FLT3 Ligand Administration after Hematopoietic Cell ... - Core

Biology of Blood and Marrow Transplantation 11:23-34 (2005) 䊚 2005 American Society for Blood and Marrow Transplantation 1083-8791/05/1101-0003$30.00/0 doi:10.1016/j.bbmt.2004.08.004

FLT3 Ligand Administration after Hematopoietic Cell Transplantation Increases Circulating Dendritic Cell Precursors That Can Be Activated by CpG Oligodeoxynucleotides to Enhance T-Cell and Natural Killer Cell Function Wei Chen,1,2 Anissa S.H. Chan,1 Amanda J. Dawson,1 Xueqing Liang,1 Bruce R. Blazar,1,2 Jeffrey S. Miller1,3 1

University of Minnesota Cancer Center; 2Departments of Pediatrics; and 3Medicine, Division of Hematology, Oncology and Bone Marrow Transplantation, University of Minnesota Cancer Center, Minneapolis, Minnesota Correspondence and reprint requests: Wei Chen, MD, PhD, University of Minnesota Cancer Center, MMC 806, 420 Delaware St. S.E., Minneapolis, MN 55455 (e-mail: [email protected]). Received May 12, 2004; accepted August 7, 2004

ABSTRACT Dendritic cells (DCs) are key effectors in innate immunity and play critical roles in triggering adaptive immune responses. FLT3 ligand (FLT3-L) is essential for DC development from hematopoietic progenitors. In a phase I clinical trial, we demonstrated that immunotherapy with subcutaneous injection of FLT3-L is safe and well tolerated in cancer patients recovering from autologous hematopoietic cell transplantation (HCT). FLT3-L administration significantly increased the frequency and absolute number of blood DC precursors without affecting other mature cell lineages during the 6-week course of FLT3-L therapy. After 14 days of FLT3-L administration, the number of blood CD11cⴙ DCs, plasmacytoid DCs (PDCs), and CD14ⴙ monocytes increased by 5.3-, 2.9-, 3.8-fold, respectively, and was maintained at increased levels throughout FLT3-L therapy. FLT3-L–increased blood DCs in HCT patients were immature and had modest enhancing effects on in vitro T-cell proliferation to antigens and natural killer (NK) cell function. The addition of type B CpG oligodeoxynucleotides (ODNs) to peripheral blood mononuclear cells obtained from HCT patients receiving FLT3-L therapy induced rapid maturation of both CD11cⴙ DCs and PDCs and enhanced T-cell proliferative responses. In addition, CpG ODN induced potent activation of NK cells from FLT3-L–treated patients with increased surface CD69 expression and augmented cytotoxicity. CpG ODN–induced activation of NK cells was primarily via an indirect mechanism through PDCs. These findings suggest that FLT3-L mobilization of DC precursors followed by a specific DC stimulus such as CpG ODN may provide a novel strategy to manipulate antitumor immunity in patients after HCT. © 2005 American Society for Blood and Marrow Transplantation

KEY WORDS FLT3 ligand

●

CpG DNA

●

Dendritic cells

INTRODUCTION Dendritic cells (DCs) are professional antigenpresenting cells (APCs) and display an extraordinary capacity to stimulate T cell–mediated immune responses [1]. Recent studies suggest that DCs not only play a critical role in regulating the types of T-cell responses, but also regulate natural killer (NK) cell activity against tumors and microbes [2,3]. Two distinct human blood DC subsets, CD11c⫹ immature

BB&MT

●

NK cells

●

T lymphocytes

DCs and CD11c⫺ plasmacytoid DCs (PDCs)—with different morphologies, phenotypes, and functional properties— have been identified [4]. Blood CD11c⫹ DCs are considered to be myeloid derived, whereas PDCs, also known as type 1 interferon-producing cells, are considered to be lymphoid related [4]. Whereas CD11c⫹ DCs play a critical role in phagocytosis of microbial or apoptotic tumor cells, PDCs play a major role in antiviral immunity by rapidly producing large amounts of type 1 interferon after 23

W. Chen et al.

viral infection. CD11c⫹ DCs express a set of Toll-like receptors (TLRs; TLR2, TLR3, TLR5, and TLR8) that is different from that expressed by PDCs (TLR7 and TLR9) [5]. CD11c⫹ DCs can be selectively activated by double-stranded RNA (polyinosinic-polycytidylic acid) through TLR3, whereas PDCs respond to CpG DNA through TLR9 recognition and signaling [6]. Developing new strategies to expand these distinct DC populations in vivo and modulate their function associated with the specific regulation of host immunity may provide novel immune-based therapies for cancer or viral diseases in patients after hematopoietic cell transplantation (HCT). FLT3 ligand (FLT3-L) is a hematopoietic growth factor that has a profound effect on the expansion and mobilization of stem cells and progenitors [7], and it plays an important role in both DC and NK cell differentiation from hematopoietic progenitor cells [8-10]. The importance of FLT3-L in the hematopoiesis of DCs has been demonstrated by the paucity of these cells in the FLT3-L deletional mutant mice [11]. Injection of FLT3-L in mice dramatically increases the numbers of both myeloid and lymphoid DCs in blood and lymphoid tissues [12-16]. In humans, studies have shown that the administration of FLT3-L increases the number of CD11c⫹ DCs, PDCs, and CD14⫹ monocytes in healthy volunteers [17,18]. The important role of FLT3-L in human DC development is also demonstrated by our recent study that FLT3-L and thrombopoietin synergistically promote the in vitro generation of large numbers of CD11c⫹ DCs, PDCs, and CD14⫹ monocytes from CD34⫹ hematopoietic progenitor cells [19]. FLT3-L is also critical for NK cell development from stem cells and the acquisition of NK cell receptors [20,21]. In mice, FLT3-L treatment increases the number of functional NK cells, and this may be important in cancer immunotherapy [22]. Given the effects of FLT3-L on the in vivo expansion of DC precursors and NK cells in mice, administration of FLT3-L in post-HCT patients may allow preferential modulation of host antitumor immunity. Whether the in vivo FLT3-L– expanded DCs have enhancing effects on the immune function of autologous T cells and NK cells in cancer patients is unknown. To determine whether FLT3-L could augment human DC and NK cell number and function in the HCT setting, a phase I trial of FLT3-L administration was performed in cancer patients after autologous HCT. In addition, we examined whether the addition of CpG oligodeoxynucleotides (ODNs) to peripheral blood mononuclear cells (PBMCs) from HCT patients receiving FLT3-L therapy could induce DC maturation associated with augmented Tcell and NK cell function. Bacterial CpG DNA is a potent immune stimulant, and its stimulatory ability is conferred by the unmethylated CpG dinucleotides 24

