Four Conserved Cysteine Residues Are Required for the DNA Binding

THEJOURNAL OF BIOLOGICALCHEMISTRY Q 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 18, Issue of June 25, pp. 12986-12990.1992 Printed in U.S. A.

Four Conserved Cysteine Residues Are Required for DNA the Binding Activity of Nuclear FactorI* (Received for publication, February 10, 1992)

Anton Novak, Neerja Goyal, and Richard M. GronostajskiS From the Division of Molecular and StructuralBiology, Ontario Cancer Institute and the Department of Medical Biophysics, University of Toronto, Toronto, Ontario M4X IK9, Canada

The role of Cys residues in the site-specific DNA binding activity of the nuclear factor I (NFI) family of proteins was assessed by chemical modification and site-specific mutagenesis. Treatment with the thiolspecific reagent N-ethylmaleimide abolished site-specific DNA binding of all forms of NFI present in HeLa nuclear extracts. Preincubation of cell extracts with an oligonucleotide containing an NFI-binding site provided partial protection of NFI from N-ethylmaleimide inactivation. Mutations were made in the cDNA encoding a truncated form of the NFI-C/CAAT box transcription factor- 1 protein, converting each of the five Cys residues in the DNA-binding domain of the protein into Ser residues. NFI-C proteins containing mutations in any of four conserved Cys residues, expressed in Escherichia coli or in vitro,did not bind to DNA. NFIC with a mutation in a nonconserved Cys residue had normal DNA binding activity. Both this active mutant and wild-type NFI-C protein were inactivated by modification of their sulfhydryl residues with 5,5’-dithiobis(2-nitrobenzoic acid) (DTNB), and preincubation withan oligonucleotide containing an NFI-binding site gave partial protection against inactivation. After modification with DTNB, DNA binding activity was partially restored by subsequent incubation with dithiothreitol, indicating that inactivation of NFIby DTNB was reversible. These studies indicate an essential role for freesulfhydryl residues in NFI-DNA binding.

related genes NFI-A, NFI-B, NFI-C, and NFI-X (16, 17); 2) differential splicing of the mRNAs of these genes (7, 17, 18); and 3) covalent modification of NFI family members by glycosylation (19) and phosphorylation (20). A common feature of all forms of NFI identified to date is a highly conserved NHz-terminal DNA-binding domain (10, 11, 17). The NHz-terminal 220 amino acids of human NFI-C and the NHz-terminal 240 amino acids of rat NFI-A were sufficient for DNA binding, dimerization, and stimulation of adenovirus replication (10, 11). This conserved DNA-binding domain of NFI is not homologous to any of the known classes of DNA-binding domains such as the zinc finger, leucine zipper, or helix-turn-helix motifs (10, 11, 14, 21). To understand how NFI binds to its specific DNA recognitionsite, we have investigated the role of specific Cys residues. These studieswere prompted by the recognition that the stimulation of adenovirus replication by NFI is sensitive to thethiol-specific alkylating reagent NEM (1). In addition, all of the known NFI family members contain four conserved Cys residues in the NHz-terminal DNA-binding domain (16, 17). In this study, we have examined the effect of chemical modification and site-specific mutagenesis of conserved and nonconserved Cys residues in NFI on its DNA binding activity. MATERIALS AND METHODS

