023 BC016434 NM_008608 BC011329 NM_021433 NM_028472 NM_133807 NM_023056 NM_025647 NM_007572

hypothetical protein E230025K15 sprouty homolog 4 (Drosophila) cathepsin Z TG interacting factor sorting nexin associated golgi protein 1 solute carrier family 40 (iron-regulated transporter), member 1 phosphatidylinositol binding clathrin assembly protein

cathepsin B ras homolog gene family, member C ADP-ribosylation factor 4 UDP-glucose ceramide glucosyltransferase cystatin B RIKEN cDNA 1600019O04 gene lipoprotein lipase acid phosphatase 2, lysosomal interferon gamma inducible protein 30 procollagen, type V, alpha 2 lysosomal-associated protein transmembrane 5 leucine aminopeptidase 3 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 gene rich cluster, C3f gene fibronectin 1 RIKEN cDNA C230088H06 gene vav 1 oncogene zinc finger protein, subfamily 1A, 1 (Ikaros) aldo-keto reductase family 1, member B8 CD84 antigen capping protein (actin filament) muscle Z-line, alpha 1 GLI pathogenesis-related 2 cathepsin D cytokine receptor-like factor 1 RAB20, member RAS oncogene family growth arrest and DNA-damage-inducible 45 gamma caspase 8 insulin-like growth factor binding protein 7 ecotropic viral integration site 2a v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) Mmp14 matrix metalloproteinase 14 (membrane-inserted) Pgd phosphogluconate dehydrogenase Stx6 syntaxin 6 Bmper BMP-binding endothelial regulator AA959742 expressed sequence AA959742 1810009M01Rik RIKEN cDNA 1810009M01 gene 0610011D08Rik RIKEN cDNA 0610011D08 gene C1qa complement component 1, q subcomponent, alpha polypeptide

Bleomycin Bleomycin Bleomycin LPS 1 Week 2 Weeks 3 Weeks 1 Week 2.20 1.38 2.08 1.53 1.28 2.42 1.65 1.44 1.47 1.42 1.45 1.25 1.81 1.70 2.32 1.57 1.24 1.61 1.24 1.83 1.37 1.19 1.37 1.63 2.80 1.74 1.87 1.41 1.23 6.55 1.43 1.70 1.54 1.73 1.65 1.46 1.25 2.18 1.46 1.37 1.39 1.49 1.49 1.58 1.32

3.44 1.41 1.80 1.47 2.07 2.30 1.77 1.73 1.41 1.56 1.42 1.54 2.28 1.84 2.56 1.59 1.40 1.71 1.50 1.61 1.63 2.00 1.72 1.55 3.97 2.04 1.67 1.29 1.47 8.98 1.49 1.70 1.49 1.77 1.83 1.60 1.39 2.15 1.74 1.46 1.30 1.61 1.81 1.64 1.50

2.25 1.51 1.76 1.23 2.04 2.30 1.38 1.84 1.43 1.63 1.52 1.76 2.64 1.88 2.04 2.06 1.51 1.63 1.53 1.53 1.66 2.25 1.79 1.55 3.67 2.12 1.76 1.44 1.56 7.05 1.49 1.51 1.39 2.03 1.78 1.77 1.61 2.95 1.48 1.32 1.38 1.52 1.74 1.58 1.55

1.83 1.83 1.83 1.82 1.80 1.79 1.78 1.78 1.78 1.77 1.77 1.76 1.76 1.76 1.76 1.74 1.74 1.73 1.73 1.72 1.72 1.71 1.71 1.71 1.71 1.71 1.70 1.69 1.69 1.68 1.68 1.68 1.68 1.67 1.65 1.65 1.64 1.63 1.63 1.62 1.61 1.61 1.61 1.61 1.60

1.94 1.37 1.27 1.96 1.67 1.34 1.20 1.26

2.10 1.40 1.54 2.20 1.66 1.48 1.59 2.19

2.14 1.30 1.38 1.64 1.56 1.51 1.74 2.43

1.59 1.59 1.58 1.57 1.57 1.56 1.55 1.55

362


Table 3 (continued)

Genbank Acc

Gene Symbol

NM_019389 NM_019749 AK003722 AK002214 NM_009465 NM_025408 NM_008845 BC023417 NM_009681 NM_010892 NM_033607 NM_022327 NM_018745 AK018401 U37501 NM_021412 AK088843 NM_007808 NM_007952 NM_008873 AJ304865 AK030708 NM_007477 BC002153 AK076103 NM_133683 NM_008764

NM_019389 Gabarap Ube2c Wbp5 Axl Phca Pip5k2a 5730589L02Rik Ap3s1 Nek2 Uchl4 Ralb Oazin 8430410J10Rik Lama5 Mmp19 E430028B21Rik Cycs Grp58 Plau Tnip2 Ckap4 Arf2 Hsbp1 Glt25d1 Tmem19 Tnfrsf11b

NM_009798 NM_015818 NM_030717 NM_007993 NM_133193 BC013213 AK089717 BC024911 NM_026424 AK077382 AF357006 NM_009821 NM_008175 NM_009898 NM_011623 NM_025401 NM_025278 NM_008046 NM_021540 BC025182 BQ891936 NM_013840 NM_016923 NM_016903 NM_021405 NM_007606