and the flanking sequences presented in the DNA [23]. These sequences are registered as “danger” signals by the TLR family, which comprises an elegant pathogen-recognition system for host defense in innate immunity [24]. The receptor for CpG DNA is identified as TLR9 [24,25]. Recent studies have demonstrated that ODNs containing the signature CpG dinucleotides (CpG ODNs) can rapidly mature human PDCs isolated from human blood [6,26,27]. CpG ODNs are currently being tested as immunotherapeutic agents to induce antitumor activity in clinical trials. Previous studies by our group [28,29] and others [30,31] demonstrated in murine tumor models that enhanced DC maturation and function by CpG ODNs strongly induce both T cell–mediated and NK cell–mediated antitumor cellular immune responses and antitumor therapeutic effects in vivo. In this report, we present data that FLT3-L administration safely increases the frequency and number of blood DC precursors in cancer patients after autologous HCT. The addition of CpG ODNs to PBMCs obtained from FLT3-L–treated patients results in the activation of DCs and the augmentation of autologous T-cell and NK cell function.

MATERIALS AND METHODS Patient Selection and Clinical Trial Design

Adult patients were eligible for this clinical trial after autologous HCT for Hodgkin disease, nonHodgkin lymphoma, or advanced-stage breast cancer. Patients received peripheral blood grafts mobilized with granulocyte-macrophage colony-stimulating factor (GM-CSF) for days 1 to 4 (250 ␮g/m2) followed by granulocyte colony-stimulating factor (5 ␮g/kg) on days 4 to 8; apheresis collections started on day 8. Patients who required chemotherapy as a part of their mobilization regimen received GM-CSF until their white blood cell count was ⬎500/␮L; they then received granulocyte colony-stimulating factor for 4 days, followed by apheresis. Cell collections continued to obtain a desired graft size of 5 ⫻ 106 CD34⫹ cells per kilogram (or a minimal dose of 2 ⫻ 106 CD34⫹ cells per kilogram). Patients received GM-CSF (250 ␮g/m2) starting on day ⫹1 after stem cell reinfusion until the absolute neutrophil count was ⬎2500/␮L for 2 days. Patients were eligible to receive FLT3-L between day 84 and 112 after transplantation. They were required to have a complete response or stable disease, stable blood counts no longer requiring transfusions or other growth factors, and no active infections and to be capable of study participation in an outpatient setting. After obtaining written informed consent approved by the Institutional Review Board at the University of Minnesota, patients were treated with human recombinant FLT3-L (Amgen, Thousand Oaks,

Effects of FLT3-L and CpG ODN on Human Dendritic Cells

CA) at 20 ␮g/kg by subcutaneous injections every other day for 6 weeks on an outpatient basis. FLT3-L was provided as a sterile, lyophilized preparation of 1.5 or 5.0 mg of protein, 40 mg of mannitol, 10 mg of sucrose, and 25 mmol/L tromethamine per vial. All patients were treated with 21 alternate daily doses of FLT3-L within 6 weeks except for 1 patient, who received 20 doses because of patient error. PBMC Preparation, Isolation, and Analysis of Blood Cell Populations

Blood samples from each patient were drawn before FLT3-L treatment on day 0 and every 14 days after the first day of FLT3-L treatment for up to 2 months (days 14, 28, 42, and 56). PBMCs from the samples collected before or after FLT3-L treatment were isolated by Ficoll-Paque density gradient centrifugation. The cell populations present in PBMCs at different time points of FLT3-L treatment were determined by staining PBMCs with a cocktail of fluorescein isothiocyanate (FITC)– conjugated antibodies against lineage markers (CD3, CD14, CD16, CD19, CD20, and CD56, hereafter referred as Lin) and/or FITC-, phycoerythrin (PE)–, APC-, or CyC-labeled antibodies against HLA-DR, CD3, CD4, CD8, CD14, CD19, CD56, CD34, CD11c, and CD123. The frequency and absolute counts of blood Lin⫺DR⫹ DCs, Lin⫺DR⫹CD11c⫹CD123⫺ DCs, Lin⫺DR⫹CD11c⫺CD123⫹ PDCs, T cells, B cells, NK cells, monocytes, and CD34⫹ cells present in PBMCs were identified and analyzed by flow cytometry. Oligodeoxynucleotides

Phosphorothioate-modified CpG ODNs and control non-CpG ODNs were obtained from Coley Pharmaceutical Group, Inc. (Wellesley, MA): ODN 2006, tcgtcgttttgtcgttttgtcgtt; and ODN 2243, ggGGGAGCATGCTCgggggG (sequences are shown 5=-3=; lowercase letters indicate phosphorothioate linkage, and bold indicates CpG dinucleotides). No endotoxin could be detected in ODN preparations (⬍0.03 endotoxin units per mililiter; limulus amebocyte lysate assay; BioWhittaker, Walkersville, MD). CpG ODN 2006 and non-CpG ODN 2243 were resuspended in Tris-ethylenediaminetetraacetic acid buffer (10 mM Tris HCL/1mM EDTA, pH 8), diluted in phosphate-buffered saline, and used at final concentrations of 3 ␮g/mL. Flow Cytometry Analysis