Plasmid DNAs and Mutagenesis-pCTF-1 contains a1688-base pair cDNA encoding the human NFI-C/CTF-1 protein (7) subcloned into pBSSK+ (Stratagene) and was a gift from R. Tjian. For mutagenesis, the PstI fragment of pCTF-1 that contained the five NHZThe NFI’family of site-specific DNA-binding proteins terminal Cys residues of NFI-C was subcloned into the PstI site of function i n vitro and in vivo in the replication of adenovirus M13mp19. Site-specific mutagenesis was performed using oligonucleDNA (1-4) and in the transcription of a number of cellular otides encoding cysteine to serine changes as described previously and viral genes (5-8). NFI family members bind as dimers (9- (22). The oligonucleotidesused were GTCCTCGCGGGACTCG11) to sites on DNA that are homologous to the dyad sym- GGCCG (Cys-79), GGAGAGCACGGAGCCCGGCGC (Cys-95), CCTGCCGGAGTGAGTCGATGCG (Cys-lll), GGACCGGGTGGCCmetric sequence TTGGC(N),GCCAA (9, 12-15). Multiple GGACTGCGCAGC (Cys-148), and GGCTGCACGCTCAGGACCforms of NFI are found in various differentiated cell types GGG (Cys-154). Mutations were confirmed by restriction enzyme (15). These multiple species of NFI are generated by at least mapping and dideoxy chain termination sequencing (23). NFI-C proteins were expressed inEscherichia coli from two differthree mechanisms: 1) the expression of four distinct but ent series of vectors. The pBS series was generated by subcloning * This work was supported by grants from the Medical Research PstI-Sac1 (blunt) fragments of wild-type and mutant clones into the Council of Canada and the National Cancer Instituteof Canada (to PstI-XhoI (blunt) site of pCTF-1. These vectors expressedfusion R. M. G.). The costs of publication of this article were defrayed in proteins consisting of 34 amino acids derived from vector sequence part by the payment of page charges. This article must therefore be fused to the NHn-terminal 220 amino acids of wild-type or mutant 18U.S.C. Section NFI-C with 11 amino acidsof vector origin at the carboxyl terminus. hereby marked “aduertisement” in accordance with The vectors are named pBS220 and pBS220Cysl-5, and their corre1734 solely to indicate this fact. NFI-C220aCysl-5, $ T o whom correspondence should be addressed Dept. of Cancer sponding proteins are denoted NFI-C220a and Biology, Cleveland Clinic Foundation, 9500 Euclid Ave., Cleveland, which refers to mutated Cys residues numbered 1-5 from the amino terminus of NFI-C. For the PET series of vectors, the NcoI-Sac1 OH 44195-5178. The abbreviations used are: NFI, nuclear factor I; CTF-1, CAAT (blunt) fragment of pCTF-1, encoding the NHp-terminal 220 amino box transcription factor-1; DTNB, 5,5’-dithiobis(2-nitrobenzoic acids of NFI-C, was subcloned into the NcoI-BamHI (blunt) site of a224-aminoacid acid); DTT, dithiothreitol;FIB-2.6, nuclear factor I binding site 2.6; pET8c(24).Thisplasmid(pET220)expressed FIB-2.6C2, C2 mutant of nuclear factor I binding site; NEM, N- fusion protein consisting of the NHp-terminal 220 amino acids of ethylmaleimide; Hepes, 4-(2-hydroxyethyl)-l-piperazineethanesul- NFI-C, withfour amino acidsderived from the vector at thecarboxyl terminus. PstI-Sac1 (blunt) fragments of mutant clones were subfonic acid; GMS, gel mobility shift; BSA, bovine serum albumin.

’

