Cytokine Gene Expression in Human Peripheral Blood. Mononuclear Cells ...... 139:2761-2767. 17. Djeu, J. Y., D. K. Blanchard, A. L. Richards, and H. Freidman.
Vol. 61, No. 10
INFECrION AND IMMUNITY, Oct. 1993, p. 4105-4111
0019-9567/93/104105-07$02.00/0 Copyright © 1993, American Society for Microbiology
Cytokine Gene Expression in Human Peripheral Blood Mononuclear Cells Stimulated by Mannoprotein Constituents from Candida albicans CLARA M. AUSIELLO,1'2 FRANCESCA URBANI,2 SANDRA GESSANI,3 GIULIO C. SPAGNOLI,4 MARIA J. GOMEZ,2 AND ANTONIO CASSONE2* Istituto CNR di Tipizzazione Tissutale e Problemi della Dialisil and Laboratori di Batteriologia e Micologia Medica2 e Virologia, 3 Istituto Superiore di Sanita, 00161 Rome, Italy, and Departments of Surgery and Research, University ofBasel, 4031 Basel, Switzerland4 Received 7 April 1993/Returned for modification 7 May 1993/Accepted 23 July 1993
The expression of cytokine genes in cultures of human peripheral blood mononuclear cells (PBMC) stimulated with mannoprotein constituents (MP) of Candida albicans has been studied by means of Si nuclease mapping analysis, polymerase chain reaction, and enzyme-linked immunosorbent assay. MP induced early, consistent, and long-lasting production of interleukin-113 (IL-11), tumor necrosis factor alpha, and IL-6 mRNAs. Similar results were obtained when the same PBMC cultures were stimulated with the purified protein derivative (PPD) from Mycobacterium tuberculosis or with II-2, although lower levels of IL-6 mRNA were detected in IL-2-stimulated cells than in MP- or PPD-stimulated cells. MP, PPD, and IL-2 induced appreciable levels of granulocyte-macrophage colony-stimulating factor and gamma interferon, but only MP and PPD were able to induce IL-2 mRNA. MP were unable to stimulate a consistent expression of the genes encoding for IL-4, IL-5, and IL-10, while low, sometimes barely detectable levels of these cytokine mRNAs were observed in PPDor IL-2-stimulated PBMC cultures. When protein synthesis of MP-stimulated PBMC was inhibited by cycloheximide, a superinduction of mRNAs for IL-4 and IL-10 and, more markedly, gamma interferon was observed. Overall, these results highlight the powerful, selective induction of cytokine gene expression by MP constituents of C. albicans in human PBMC cultures, thus providing some functional clues to explain the efficient state of the anticandidal response in normal human subjects.
constituents, like those modulated by bacterial lipopolysaccharide or muramyl-dipeptide (11, 18). Both antigen-specific T-cell responses and immunomodulatory activities are regulated by cytokines, which influence the activities of T cells, B cells, and natural immune effectors, in an intricate interplay of positive and negative regulatory signals (2, 45). Therefore, a comprehensive evaluation of the cytokine profile was deemed necessary for a better insight into the mechanisms of MP induction of Candidaspecific and nonspecific immune responses. Starting from preliminary observations on a limited spectrum of cytokines (4, 47), we have assayed both gene mRNA expression and production of cytokines in PBMC cultures of subjects normally responding to candidal MP. We also attempted to determine whether MP-induced cytokine mRNA expression required de novo synthesis of proteins by using cycloheximide (CHX), an inhibitor of protein synthesis (1, 23, 35). Finally, the effects of MP on cytokine production were compared with those induced by an antigenic stimulant, such as the protein-purified derivative (PPD) of Mycobacterium tuberculosis, and IL-2.