FITC-, PE-, APC-, or CyC-conjugated mouse anti-human monoclonal antibodies (mAbs) directed against CD3, CD4, CD8, CD14, CD19, CD40, CD45, CD54, CD80, CD83, CD86, CD123 (interleukin [IL]–3R␣), HLA-ABC, and HLA-DR antigens,

BB&MT

as well as isotype control mAbs, were obtained from BD PharMingen (San Diego, CA). FITC-conjugated anti-Lin, PE-labeled anti-CD56, and APC-labeled anti-CD11c antibodies were obtained from Becton Dickinson Immunocytometry Systems (San Jose, CA). Cells were stained with FITC-, PE-, APC-, or CyCconjugated mAbs for 45 minutes on ice, washed twice with Hanks buffered salt solution containing 0.2% fetal bovine serum (FBS), and fixed with 0.2% paraformaldehyde phosphate-buffered saline. Mean fluorescence intensity and positive cell percentages were determined by flow cytometric analysis. In Vitro Activation of Blood DCs and NK Cells

For in vitro activation of blood DCs and NK cells, PBMCs or purified DC subsets were cultured in 24well plates at 5 ⫻ 106 cells per 2 mL of medium per well with or without the addition of ODN 2006 (3 ␮g/mL), polyinosinic-polycytidylic acid (50 ␮g/mL), recombinant human IL-2 (500 U/mL), or other activation conditions as indicated. Cells were cultured in a 37°C, 5% CO2 humidified incubator. After 48 hours, cultured cells were harvested and assessed for their phenotypic changes, antigen-presentation function, or NK-mediated cytolytic activity against a human NK-sensitive tumor target. The maturation-associated cell-surface markers (CD40, CD80, and CD86) on DCs before and after ODN 2006 stimulation were analyzed by gating on the Lin⫺DR⫹CD11c⫹CD123⫺ DCs and Lin⫺DR⫹CD11c⫺CD123⫹ PDCs. The activation of NK cells in PBMCs after ODN 2006 stimulation was analyzed by examining CD69 expression on the gated CD56⫹ cell population by flow cytometry. T-Cell Proliferation Assays

Purified T cells in 10% human AB serum complete medium (CM) consisting of RPMI 1640 supplemented with penicillin 100 U/mL, streptomycin 100 ␮g/mL, and glutamine 2 mmol/L (all from Mediatech, Herndon, VA) were added at 2 ⫻ 105 cells per well in 96-well plates as responder cells. For the mixed leukocyte reaction (MLR) assay, irradiated PBMCs (5000 cGy) from HCT patients were added to purified allogeneic T cells at the indicated concentration as stimulator cells, with or without preincubation under various activation conditions, for 48 hours. For antigenpresentation experiments, PBMCs from HCT patients before and during FLT3-L therapy were incubated with various doses of tetanus toxoid (TT) proteins (0.1 to 10 ␮g/mL; Accurate Chemical, Westerbury, NY) in a 5-day proliferation assay. In experiments with the addition of ODN 2006, irradiated PBMCs from HCT patients were incubated with purified autologous T cells plus various doses of TT in a 5-day proliferation assay. The plates were pulsed with 1 ␮Ci of 3H-thymidine per well for 18 hours before 25

W. Chen et al.

Table 1. Patient Characteristics for the Clinical Trial

Diagnosis

Age (y)

Sex

Time from Diagnosis to HCT (mo)

Prior Therapies (mo)

NHL (MALT) NHL (mantle cell) NHL (follicular/large cell) NHL (large cell) Breast cancer NHL (follicular cell) NHL (large cell) Hodgkin disease

52 61 60 54 49 57 22 32

F M F F F F F M

39 13 110 8 24 26 8 20

CHOP (4), XRT, DHAP (2) CHOP (7), CVP (1), ESHAP (2) Chlorambucil/CVP, CHOP (8), DHAP (2) CHOP (6), then mitoxantrone, cy, ARA-C, prednisone CA (4), docetaxel (2) CHOP/CVP (10), rituxamab, CHOP (8), XRT CHOP (8), XRT ABVD (6), chemotherapy at relapse not specified (3)

MALT indicates mucosal-associated lymphoid tissue; cy, cyclophosphamide; ARA-C, cytarabine; CHOP, cy, doxorubicin, vincristine, prednisone; CVP, cy, vincristine; prednisone; DHAP, dexamethasone, cisplatin, ARA- C; ESHAP, etoposide, methylprednisolone, ARA-C, cisplatin; XRT, radiation therapy; ABVD, doxorubicin bleomycin, vinblastine, dacarbazine; CA, cy, doxorubicin; NHL, non-Hodgkin lymphoma.

harvesting. All determinations were performed in triplicate, and 3H-thymidine incorporation (counts per minute; cpm) was determined. A stimulation index was calculated by dividing the mean cpm of the experimental group with the combination of mean cpm from T cells alone and APCs alone. Cytotoxicity Assays

Human NK-sensitive leukemia cell line K562 was used as target cells. The cell line was maintained in 10% FBS RPMI 1640 medium. Fresh or cultured PBMCs from HCT patients were used as effector cells. Target cells were incubated at 37°C with 250 ␮Ci of chromium 51 (New England Nuclear, Boston, MA) in 1 mL of 20% FBS CM for 45 minutes. Labeled targets were washed 3 times and resuspended in 20% FBS CM at 105 cells per milliliter. Effector cells in 100 ␮L were added to 96-well plates followed by 104 labeled target cells. Plates were incubated for 4 hours at 37°C, and supernatant was harvested from each well and counted in a gamma counter. Maximum cpm were determined by lysing the targets alone with 0.3% Triton-X solution, whereas minimum cpm were determined by targets in media alone. All determinations of cytotoxicity were performed in triplicate with at least 3 effector-target ratios. The percentage of lysis was calculated with the following formula: % lysis ⫽ (experimental mean cpm ⫺ spontaneous release mean cpm) ⁄ (maximum release mean cpm ⫺ spontaneous release mean cpm) ⫻ 100% Data Analysis