12986

Cys Residues of NFI Required for DNA Binding cloned intothe PstI-BamHI(blunt) site of pET220 to yield pET220Cysl-5, which expressed NFI-C220b and NFI-C220bCysl-5. Preparation of Cell Extracts-HeLa nuclear extracts were prepared as described (15).Bacterial extracts were prepared from E. coli strain DH5a transformed with pBS220 vectors and strainBL21(DE3) transformed with pET220 vectors grown in LB ampicillin (100 pglml). Saturated cultures were diluted 1:50, grown to A m = 0.4 at 37 "C, induced with 0.5 mM isopropyl thiogalactoside for 3 h a t 37 "C, and centrifuged at 2,300 X g for 10 min at 4 "C. Pellets were resuspended in cold Buffer L (25 mM Hepes pH 7.5,0.35 M NaCI, 10% sucrose, 5 mM DTT, and 1 mM phenylmethylsulfonyl fluoride), and lysozyme was added to 200 pg/ml, followed by incubation on ice for 15 min. Cells were lysed byaddition of Nonidet P-40 to 0.1% and incubation on ice for 15 min. Lysates were centrifuged a t 150,000 X g for 1 h at 4 "C, and the resulting supernatants were stored at -70 "C and used t o assay for NFI activity. Protein concentration was measured using the Bradford assay (Bio-Rad) (25). I n Vitro Transcription-Translation-pET22O wild type and mutant plasmids were purified by equilibrium centrifugation in cesium chloride/ethidium bromide gradients (26). One pg of HindIII-linearized plasmid was transcribed in vitro with T7 RNA polymerase using an mCap RNA capping kit (Stratagene). Three pg ofthe resulting mRNA was translated in vitro using a wheat germ translation system (Promega) and [3sS]methionine (1,200 Ci/mmol, Du Pont-New England Nuclear). Gel Mobility Shift (GMS) Assay-NFI binding activity was assayed using a "P-labeled 26-base pair oligonucleotide that contains an NFIbinding site(FIB-2.6) and with a control oligonucleotidethat contains a single base pair mutation that abolishes NFI binding (FIB-2.6C2) (15, 27). Cell extracts or in vitro translated NFI-C proteins were added to 2O-pl reactions containing 25 mM Na-Hepes pH 7.5,150 mM NaC1,0.5 mg/ml BSA, 125 pg/ml poly(d1-dC),5 mM MgClz or CaCI2, 4 mM DTT, 10 fmol of 32P-labeledoligonucleotide (-5,000 cpm/fmol), 5% glycerol, and 0.005% bromphenol blue and were incubated at 4 "C for 30 min. Incubation mixtures were analyzed on 7% nondenaturing polyacrylamide gels that were dried and subjected to autoradiography (15).

+

RESULTS

12987

Order of addition

D T r " 2 NEMFIB-2.6 + 2 N E - 1 lane 1 2 I

-

4 3 1 3 4 2 3 1 3 4

2 4 1

5 6

1182U

FIG. 1. NEM inactivation of NFI in HeLa nuclear extracts. Incubations and GMS analyses were performed under standard conditions with [32P]FIB-2.6and 0.6 pg of HeLa nuclear extract ( N E ) . Free sulfhydryl residues were inactivated by incubation with 10 mM NEM for 10 min at 4 "C. Excess NEM was then inactivated by a further incubation with 50 mM DTT for 10 min at 4 "C. The order of additions is shown at the top of the figure. Lane I, minus extract; lane 2, extract added last, no NEM or DTT, lane 3, NEM and DTT added prior to extract; lane 4, extract plus DNA incubated with NEM and DTT; lane 5, extract incubated with NEM and DTT with DNA added last; lane 6, a 5-fold longer exposure of lane 4.