Cell wall components of the human commensal microorganism Candida albicans have repeatedly been shown to induce or modulate immune responses in a variety of in vitro and in vivo models (3, 11, 31, 32). For example, strong anticancer responses may be detected in mice injected with heat-killed yeast and mycelial cells of C. albicans (12, 28). These responses, mediated by the host's immune system (28), are equally induced by inoculating mice with glucan or mannoprotein components (MP) of the fungal cell wall (42, 43). Furthermore, candidal MP strongly activate effectors of natural immunity such as natural killer (NK) cells, macrophages, and polymorphonuclear cells (16, 17, 19, 34, 42). MP contain one or more constituents acting as recall antigens in inducing lymphoproliferation (6, 36, 46, 47), production of gamma interferon (IFN-y) and interleukin-2 (IL-2) (4, 6, 47), as well as non-major histocompatibility complex-restricted cell-mediated cytotoxicity in cultures of peripheral blood mononuclear cells (PBMC) of normal human donors (5). Moreover, mannan, the polysaccharide constituent of MP, has long been known to possess immunosuppressive activities (18, 36). In AIDS patients, immune responses to MP antigens are early and deeply depressed, and no generation of cell-mediated cytotoxicity or IFN--y production is observed (37). Such defective responses are associated with enhanced predisposition to opportunistic candidal infections (3, 10, 26, 32). Thus, immune responses to candidal MP are relevant for specific recognition of Candida antigens, for the host-parasite relationship in candidiasis, and for immunomodulation of nonspecific responses induced by microbial *
MATERIALS AND METHODS Mitogenic and antigenic stimulants. MP from C. albicans were obtained from washed yeast-form C. albicans BP serotype A and were partially purified as described elsewhere (6, 47). Recombinant IL-2 was kindly provided by G. Garotta, Hoffmann-La Roche, Basel, Switzerland. PPD was obtained by the Statens Seruminstitut (Copenhagen, Denmark). All stimulants were adsorbed to polymyxin-B sulfate
Corresponding author. 4105
4106
INFECT. IMMUN.
AUSIELLO ET AL.
agarose (Sigma, St. Louis, Mo.) for removal of any potentially contaminating endotoxin. PBMC cultures and cell proliferation. Heparinated venous peripheral blood samples were obtained from healthy donors. PBMC were isolated by centrifugation on a density gradient (Lymphoprep; Nyegaard, Oslo, Norway) and washed twice in RPMI 1640 medium (GIBCO, Grand Island, N.Y.). Cells were then diluted in RPMI 1640 medium supplemented with 5% pooled AB serum and antibiotics (penicillin [100 IU/ml] and streptomycin [0.1 mg/ml]; GIBCO) (6). Cells were incubated at a concentration of 106/ml in the presence of MP (50 ,ug/ml), IL-2 (100 U/ml), or PPD (10 p.g/ml). In selected experiments, PBMC were also stimulated for 18 h with the anti-CD3 mitogenic monoclonal antibody CBT3G as previously reported (46). To isolate total RNA, PBMC were cultured in 25-cm2 flasks in 10 ml of complete medium and cultured for different times at 37°C under 5% CO2. When CHX was used, PBMC were preincubated 10 min with 50 p,g of CHX per ml and cultured for 5 h in the presence or absence of the relevant stimulus before RNA
extraction. Culture supematants were collected to measure the cytokine production by enzyme-linked immunosorbent assay (ELISA; see below). PBMC proliferation was measured in triplicate in 0.2 ml in 96-well flat-bottom microwell plates. Plates were incubated in 5% CO2 at 37°C and harvested on day 7, 18 h after addition of 0.5 ,uCi of [3H]thymidine (NEN-DuPont). Analysis of cytokine mRNA expression. (i) Si nuclease mapping. Total cellular RNA was extracted as described by Chomczynski and Sacchi (14). To synthesize cRNA probes, we used four different plasmids containing cDNA for human IL-1,B, IFN--y, IL-2, and IL-6. The IL-lp cDNA was an EcoRI-HindIII fragment inserted into plasmid SP65 and linearized with EcoRI; the IFN--y cDNA was a 439-bp TaqI-Sau3A fragment inserted into SP65 and linearized with HindIII; the IL-6 cDNA was inserted into G-7, obtained from P. B. Segal (Rockfeller University), containing approximately 900 bp of the coding region of the IL-6 gene (29) inserted between the EcoRI and HindIII sites of IGEM-2; finally, the IL-2 cDNA EcoRI-HindIII fragment, inserted into pGEM3 (Promega Biotec), was linearized with EcoRI. RNA probe labeling and hybridization with total cellular RNA were performed as described previously (24). Briefly, [32P]cRNA was purified by phenol extraction and electrophoresed on 1% low-melting-point agarose gels. The corresponding gel slice was excised and melted at 65°C. The labeled cRNA was then added to 10 ,ug of cellular RNA dissolved in hybridization buffer. The reaction mixture was digested with S1 nuclease (Boehringer, Mannheim, Germany), extracted with chloroform, and fractionated on 5% polyacrylamide gels with Tris-borate buffer. Radioactivity was revealed by exposure of the dried gel to X-Omat AR-5 X-ray film (Eastman Kodak Co., Rochester, N.Y.). The relative density of mRNA bands was determined by using an LKB 2202 Ultroscan densitometer. (ii) PCR. Total RNA (1.5 p,g/30-p,l reaction) was incubated for 10 min at 65°C with 0.1 ,ug of oligo(dT1218) (Pharmacia) per ml. After ice cooling, 20 U of Moloney murine leukemia virus reverse transcriptase, 20 mM dithiothreitol, and 5 x Moloney murine leukemia virus reverse transcriptase buffer were added as recommended by the manufacturer (GIBCOBRL, Life Technologies, Inc., Gaithersburg, Md.). The cDNAs thus obtained were tested for the presence of gene sequences in polymerase chain reactions (PCR) (GeneAmp kit; Perkin-Elmer Cetus, Norwalk, Conn.) performed in 20-,ul volumes by using specific primer pairs. Two microli-
TABLE 1. PBMC proliferation induced by IL-2, MP, or PPD' Stimulus
None IL-2, 100 U/ml MP, 50 ,ug/ml PPD, 10 ,ug/ml
No. of
subjects subjects 7 7 7 4
Mean [3Hlthymidine incorporation (103 cpm) ±~ ~-+- SE (range)'
1.0 41.0 33.7 32.9
± ± ± ±
0.1 (0.4-2.3) 7.8 (17.8-67.3) 6.5 (10.8-55.0) 9.8 (21.7-48.3)
a 2 x 105 PBMC per well were cultured for 7 days with the indicated stimuli. b For further details, see Materials and Methods.