Data from patients or experiments are expressed as mean ⫾ SD. Statistical analysis of the results between groups was performed with the Student t test. Values of P ⬍ .05 were considered significant. 26

RESULTS Immunotherapy with Subcutaneous Infusions of FLT3-L Is Safe and Well Tolerated in Patients after Autologous HCT

The main clinical objective was to test the safety and clinical tolerance of FLT3-L in patients after autologous HCT. Six patients with non-Hodgkin lymphoma, 1 patient with Hodgkin lymphoma, and 1 patient with advanced-stage breast cancer completed their participation in this phase I study (Table 1). Patients received mobilized hematopoietic cells with a median of 5.5 ⫻ 106 CD34⫹ cells per kilogram (range, 3.5-27 ⫻ 106/kg), and all engrafted promptly. Neutrophil recovery (absolute neutrophil count ⬎500/␮L for 3 days) was at a median of 11 days (range, 9-14 days), and platelet recovery (⬎20 000 for 3 days) was at 15 days (range, 10-29 days). Ninety-five days (range, 64-110 days) after transplantation, patients received posttransplantation immunotherapy with human recombinant FLT3-L (20 ␮g/kg) by subcutaneous injection every other day for 6 weeks. FLT3-L was well tolerated without side effects in all postHCT patients. There were no constitutional symptoms. All planned doses were administered except for an erroneously missed dose in 1 patient. FLT3-L Effectively Increases the Frequency and Absolute Number of Blood DC Precursors in Patients after Autologous HCT without Affecting Other Mature Cell Lineages

Blood samples from patients were studied in vitro to assess the frequency, absolute cell count, and function of circulating DC populations before FLT3-L treatment (designated as day 0) and every 2 weeks after FLT3-L for up to 2 months (days 14, 28, 42, and 56) after HCT. Blood DC subsets were defined as Lin⫺DR⫹ and had differential expression of CD11c or CD123. Both blood DC subsets recovered after HCT, along with other mature cell lineages. The


A

B

Normal Donors

C

HCT Patients

10

1.63 ± 0.55

1.09 ± 0.60

HCT Patients Pre FLT3-L On FLT3-L

7.32 ± 1.22

1 0.36 ± 0.09

0.88 ± 0.38

2

0.38 ± 0.33

1

% of Total PBMC

0.69 ± 0.45

% of Total PBMC

% of Total PBMC

5.8 ± 0.23

2

8

6 4

1.24 ± 0.4

2 0

0 Lin-DR+ DCs

CD11c+ DCs

PDC

0 Lin-DR+ DCs

CD11c+ DCs

PDC

Lin-DR+ DCs

CD11c+ DCs

PDCs

Figure 1. FLT3-L administration effectively increases the frequency of blood DC subsets in cancer patients after autologous HCT. PBMCs isolated from the peripheral blood of healthy donors (A) and from post–autologous HCT patients enrolled in this study before FLT3-L therapy (B) and at day 14 after FLT3-L therapy (C) were stained with FITC-conjugated anti-Lin, CyC-conjugated anti–HLA-DR, APC-conjugated anti-CD11c, and PE-conjugated anti-CD123 antibodies. The frequency of circulating Lin⫺DR⫹ DCs, Lin⫺DR⫹CD11c⫹CD123⫺ DCs, and Lin⫺DR⫹CD11c⫺CD123⫹ PDCs in PBMC was determined by flow cytometric analysis. The percentages of DC subsets in the blood samples are expressed as mean ⫾ SD. Each symbol represents a single donor or patient tested. No significant difference was found between the percentages of DC subsets in blood samples from patients before FLT3-L therapy (n ⫽ 8) compared with healthy donors (n ⫽ 8; P ⬎ .05). A significant increase was obtained in the percentage of DC subsets in blood samples from the patients at day 14 of FLT3-L treatment (*P ⬍ .05) compared with that before FLT3-L therapy.

frequency of Lin⫺DR⫹ DCs, CD11c⫹ DCs, and PDCs in the PBMCs of HCT patients was 1.6% (1.63% ⫾ 0.55%), 0.88% (0.088% ⫾ 0.38%), and 0.36% (0.38% ⫾ 0.33), respectively, within 2 to 3 months after HCT, similar to that in healthy donors (Figure 1). The absolute counts of leukocytes, neutrophils, lymphocytes, and platelets, as well as T cells, B cells, NK cells, monocytes, and CD34⫹ cells, present in the PBMCs of HCT patients before FLT3-L treatment (day 0) were in a normal range (Figures 2 and 3). After 14 days of FLT3-L treatment, the frequencies of circulating Lin⫺DR⫹ DCs, CD11c⫹ DCs, PDCs, and CD14⫹ monocytes were increased to 7.3% (7.32% ⫾ 1.22%), 5.8% (5.8% ⫾ 0.23%), 1.2% (1.24% ⫾ 0.4%), and 39.2% (39.2% ⫾ 18.7%) in the PBMCs of HCT patients, respectively (Figure 1C and data not shown). The absolute numbers of circulating Lin⫺DR⫹ DCs, CD11c⫹ DCs, PDCs, and CD14⫹ monocytes were increased 7.6-, 5.3-, 2.9-, and 3.8fold, respectively— higher than before FLT3-L treatment. It is important to note that kinetic analysis showed that prolonged injections of FLT3-L did not further increase the frequency and absolute number of blood DC subsets and CD14⫹ monocytes but maintained them at increased levels during the 6-week course of FLT3-L treatment (Figure 2). Of note, FLT3-L infusion increased both blood CD11c⫹ DCs and PDCs; however, it preferentially increased CD11c⫹ DCs and altered the blood CD11c⫹ DC/ PDC ratio from a 1.5 to 2.5 range to a ratio of 4.5 to 7.0 within 14 days. After FLT3-L injections were completed on day 42, the absolute number of blood CD11c⫹ DCs, PDCs, and CD14⫹ monocytes declined to the normal range within 2 weeks. There was