The potential role of Cys residues in the DNA binding activity of NFI was investigated by treating HeLa nuclear extract with the thiol-specific reagent NEM. As shown pre- extracts were mixed in all combinations. No complementation viously, fivespecific NFI-DNA complexes were detected when or inhibition was detected (data not shown). nuclear extracts were incubated with the FIB-2.6 oligonucleThe amount of soluble NFI produced in E. coli from the otide (15) (Fig. 1, lane 2 ) . When NEM was inactivated with pBS vectors is quite low, primarily due to precipitation of DTT before the addition of nuclear extract, no inhibition of NFI-C proteins intoinsoluble inclusion bodies? Therefore, to NFI binding activity was seen (Fig. 1, lane 3 ) . Pretreatment ensure that equivalent amounts of wild-type and mutantNFIof the nuclear extract with NEMabolished binding of all the C220 proteins were compared for DNA binding activity, the forms of NFI (Fig. 1, lane 5). If the extract was incubated various NFI-C proteins were translated in vitro and assayed with FIB-2.6 oligonucleotide before NEM addition, partial by GMS analysis. In vitro translation of mRNAs generated protection of binding activity was seen (Fig. 1, lanes 4 and 6 from the PET vectors produced approximately equal quan( l a n e 6 is a 5-fold longer exposure of lane 4 ) ) . tities of wild-type and mutant NFI-C220b proteins (Fig. 4, The DNA-binding domain of NFI-Ccontains fiveCys lanes 3-8). GMS analysis of these proteins showed that both residues, four of which are conserved in all NFIfamily mem- NFI-C220b and the mutant NFI-C22ObCysl bound specifibers (Fig. 2). The contribution of each of the five Cysresidues cally to FIB-2.6 DNA(Fig. 5, lanes 2-31, while proteins in the DNA binding of NFI-C was investigated using trun- containing mutations inthe four conserved Cys residues NFIcated forms of wild-type and mutanthuman NFI-C proteins. C22ObCys2-5 did not bind DNA (Fig. 5, lanes 4-7). NonspeWild-type NFI-C220 and proteins with individual Cys resi- cific DNAbinding activity was similar in all of the translation dues changed to Ser residues were expressed in E. coli as reactions (Fig. 5,lanes 8-14). described under "Materials and Methods." GMS analyses To test whether modification of essential cysteine residues were used to measure the DNA binding activity of wild-type in NFI promoted irreversible denaturation of the protein, we and mutantproteins. Extracts of E. coli expressing NFI-C220a used the reversible modification reagent DTNB. Incubation and NFI-C22OaCysl proteins generated one specific protein- of extracts containingNFI-C220b with DTNB abolished DNA DNA complex with the FIB-2.6 oligonucleotide (Fig. 3, lanes binding activity (Fig. 6, lanes 3-5). About one-third of the 2-5). The slightly greater binding activity seenwith the Cys- binding activity was restored when excess DTT was added 1 mutant (lanes 4 and 5) was not detected in subsequent after the inactivation with DTNB (Fig. 6, lanes 6-8). Incuanalyses (see Fig. 5 and data not shown). No protein-DNA bation of the extract with [32P]FIB-2.6DNA before the adcomplex was detected with the mutantFIB-2.6C2 oligonucle- dition of DTNB partially prevented inactivation and yielded otide (Fig. 3, lanes 14 and 15). Extracts from cells containing residual DNA binding activity which migrated slightly faster NFI-C220aCys2, -Cys3, -Cys4, and -Cys5 had no detectable than the control NFI-C22O-DNA complex (Fig. 6, lanes 9DNA binding activity (Fig. 3, lanes 6-13). To assay for inhibitors andfor complementation between mutants, pairsof cell * R. M. Gronostajski, unpublished results.

Cys Residues of NFI Required for DNA Binding

12988

Y 8 I8 P .. I

I

D

W

~

I

E

A

L

L

P

W

~

K

E

R

A

V

W

E

~

N

X

Q

X

N

A

f I

S

~

IW LRS X nI i l ( l [ 91

....................................................... A . . . . . . . . .................A . . . . . ....................................... T............S....................... ........ -1a. ................ I...................................S....~.................Q.Y........... ).Iysoxa................. I ................................... S....X.................Q.?........... ......................................... E ........... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . moP. ......................................... ................................................ yIsP.W ......................................... ................................................ ................. 5 . ...................................... I .......................... T..... MYSPYCLTQ. ................ S ...................... .E................................. .g...... .V. ... I(IS8P.

T .Q

8 .P T .Q

FIG. 2. Amino acid conservation in theDNA-binding domain of NFI family members. Amino acid residues 1-191 of the human NFI-C protein are shown aligned with the sequences of other known NFI family members. The sequences are grouped by gene family (C, B, A, and X) andrepresent cDNAs identified from: human (NFI-C) (EMBL X12492); porcine (pNFI-C) (GenBank X12764); chicken (cNFIA, -B, -C,-X)(EMBL X51486,X51485,X51483, and X61225, respectively); hamster ( h N F I - B , -X)(GenBank 504122 and 504123, respectively); rat (rNFI-A) (GenBank X13167); and murine (mNFI-A) (GenBank D90172M58637) sources. A period in the sequence indicates that theresidue is the same as seen in NFI-C. Dashes indicate spaces inserted to produce optimal alignment of the sequences. The shaded boxed regions numbered 1-5 indicate the location and relative conservation of the Cys residues modified in these studies. Cys-2 to -5 are conserved in all family members while Cys-1 is present only in the C family and chicken NFI-X. The alignments were generated with the Pileup program of the Genetics Computer Group (33) and displayed with the program Maligned (provided by Dr. Steven Clark). Residues 1220 of NFI-C constitute the functional NFI DNA-binding domain (10). 2.6 I