Gene Name

gamma-aminobutyric acid receptor associated protein ubiquitin-conjugating enzyme E2C WW domain binding protein 5 AXL receptor tyrosine kinase phytoceramidase, alkaline phosphatidylinositol-4-phosphate 5-kinase, type II, alpha RIKEN cDNA 5730589L02 gene adaptor-related protein complex 3, sigma 1 subunit NIMA (never in mitosis gene a)-related expressed kinase 2 ubiquitin carboxyl-terminal esterase L4 v-ral simian leukemia viral oncogene homolog B (ras related) ornithine decarboxylase antizyme inhibitor RIKEN cDNA 8430410J10 gene laminin, alpha 5 matrix metalloproteinase 19 RIKEN cDNA E430028B21 gene cytochrome c, somatic glucose regulated protein plasminogen activator, urokinase TNFAIP3 interacting protein 2 cytoskeleton-associated protein 4 ADP-ribosylation factor 2 heat shock factor binding protein 1 glycosyltransferase 25 domain containing 1 transmembrane protein 19 tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) Capzb capping protein (actin filament) muscle Z-line, beta Hs6st1 heparan sulfate 6-O-sulfotransferase 1 Lactb lactamase, beta Fbn1 fibrillin 1 Il1rl2 interleukin 1 receptor-like 2 1110028E10Rik RIKEN cDNA 1110028E10 gene Tens1 tensin-like SH2 domain containing 1 8430437G11Rik RIKEN cDNA 8430437G11 gene 1500041J02Rik RIKEN cDNA 1500041J02 gene Tmepai transmembrane, prostate androgen induced RNA Loxl1 lysyl oxidase-like 1 Runx1 runt related transcription factor 1 Grn granulin Coro1a coronin, actin binding protein 1A Top2a topoisomerase (DNA) II alpha Ubl5 ubiquitin-like 5 Gng12 guanine nucleotide binding protein (G protein), gamma 12 Fst follistatin Rnf130 ring finger protein 130 Dna2l DNA2 DNA replication helicase 2-like (yeast) 9630037P07Rik RIKEN cDNA 9630037P07 gene Uxt ubiquitously expressed transcript Ly96 lymphocyte antigen 96 Esd esterase D/formylglutathione hydrolase Cst10 cystatin 10 (chondrocytes) Car3 carbonic anhydrase 3

Bleomycin Bleomycin Bleomycin LPS 1 Week 2 Weeks 3 Weeks 1 Week 3.00 1.23 1.93 1.35 1.47 1.33 1.63 1.36 1.28 1.65 1.41 1.42 1.30 1.39 1.39 1.21 1.77 1.43 1.38 2.32 1.48 1.82 1.33 1.36 1.63 1.62 1.67

2.45 1.45 1.83 1.49 1.82 1.39 1.62 1.38 1.42 1.93 1.35 1.43 1.36 1.51 1.46 1.68 1.53 1.30 1.46 2.67 1.48 1.90 1.69 1.39 1.82 1.50 2.43

2.07 1.41 1.93 1.93 1.78 1.33 1.48 1.46 1.47 1.89 1.38 1.30 1.44 1.32 1.51 1.48 1.33 1.35 1.79 2.43 1.26 1.60 1.53 1.38 1.78 1.40 2.55

1.54 1.54 1.53 1.53 1.53 1.53 1.52 1.51 1.51 1.51 1.50 1.50 1.50 1.48 1.47 1.47 1.47 1.46 1.46 1.45 1.45 1.45 1.45 1.45 1.44 1.44 1.44

1.38 1.61 1.87 2.05 1.51 1.54 1.58 1.20 1.62 1.39 1.52 1.30 1.32 1.36 3.26 1.40 1.40 4.15 1.24 1.62 1.49 1.40 1.27 1.67 0.44 0.52

1.54 1.66 1.89 2.40 1.36 1.69 1.61 1.37 1.37 1.85 1.74 1.45 1.66 1.49 3.15 1.35 1.49 4.55 1.52 1.77 1.41 1.34 1.42 2.08 0.41 0.50

1.38 1.49 1.63 1.94 1.80 1.65 1.35 1.57 1.36 2.11 1.49 1.59 1.65 1.48 3.05 1.29 1.36 3.60 1.54 1.71 1.43 1.28 1.37 1.96 0.38 0.24

1.44 1.43 1.43 1.42 1.42 1.41 1.41 1.41 1.40 1.39 1.39 1.39 1.38 1.38 1.37 1.37 1.37 1.35 1.35 1.34 1.31 1.31 1.31 1.19 0.59 0.55


363

Table 3 (continued)

Genbank Acc

Gene Symbol

Gene Name

Bleomycin Bleomycin Bleomycin LPS 1 Week 2 Weeks 3 Weeks 1 Week

NM_010570 J03953 NM_009992

Irs1 Gstm3 Cyp1a1

insulin receptor substrate 1 glutathione S-transferase, mu 3 cytochrome P450, family 1, subfamily a, polypeptide 1

0.62 0.58 0.13

used to determine significance. Statistical significance was set at p