BB&MT

no significant change in total leukocytes, neutrophils, lymphocytes, or platelets in blood samples from the HCT patients before, during, or after the course of FLT3-L treatment (Figure 3). There was no significant difference in CD34⫹ cells or T-cell, B-cell, or NK cell counts between blood samples from HCT patients before, during, and after FLT3-L therapy. These results demonstrated that the administration of FLT3-L safely increases the frequency and absolute counts of blood DC precursors of patients after autologous HCT without affecting other mature cell lineages. FLT3-L–Expanded Blood DCs Are Immature and, without Activation, Have Modest Enhancing Effects on T-Cell and NK Cell Function

FLT3-L administration to cancer patients was based on the hypothesis that an increased presence of circulating DCs might have profound effects on enhancing host antitumor immunity. It is interesting to note that phenotypic analysis of FLT3-L–increased blood DCs showed negligible levels of CD40 and CD80 on both CD11c⫹ DCs and PDCs, indicating that they were immature. Despite the increase in blood DCs after FLT3-L treatment, PBMCs from FLT3-L–treated HCT patients had a small and statistically insignificant enhancement effect on the allostimulatory capability to induce T-cell proliferation as assessed in MLR (1.14- to 2.21-fold increase compared with PBMCs before FLT3-L therapy; P ⬎ .05; Figure 4A). The capacity of PBMCs from HCT patients before and during FLT3-L therapy to enhance the presentation of a recall antigen to autologous T cells was also examined. TT-pulsed PBMCs from 27

W. Chen et al.

Figure 2. Prolonged FLT3-L administration maintained the increased number of blood DC subsets and CD14⫹ monocytes in patients throughout the 42-day therapy course. PBMCs isolated from blood samples of HCT patients before, during, and after FLT3-L therapy (days 0, 14, 28, 42, and 56) were stained with fluorescent anti-Lin, HLA-DR, CD11c, CD123, or CD14 antibodies. The frequency of blood DC subsets and monocytes was determined by flow cytometric analysis. A, The data show the flow cytometric gates and kinetic changes of percentages of Lin⫺DR⫹ DCs, Lin⫺CD11c⫹CD123⫺ DCs, Lin⫺CD11clowCD123⫹ PDCs, and CD14⫹ monocytes in PBMC from 1 representative HCT patient at different time points of FLT3-L treatment. B, The data show the kinetic changes of absolute counts of blood Lin⫺DR⫹ DCs, CD11c⫹ DCs, PDCs and CD14⫹ monocytes from all HCT patients tested and are expressed as the mean ⫾ SD. *P ⬍ .05, comparing the absolute counts of DCs at a specific time point of FLT3-L therapy with day 0.

HCT patients receiving FLT3-L therapy induced proliferative responses of autologous T cells in a TT dose– dependent manner, although the stimulation index was only slightly higher (1.36- to 2.58-fold) than that induced by TT-pulsed PBMCs from HCT patients before FLT3-L therapy, and a significant difference was detected exclusively at high antigen doses (Figure 4B). NK cells in the PBMCs of HCT patients receiving FLT3-L therapy expressed negligible levels of CD69 and exhibited low levels of cytolytic activities against K562. Killing of K562 targets by NK cells in 28

PBMCs did not change significantly on FLT3-L treatment (Figure 4C). These findings demonstrated that FLT3-L–increased blood DCs are immature and, without activation, have modest effects on enhancing autologous T-cell and NK cell function. FLT3-L–Increased Blood DCs Can Be Matured by CpG ODN to Enhance Their Antigen Presentation and T Cell–Stimulatory Function

The finding that FLT3-L–increased blood DCs have limited effects on T-cell and NK cell function


Figure 3. FLT3-L therapy does not affect the absolute counts of other mature cell lineages in the peripheral blood of post-HCT patients. Blood samples from each patient were drawn before FLT3-L treatment at day 0 and every 14 days after the first day of FLT3-L treatment for up to 2 months (days 14, 28, 42, and 56). The absolute counts of the total white blood cells (WBC), neutrophils, lymphocytes, and platelets in blood samples of each patient were obtained and evaluated. The cell populations present in PBMC were further analyzed by flow cytometry after staining of PBMCs with multicolored fluorescent antibodies specific against CD3, CD19, CD34, and CD56. The data shown are the kinetic changes of each cell population from all HCT patients tested and are expressed as the mean ⫾ SD. No significant difference was found between the absolute counts of these mature cell lineages at the tested time points during FLT3-L therapy compared with those before FLT3-L therapy (day 0; P ⬎ .05).

suggests that these immature DCs require further activation to enhance host immune function. Using the blood samples obtained from HCT patients receiving FLT3-L therapy, we tested whether the addition of CpG ODN could activate FLT3-L– increased DCs to enhance their antigen presentation and T cell–stimulatory function. Upon stimulation with ODN 2006, blood CD11c⫹ DCs and PDCs both matured and increased surface expression of CD40, CD80, and CD86 within 48 hours (Figure 5A). As a control, the addition of the nonCpG ODN 2243 showed minimum effects on the maturation of either DC subset. The allostimulatory capabilities of ODN 2006 –stimulated PBMCs from HCT patients receiving FLT3-L therapy were enhanced 4.3- to 6.7-fold compared with that without CpG ODN (P ⬍ .001; Figure 5B). In the presence of CpG ODN 2006, TT-pulsed PBMCs from HCT patients receiving FLT3-L induced significantly higher proliferative responses of autologous T cells to TT; the stimulation index was 2.8- to 5.4-fold higher than that without CpG ODN (P ⬍ .05; Figure 5C). These results demonstrate that CpG ODN can effectively mature FLT3-L–in-

BB&MT

creased blood DCs to enhance their antigen presentation and T cell–stimulatory function. CpG ODN 2006 Effectively Activates NK Cells in PBMCs from FLT3-L–Treated HCT Patients with Enhanced Cytolytic Activity

Our studies have shown that CpG ODNs can effectively activate human NK cells in PBMCs via an indirect mechanism through blood PDCs [3]. NK cells from HCT patients receiving FLT3-L expressed negligible CD69 levels. The addition of ODN 2006, but not ODN 2243, upregulated CD69 expression on NK cells in PBMC (Figure 6A). Upon activation with ODN 2006, NK cell activity in PBMCs obtained from FLT3-L–treated patients was significantly increased as assessed by cytotoxicity against K562 cells (Figure 6B). In most HCT patients (5/7) tested, higher NK-mediated cytotoxicity was induced in ODN 2006 –stimulated PBMCs from HCT patients receiving FLT3-L than before FLT3-L therapy (Figure 6C). Depletion of PDCs in PBMC from HCT patients receiving FLT3-L before ODN 2006 stimulation significantly reduced the CpG ODN, but not IL-2–induced augmenta29

W. Chen et al.

C.