WT

pIExtract

0

2 1 " " = i

Cysl cys2

c2

cyss

I

cys4

cyss w

n

1

1

22

~~~~~~

3 4 5 6 7 8 9 101112131415 ~

-

--

2

3

4

5

6

7

8

KDa 97.4 68

-

43

-

29

-

"

746W

FIG. 3. Effect of Cys mutations on DNA binding activity of NFI-C.GMS assays were performed with [32P]FIB-2.6(lanes 1-13) or [:"P]FIB-2.6C2 (lanes 14 and 15) in the absence ( l a n e 1 ) or presence of the indicated amounts of extract from E. coli expressing: NFI-C220a (lanes 2 and 3 ) ; NFI-C22OaCysl (lanes 4 and 5); NFIC220aCys2 (lanes 6 and 7); NFI-C220aCys3 (lanes 8 and 9 ) ; NFIC220aCys4 (lanes 10 and 11); NFI-C220aCys5 (lanes 12 and 13); NFI-C220a ( l a n e 14); and NFI-C22OaCysl ( l a n e 15). The arroul indicates the position of the NFI-C220a-DNA complex. WT, wild type.

18.4 14.3 743w

FIG. 4. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products of wild-type and mutant NFI-C220mRNAs. Products of translation reactions programmed with: no RNA ( l a n e 1 ); 1 pg of bromemosaic virus ( B M V ) mRNA ( l a n e 2 ) ; 3 pg of NFI-C220b mRNA ( l a n e 3); 3 pg of NFIC220bCysl mRNA ( l a n e 4 ) ; 3 pg of NFI-C220bCys2 mRNA( l a n e 5); 3 pg of NFI-C220bCys3 mRNA ( l a n e 6 ) ; 3 pg of NFI-C220bCys4 mRNA ( l a n e 7); and 3 pg of NFI-C220bCys5 mRNA ( l a n e 8). The arrow indicates the position of the wild-type ( WT)and mutantNFIC220b proteins, and the mobility of protein standards is marked on the left (kDa).

11). This faster migrating NFI-C22O-DNA complex increased in quantity andreverted to themobility of the control complex when DTNB modification was reversed with excess DTT (data not shown). Thus, in both the absence and presence of ["'P]FIB-2.6 oligonucleotide, it was possible to restore the DNA binding activity of NFI upon reversal of DTNB modification. The change in mobility seen with DTNB treatment of NFI family members. The 5th, nonconserved residue does is not seen with similar treatment of an NFI-C22OaCysl- not appear to be required for binding activity. These results DNA complex and is therefore likely caused by DTNB modare consistent with and extend previous mutagenesis studies ification of Cys-1 of NFI-C220 (data not shown). on an NFI-A family member. Gounari et al. (11)demonstrated DISCUSSION that the NHa-terminal 206 amino acids of the rat NFI-A These studies indicate an essential role forthe 4 conserved protein were sufficient for oligomerizationand DNA binding cysteine residues in the NH2-terminal DNA-binding domain activity (position 206of the rat A protein corresponds to


1 2 3 4

5

6 7

8 9 1011121314

Order of Addition Time(min)30' Extract DTNB Dl7 DNA -

"A

B

12989 c

30' 10' 20' 30' 10' 20' 30' 10' 20' 30' 1 4 1 1 1 1 1 1 1 1 1 2

2 2 2 2 2 2 2 3 3 " - 3 3 3 " 1 3 3 3 4 4 4 2

3

3

2

2

1 2 3 4 5 6 7 8 9 1 0 1 1 ..~, .. ., ~

'

747w

FIG. 6. Reversibleinactivation of NFI-C220 by DTNB. GMS assays were performed as described with ["P]FIB-2.6 DNA and 7.:5,:, 0.4 pg of E. coli extracts containing NFIX220b. Theorder of addition FIG. 5. DNA binding activity of in vitro translated NFI- of each component of the reaction is shown aboue the lanes. The time C220b proteins. GMSassays were performedwith ["'P]FIB-2.6 of incubation after each addition isshown below. Lane 1, extract plus DNA (lanes 1-7) or [:"P]FIB-2.6C2 DNA (lanes 8-14). The arrow on ["*P]FIB-2.6 (30 min); lane 2, ["P]FIB-2.6 DNA plus DTNB (30 min) the left indicates the position of the NFIX220b-DNAcomplex formed plus DTT (30 min) plus extract (30 min); lanes 3-5 (marked A ) , by 5 pl of translation reactions programmed with: no