ters of the relevant cDNA was amplified in the presence of 0.05 ,uM 5' and 3' primers, 2 mM deoxynucleotides, and 0.5 U of AmpliTaq polymerase and GenAmp lOx PCR buffer. The PCR was performed in a Perkin-Elmer thermal cycler for 25 cycles as follows: 40 s of denaturation at 94°C, 40 s of annealing at 62°C, and a 1-min extension at 72°C. The reaction product was visualized by electrophoresis, using 10 ,ul of the reaction mixture and 2 ,ul of loading buffer containing ethidium bromide (0.5 ,ug/ml; Sigma); 0.5 ,ug of HaeIIIdigested 4X174 DNA (GIBCO-BRL) was run in parallel. Cytokine-specific primer pairs were synthesized on an Applied Biosystems synthesizer (Applied Biosystems, Inc., Foster City, Calif.), using the sequences published by Ehlers and Smith (20). Tumor necrosis factor alpha (TNF-a) (694 bp) and IL-10 (575 bp) primer pairs sequences were designed on the basis of published gene sequences (44, 48) as follows: TNF-a sense, ATGAGCACTGAAAGCATGATCCGG; TNFa antisense, GCAATGATCCCAAAGTAGACCTGCCC; IL10 sense, AAGGCATGCACAGCTCAGCACT; and IL-10 antisense, TCCTAGAGTCTATAGAGTCGCCA. The primer sequences were complementary to sequences in the exons or spanned exon-exon junctions and thus were RNA specific. Cytokine production measurements. TNF-a, IFN-y, IL-4, and IL-6 were measured in PBMC culture supernatants, collected at different time intervals, by commercial ELISA (Quantikine; RD Systems, Minneapolis, Minn.) as specified by the manufacturer.
RESULTS PBMC proliferation in response to MP, PPD, and IL-2. The proliferative response of PBMC from the healthy donors used in this study was determined as a control for lymphocyte activation. Table 1 shows that all donors studied had a good proliferative response to MP, PPD, or IL-2. Their PBMC were thus used to analyze the cytokine profile. Cytokine mRNA expression in activated PBMC cultures determined by S1 nuclease mapping analysis. S1 mapping analysis was initially used to quantitate mRNA accumulation for IL-1ip, IL-6, IL-2, and IFN--y in unstimulated as well as MP- or IL-2-stimulated PBMC. Figure 1A shows the results of IFN-y mRNA accumulation monitored at 5, 18, 48, and 72 h. Densitometry of the autoradiographs showed that IFN--y mRNA was maximally expressed after 48 h of stimulation in both MP- and IL-2activated PBMC (Fig. 1B). As summarized in Table 2, MP was also an inducer of IL-1p, IL-6, and IL-2 mRNAs, the expression of which peaked at 18 h, in contrast with IFN-,y mRNA expression, which peaked at 48 h. In IL-2-stimulated PBMC, IL-13 and IFN-y mRNAs but no IL-2 and IL-6 mRNAs were detected. PCR analysis. Since S1 mapping analysis requires relatively high amount of RNA (10 to 15 ,ug for each sample), we
VOL. 61, 1993
A
CANDIDAL MANNOPROTEINS AND CYTOKINES 5
18
48
12 3
12 3
12 3
bE
B
WW"
72
hours
12 3 L
W
-I FN-y
100-
m
50-
L-
rco
>nZ
Zn
(11
FIG. 2. PCR analysis of cytokine mRNA induced in anti-CD3activated PBMC. Human PBMC were cultured in the presence of the anti-CD3 monoclonal antibody CBT3G at 10 p1g/ml. After 18 h, RNA was extracted and reverse transcribed. The cDNA obtained was assayed for the presence of specific cytokine mRNA by 25 cycles of PCR as described in Materials and Methods. Reaction products were run on a 1% agarose gel in the presence of appropriate molecular weight markers (arrow). 3-Actin is the positive control.