B.

A. 12000

12

Pre FLT3-L On FLT3-L

60



8

*

6

4000

*

% Lysis

8000

S.I.

CPM

10

40

20

4

2

0

0 0

6.3

12.5

25

50

100

0

0.3

Stimulator Number (x103)

0.6

1.2

2.5

TT Doses ( g/ml)

5.0

10:1

20:1

40:1

80:1

E:T Ratio

Figure 4. FLT3-L–increased blood DCs are immature and, without activation, have modest enhancing effects on T-cell and NK cell function. A, Graded numbers of irradiated PBMCs from HCT patients before and during FLT3-L treatment (days 14 or 28) were incubated with purified allogeneic CD3⫹ T cells in a 5-day MLR assay. B, Graded numbers of irradiated PBMCs from HCT patients before and during FLT3-L treatment were pulsed with various doses of TT (0.1-10 ␮g/mL) and incubated with autologous CD3⫹ T cells in a 5-day proliferation assay. C, PBMCs from HCT patients before and during FLT3-L treatment were cultured in serum-free medium alone or with CpG ODN 2006 for 48 hours. NK cell–mediated cytolytic activity against K562 tumor targets was assessed in 4-hour cytotoxicity assays. The data shown in each panel are aggregate results from 7 different HCT patients expressed as the mean ⫾ SD.

tion of NK cell cytolytic activity (Figure 6D). This result is consistent with our findings with blood samples from healthy donors that CpG ODN activates human NK cells predominately via an indirect mechanism through PDCs [32]. The results demonstrate that CpG ODN can be used to effectively induce the activation and cytolytic function of NK cells in blood samples from FLT3-L–treated HCT patients. DISCUSSION Despite current advances in HCT, relapse continues to be the main cause of treatment failure in patients treated with autologous transplantation. We are interested in developing safe and effective immunotherapy after HCT. FLT3-L administration has not been previously tested in humans after HCT. In this study, autologous HCT patients were enrolled to receive FLT3-L treatment after successful engraftment. These HCT patients were evaluated for the clinical safety of FLT3-L treatment and for the enhancing effects of FLT3-L on their immune function. We show that immunotherapy with subcutaneous FLT3-L infusion is well tolerated in cancer patients after autologous HCT, without toxicity. We demonstrate that FLT3-L therapy results in early recovery and a marked increase of CD11c⫹ DCs, PDCs, and CD14⫹ monocytes in the peripheral blood of HCT patients without affecting other mature cell lineages. The prolonged injection of FLT3-L from days 14 to 42 did not further increase the frequency and absolute number of circulating DC precursors but effectively maintained DCs at increased levels during the course of FLT3-L treatment. After FLT3-L injections were 30

discontinued, the absolute number of blood DC precursors declined to the normal range within 2 weeks. FLT3-L administration greatly increased the frequencies and absolute counts of blood DC subsets and CD14⫹ monocytes in HCT patients, similar to previous reports by others of FLT3-L effects in healthy volunteers [17,18]. Monitoring the immune recovery of DC populations in HCT patients from the time of transplantation to engraftment may help to define the best time point for FLT3-L treatment, because DC recovery might occur during a particular time period after HCT, and this may influence the outcome of FLT3-L administration on DCs. It is interesting to note that FLT3-L increased phenotypic immature DCs in the peripheral blood of HCT patients; it had only modest effects on presenting either recall antigens or alloantigens to induce T-cell responses and failed to augment the function of NK cells against K562 tumor targets. These findings suggest that FLT3-L–increased blood DCs require further maturation to enhance host immune function. CpG ODNs can effectively enhance DC maturation and strongly induce both T cell–mediated and NK cell– mediated antitumor cellular immune responses and antitumor therapeutic effects in mice. Our studies have shown that CpG ODNs are potent stimulators of NK cell–mediated antitumor responses to protect naive mice against a lethal acute myeloid leukemia challenge and protect syngeneic and allogeneic bone marrow transplant recipients against acute myeloid leukemia challenge at both early and late time points after transplantation [28]. CpG ODNs are stable, chemically well defined, inexpensive agents with clinical-grade formulas available for studies [23]. At least 3 distinct classes of CpG ODNs with structural and functional differences


Figure 5. CpG ODN effectively induces the maturation of FLT3-L–increased blood DCs and enhances their antigen-presentation and T cell–stimulatory function. A, PBMCs from HCT patients receiving FLT3-L therapy (day 14 or 28) were stained with fluorescent antibodies against blood CD11c⫹ DCs or PDCs. Cell-surface expression of CD40, CD80, and CD86 on gated CD11c⫹ DCs and PDCs in fresh PBMCs or PBMCs cultured for 48 hours in medium containing either ODN 2006 or ODN 2243 was compared and determined by flow cytometric analysis. The data shown are representative results from 1 of 5 reproducible experiments from different HCT patients. B, Graded numbers of irradiated PBMCs from patients receiving FLT3-L treatment were incubated with purified allogeneic CD3⫹ T cells with or without ODN 2006 in a 5-day MLR assay. C, Graded numbers of irradiated PBMCs from patients receiving FLT3-L treatment were pulsed with various doses of TT (0.1-10 ␮g/mL) and incubated with autologous CD3⫹ T cells with or without ODN 2006 in a 5-day proliferation assay. The data shown in panels B and C are aggregate results from 5 different HCT patients expressed as mean ⫾ SD. *P ⬍ .05, comparing the CpG ODN 2006 group versus the no-CpG group.