RNA (lanes 1 extract plus DTNB (10, 20, and 30 min for lanes 3-5, respectively) and 8 ) ; NFI-C220b mRNA (lanes 2 and 9 ) ; NFI-C22ObCysl mRNA plus ["P]FIB-2.6 DNA (30 min); lanes 6-8 (marked B ) , extract plus (lanes 3 and 10); NFI-C220bCys2 mRNA (lanes 4 and 1 1 ) ; NFI- DTNB (30 min) plus DTT (10, 20, and 30 min for lanes 6-8, C220bCys3 mRNA (lanes 5 and 12); NFI-C220bCys4 mRNA (lanes respectively) plus ["'P]FIB-2.6 DNA (30 min); lanes 9-12 (marked 6 and 13);and NFI-C220bCys5 mRNA (lanes 7 and 14). Bands near C),extract plus ["PIFIB-2.6 DNA (30 min) plus DTNB (10, 20, and 30 min for lanes 9-11, respectively). The arrow on the left indicates the top and bottom of the gel are caused by the presence oflow amounts of nonspecific DNA binding activity present in the transla- the position of the NFI-C220b DNA complex. tion extracts. Free oligonucleotide is a t the bottom of the gel. WT, wild type. site-specific DNA-binding proteins. Although protection from

residue198 of the human NFI-C protein in this study). Deletion of 10 or 30 amino acids (correspondingto residues 16-25 and 16-45 of the NFI-C protein used here) was sufficient to abolish DNA binding of the rat NFI-A protein. These deletions had noapparent effect onthe oligomerization properties of the ratNFI-A protein. The regions of the ratNFI-A protein deleted in these earlier studies is NH,-terminal to all five of the cysteine residues examined inthis report. Cysteine residues have been shownto be important in the activity of a number of site-specific DNA binding proteins. One major role forcysteine residues is in coordinating zinc in a number of "zinc finger" DNA-binding proteins (21, 28). Structural studies have indicated that thecoordination of zinc can be involved directly in determining the structure of the DNA-binding regionof these proteins as well as in the dimerization of monomer subunits. However, the DNA-binding domain of NFI family members showsno apparent homology to any of the well characterized zinc finger motifs.Thus, it is not possible to directly relate the role of cysteine residues in NFI with their role in zinc finger proteins. Cysteine residues have also been implicated DNA in binding by the AP-1 family of binding proteins (29). However, with this family of proteins, the mutation of particular cysteine residuesto serine residues increased rather than decreased DNA binding activity and produced proteins that were resistant to inactivation by NEM. These results differ drastically from our analysis of NFI mutants in which each of the cysteine residues appears essential for DNA bindingactivity. There are a number of potential functions for these essential cysteine residues in NFI-DNA interaction. It is possible that one or more of these cysteines may interact directly with DNA. Such an interaction wouldbe unique among known

NEM and DTNB inactivation by prior binding of DNA is consistent with such direct interactions, such protection could also be due to long range alterations in the structure of NFI upon DNA binding. A second possible role for cysteine residues is in the dimerization of NFI. We and others have shown that NFI family membersbind as dimers to DNA, protecting bases in adjacent major groovesof one face of the DNA helix (9, 27, 30, 31). In addition, gel mobility shift and chemical cross-linking studies have indicated that NFI binds to DNA as either homo- or heterodimers of different NFI subunits (911). Thus, it is likely that a defect in dimerization would render mutant NFI proteins unable to bind DNA. Such a role for cysteine