have recently been identified [33,34]. We chose to test CpG-B ODN (2006) in this study because CpG-B ODN (2006) is a potent stimulator for human DC maturation and is now available in clinical grade (known as ODN 7909). Our results demonstrated that blood immature DCs from FLT3-L–treated patients can be effectively activated by ODN 2006 with enhanced T cell– stimulatory function and augmented NK cell–mediated cytotoxicity against K562 tumor targets. The requirement for CpG ODN to mature FLT3-L–increased DCs to enhance autologous T-cell and NK cell function supports the notion that this combination may lead to novel strategies to manipulate immune responses against residual tumor that may be present after autologous HCT. Our studies with blood samples obtained from

BB&MT

healthy donors showed that although human NK cells lack TLR9 expression (a TLR required for CpG recognition), incubation of CpG ODN with PBMCs effectively induced the activation of NK cells and augmented NK cytolytic activity. When PDCs were depleted from PBMC, the previously observed CpG ODN effect on NK cells was completely abrogated at various doses of CpG ODN tested. The addition of PDC to purified PDC-depleted NK cells effectively restored the CpG ODN effect on NK cells in a PDC dose– dependent manner [32]. Comparable results were obtained in this study with blood samples obtained from HCT patients receiving FLT3-L treatment. CpG ODN effectively enhanced NK cell cytotoxicity function in blood samples from HCT patients receiving FLT3-L. However, deple31

W. Chen et al.

Figure 6. CpG ODN effectively activates NK cells in PBMCs from FLT3-L–treated patients and augments NK cell cytolytic activity in a PDC-dependent manner. A, NK cells in PBMCs from HCT patients receiving FLT3-L therapy (day 14 or 28) before and after culturing with either ODN 2006 or ODN 2243 for 48 hours were stained with FITC- and PE-conjugated antibodies against CD56/CD69 and determined by flow cytometric analysis. Data are representative results from 1 of 5 reproducible experiments from different HCT patients. B, PBMCs from HCT patients receiving FLT3-L treatment were cultured in medium alone or with ODN 2006 for 48 hours. NK cell–mediated cytolytic activity against K562 tumor targets was assessed in a standard 4-hour cytotoxicity assay. Data shown are aggregate results from 7 patients expressed as mean ⫾ SD. C, PBMCs from patients before and during FLT3-L treatment were cultured with ODN 2006 for 48 hours and assessed for NK cell–mediated lysis of K562 tumor targets in a 4-hour cytotoxicity assay. Data are representative results from 3 HCT patients. D, PBMCs from patients receiving FLT3-L treatment were depleted of PDCs by using a BDCA-4 isolation kit and magnetically activated cell sorting before culturing with ODN 2006 or IL-2 for 48 hours. Cells were then assessed for NK cell–mediated lysis of K562 targets in a 4-hour cytotoxicity assay. Data are representative of 3 HCT patients.

tion of blood PDCs increased by FLT3-L therapy completely inhibited the CpG ODN effect on enhancing NK cell cytotoxicity activity. Similarly, human blood CD11c⫹ DCs also lack TLR9 expression [5]. In CpG ODN–stimulated PBMCs, blood CD11c⫹ DCs are activated mainly via an indirect mechanism through PDCs. Human PDCs play a major role in antiviral immunity by rapidly producing large amounts of type 1 interferon after viral infection or bacterial DNA activation. The type 1 interferons produced by PDCs have striking influences on the type of immune responses generated in vivo. The critical role of PDCs in human antiviral immunity is suggested by the observation that the loss of PDCs correlates with disease progression to acquired immunodeficiency syndrome in human immunodefi32

ciency virus–infected subjects [35]. In allogeneic bone marrow transplantation, increasing evidence indicates that PDCs may play an important role in immune responses after HCT to facilitate engraftment and prevent graft-versus-host disease [36-38]. Developing new strategies to expand DC populations in vivo and modulate their function associated with the specific regulation of the immunity in the host may provide novel immunebased therapies for cancer or viral diseases in posttransplantation patients.

ACKNOWLEDGMENTS We gratefully acknowledge Sue Fautsch at the Cancer Center Translational Cell Therapy Core for


the collection of research samples and Roby Nicklow for clinical coordination of this research trial. This work was supported in part by research grants from the Randy Shaver Cancer Research and Community Fund; the Children’s Cancer Research Fund and Leukemia Research Fund (W.C.); the Leukemia Task Force and National Institutes of Health grant no. RO1 CA72669 (B.R.B.); and the Fairview-University Medical Center Stem Cell Laboratory (J.S.M). We also acknowledge of the support of the University of Minnesota Bone Marrow Transplantation Research Fund.

14.

15.

16.

17.

18.