residues in dimerization is seen in the second zinc finger of the glucocorticoid receptor, which appears to play a role in stabilization of the dimeric formof the protein (32). Future studies should allow us to distinguish between these and other possiblerolesfor the conservedcysteine residues inthe NH, terminus of NFI family members. Acknowledgments-We thank S. McCracken, N. Miyamoto, and C. Campbell for valuablediscussions, K. Diep for technical assistance, and R. Pileggi for preparation of the manuscript. REFERENCES 1. Nagata, K., Guggenheimer, R. A., Enomoto, T., Lichy, J. H., and Hurwitz, J. (1982) Proc. Natl. Acad. Sci. U.S. A. 79, 6438-

6442 2. Wang, K., and Pearson, G. D. (1985) Nucleic Acids Res. 13,5173-

5187 3. Hay, R. T. (1985) EMBO J. 4,421-426 4. Rosenfeld, P. J., O'Neill, E. A., Wides, R. J., and Kelly, T. J. (1987) Mol. Cell. Bwl. 7,875-886 5. Gronostajski, R. M., Knox, J., Berry, D., and Miyamoto, N. G. (1988) Nucleic Acids Res. 16, 2087-2098

12990


6. Abraham, L. J., Bradshaw, A. D., Shiels, B. R., Northemann, W., Hudson, G., and Fey, G. H.(1990) Mol. Cell. Bwl. 1 0 , 34833491 7. Santoro, C., Mermod, N., Andrews, P. C., and Tjian, R. (1988) Nature 3 3 4 , 218-224 8. Rossi, P., Karsenty, G., Roberts, A. B., Roche, N. S., Sporn, M. B., and de Crombrugghe, B. (1988) Cell 62,405-414 9. de Vries, E., van Driel, W., van den Heuvel, S. J. L., and van der Vliet, P. C. (1987) EMBO J. 6 , 161-168 10. Mermod, N., O’Neill, E. A., Kelly, T. J., and Tjian, R. (1989) Cell 68,741-753 11. Gounari, F., De Francesco, R., Schmitt, J., van der Vliet, P. C., Cortese, R., and Stunnenberg, H. (1990) EMBO J. 9,559-566 12. Meisterernst, M., Gander, I.,Rogge, L., and Winnacker, E. L. (1988) Nucleic Acids Res. 16,4419-4435 13. Leegwater, P. A. J., van Driel, W., and van der Vliet, P. C. (1985) EMBO J. 4,1515-1521 14. Meisterernst, M., Rogge, L., Foeckler, R., Karaghiosoff, M., and Winnacker, E. L. (1989) Biochemistry 28,8191-8200 15. Goyal, N., Knox, J., and Gronostajski, R.M. (1990) Mol. CeU. Biol. 1 0 , 1041-1048 16. Kruse, U.,Qian, F., and Sippel, A. E. (1991) Nucleic Acids Res. 19,6641 17. Rupp, R. A. W., Kruse, U., Multhaup, G., Gobel, U., Beyreuther, K., and Sippel, A. E. (1990) Nucleic Acids Res. 1 8 , 2607-2616 18. Paonessa, G.; Gounari, F., Frank, R., and Cortese, R. (1988) EMBO J. 7,3115-3123

19. Jackson, S. P., and Tjian, R. (1989) Proc. Natl. Acad. Sci.U. S. A . 86,1781-1785 20. Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 6 3 , 155-165 21. Mitchell, P. J., and Tjian, R. (1989) Science 246,371-378 22. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 164,367-383 23. Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U.S. A . 84,4767-4771 24. Studier, F.W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990) Methods Enzymol. 186,60-89 25. Bradford, M. (1976) Anal. Biochem. 7 2 , 248-254 26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual,Cold Spring HarborLaboratory, Cold Spring Harbor, NY 27. Gronostajski, R. M. (1986) Nucleic Acids Res. 1 4 , 9117-9132 28. Berg, J. M. (1990) Annu. Rev. Biophys. Biophys. Chem. 19,405421 29. Abate, C.. Patel, L., Rauscher, F. J... 111,. and Curran,. T. (1990) . ~cience.249,i15i-1161 30. Gronostaiski. R. M. (1987) Nucleic Acids Res. 16.5545-5559 31. GronostGski; R. M., Adhya, S., Nagata, K., Guggenheimer, R. A., and Hurwitz, J. (1985) Mol. Cell. Biol. 6,964-971 32. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and Sigler, P. B. (1991) Nature 352,497-505 33. Devereux, J., Haeberli, P., and Smithies, 0.(1984) Nucleic Acids Res. 12,387-395