REFERENCES 1. Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol. 2000;18:767-811. 2. Fernandez NC, Lozier A, Flament C, et al. Dendritic cells directly trigger NK cell functions: cross-talk relevant in innate anti-tumor immune responses in vivo. Nat Med. 1999;5:405411. 3. Moretta A. Natural killer cells and dendritic cells: rendezvous in abused tissues. Nat Rev Immunol. 2002;2:957-964. 4. Liu YJ. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell. 2001;106:259-262. 5. Kadowaki N, Ho S, Antonenko S, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001;194: 863-869. 6. Kadowaki N, Antonenko S, Liu YJ. Distinct CpG DNA and polyinosinic-polycytidylic acid double-stranded RNA, respectively, stimulate CD11c-type 2 dendritic cell precursors and CD11c⫹ dendritic cells to produce type I IFN. J Immunol. 2001;166:2291-2295. 7. Lyman SD, Jacobsen SE. c-kit ligand and Flt3 ligand: stem/ progenitor cell factors with overlapping yet distinct activities. Blood. 1998;91:1101-1134. 8. Blom B, Ho S, Antonenko S, Liu YJ. Generation of interferon alpha-producing predendritic cells (Pre-DC)2 from human CD34(⫹) hematopoietic stem cells. J Exp Med. 2000;192:17851796. 9. Gilliet M, Boonstra A, Paturel C, et al. The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J Exp Med. 2002;195:953-958. 10. Miller JS, McCullar V, Punzel M, et al. Single adult human CD34(⫹)/Lin⫺/CD38(⫺) progenitors give rise to natural killer cells, B-lineage cells, dendritic cells, and myeloid cells. Blood. 1999;93:96-106. 11. McKenna HJ, Stocking KL, Miller RE, et al. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood. 2000;95:3489-3497. 12. Maraskovsky E, Brasel K, Teepe M, et al. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med. 1996;184:1953-1962. 13. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype,

BB&MT

19.

20.

21.

22.

23. 24. 25.

26.

27.

28.

29.

30.

31.

and localization of dendritic cell subsets in FLT3 ligandtreated mice. J Immunol. 1997;159:2222-2231. Shurin MR, Pandharipande PP, Zorina TD, et al. FLT3 ligand induces the generation of functionally active dendritic cells in mice. Cell Immunol. 1997;179:174-184. Pulendran B, Smith JL, Caspary G, et al. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci U S A. 1999;96:1036-1041. Maldonado-Lopez R, De Smedt T, Michel P, et al. CD8alpha⫹ and CD8alpha⫺ subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 1999;189:587-592. Maraskovsky E, Daro E, Roux E, et al. In vivo generation of human dendritic cell subsets by Flt3 ligand. Blood. 2000;96:878884. Pulendran B, Banchereau J, Burkeholder S, et al. Flt3-ligand and granulocyte colony-stimulating factor mobilize distinct human dendritic cell subsets in vivo. J Immunol. 2000;165:566572. Chen W, Antonenko S, Sederstrom JM, et al. Thrombopoietin cooperates with FLT3-ligand in the generation of plasmacytoid dendritic cell precursors from human hematopoietic progenitors. Blood. 2004;103:2547-2553. Miller JS, McCullar V. Human natural killer cells with polyclonal lectin and immunoglobulinlike receptors develop from single hematopoietic stem cells with preferential expression of NKG2A and KIR2DL2/L3/S2. Blood. 2001;98:705-713. Yu H, Fehniger TA, Fuchshuber P, et al. Flt3 ligand promotes the generation of a distinct CD34(⫹) human natural killer cell progenitor that responds to interleukin-15. Blood. 1998;92: 3647-3657. Shaw SG, Maung AA, Steptoe RJ, et al. Expansion of functional NK cells in multiple tissue compartments of mice treated with Flt3-ligand: implications for anti-cancer and anti-viral therapy. J Immunol. 1998;161:2817-2824. Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol. 2002;20:709-760. Hemmi H, Takeuchi O, Kawai T, et al. A Toll-like receptor recognizes bacterial DNA. Nature. 2000;408:740-745. Takeshita F, Leifer CA, Gursel I, et al. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J Immunol. 2001;167:3555-3558. Hartmann G, Weiner GJ, Krieg AM. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc Natl Acad Sci U S A. 1999;96:9305-9310. Bauer M, Redecke V, Ellwart JW, et al. Bacterial CpG-DNA triggers activation and maturation of human CD11c⫺, CD123⫹ dendritic cells. J Immunol. 2001;166:5000-5007. Blazar BR, Krieg AM, Taylor PA. Synthetic unmethylated cytosine-phosphate-guanosine oligodeoxynucleotides are potent stimulators of antileukemia responses in naive and bone marrow transplant recipients. Blood. 2001;98:1217-1225. Weigel BJ, Nath N, Taylor PA, et al. Comparative analysis of murine marrow-derived dendritic cells generated by Flt3L or GM-CSF/IL-4 and matured with immune stimulatory agents on the in vivo induction of antileukemia responses. Blood. 2002; 100:4169-4176. Brunner C, Seiderer J, Schlamp A, et al. Enhanced dendritic cell maturation by TNF-alpha or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo. J Immunol. 2000;165:6278-6286. Heckelsmiller K, Beck S, Rall K, et al. Combined dendritic cell33

W. Chen et al.

and CpG oligonucleotide-based immune therapy cures large murine tumors that resist chemotherapy. Eur J Immunol. 2002;32:3235-3245. 32. Chen W, Chan ASH, Dawson AJ, et al. CpG oligodeoxynucleotides activate human NK cells predominantly via an indirect mechanism through plasmacytoid dendritic cells. Keystone Symposia-J7. 2003 (abstr. 116). 33. Krug A, Rothenfusser S, Hornung V, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur J Immunol. 2001;31:2154-2163. 34. Hartmann G, Battiany J, Poeck H, et al. Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-alpha induction in plasmacytoid dendritic cells. Eur J Immunol. 2003;33:1633-1641.

34

35. Soumelis V, Scott I, Gheyas F, et al. Depletion of circulating natural type 1 interferon-producing cell in HIV-infected AIDS patients. Blood. 2001;98:906-912. 36. Arpinati M, Green CL, Heimfeld S, et al. Granulocyte-colony stimulating factor mobilizes T helper 2-inducing dendritic cells. Blood. 2000;95:2484-2490. 37. Rossi M, Arpinati M, Rondelli D, et al. Plasmacytoid dendritic cells: do they have a role in immune responses after hematopoietic cell transplantation? Hum Immunol. 2002;63: 1194-1200. 38. Waller EK, Rosenthal H, Jones TW, et al. Larger numbers of CD4(bright) dendritic cells in donor bone marrow are associated with increased relapse after allogeneic bone marrow transplantation. Blood. 2001;97:2948-2956.