TRANSCRIPT LEVELS OF IEN-GAMMA
'C
4107
LHH~~7
c0 FIG. 1. Kinetics of IL-2- and MP-induced IFN-y mRNA expression, as analyzed by Si mapping. (A) Human PBMC were cultured either in the absence (lanes 1) or in the presence of IL-2 (100 U/ml) (lanes 2) or MP (50 ,ug/ml) (lanes 3). At the indicated time, cells were harvested and lysed, and total RNA was extracted and hybridized to a cRNA transcript as described in Materials and Methods. The IFN--y lane is the positive transcription control. (B) Scanning densitometer tracings of IFN-y bands shown in panel A.
resorted to the use of a PCR technique in all subsequent experiments. In preliminary assays, we assessed the reproducibility and consistency of the experimental conditions used for PCR analysis. Stimulation of PBMC cultures with the mitogenic anti-CD3 antibody demonstrated that the conditions under which the PCR was run were suitable to detect an appreciable signal from all cytokine mRNAs tested (Fig. 2). In other experiments, serial 10-fold dilutions of cDNA were subjected to 25 PCR cycles using 1-actin primers; the 1-actin mRNA signal was seen to decrease progressively with increasing dilution, being still detectable at a cDNA dilution of 1:1,000 (Fig. 3). This effect was observed in two independent determinations for each cDNA dilution, which demonstrated the high reproducibility of our PCR conditions. This analysis of PCR efficiency was also applied to IFN-y, IL-2, TNF-a, and granulocyte-macrophage colony-stimulating factor (GM-CSF) transcripts, as demonstrated in Fig. 4, which shows results for MP-stimulated PBMC cultures. After these preliminary experiments, we tested cytokine mRNA expression in response to the various stimulants in a number of PBMC cultures from separate, independent do-
nors. Figure 5 shows a typical cytokine profile from an experiment with one of four PBMC donors in which total RNA was extracted at 5, 20, 48, and 72 h from PBMC, either unstimulated or stimulated with IL-2 (100 U/ml), MP (50 ,g/ml), or PPD (10 p,g/ml). Accumulation of IL-13 and TNF-a mRNAs in MP-, PPD-, and IL-2-stimulated PBMC was detected after 5 to 20 h and persisted at elevated levels for the 72 h of culture. GM-CSF and IFN--y mRNAs were also detected in PBMC stimulated by IL-2, MP, or PPD. IL-2 mRNA was detectable only in MP- and PPD-stimulated cultures and only for the first 48 h. IL-6 mRNA was more readily and abundantly expressed in MP- and PPD-activated cultures than in IL-2-stimulated ones (see also Fig. 7). There were donor-dependent variations in the intensity of the band for each of the cytokine mRNAs tested, but in all cases, there was a detectable signal in the PCR of the samples from MP-stimulated cultures. Figure 5 also shows the profile of IL4, IL-5, and IL-10 mRNAs. Compared with the intensity of the signals from all other cytokine messages, the IL4, IL-5, and IL-10 mRNAs were substantially absent in MP-stimulated cultures. IL-5 mRNA was late and barely detectable in IL-2- or PPDstimulated cultures, while a low-intensity signal from IL-10 mRNA was essentially detectable only in PPD-stimulated cells. This pattern was confirmed in PBMC cultures of all other donors tested. In the specific donor of the experiment described above, little IFN--y mRNA was detected in MP-stimulated PBMC. However, with all other donors, IFN-y message was abundant. Figure 6 shows IFN-y mRNA in PBMC of a subject different from those used for Fig. 2 and 5, as assayed by Si
TABLE 2. Summary of cytokine mRNA detection by S1 mapping analysis Cytokine mRNA
IL-11 IL-2 IL-6
IFN-y
Peak production (absorbance units)
Time of peak production (h)
MP
IL-2
MP
IL-2
0.64 0.11 0.16 0.72
0.31
18 18 18 48
18
0.57
48
l
2
3
4
T
5
FIG. 3. Effects of cDNA serial dilution on 1-actin mRNA expression. Undiluted (lanes 1) or 10-fold serially diluted (1:10 [lanes 2], 1:100 [lanes 3], and 1:1,000 [lanes 4]) duplicate cDNA samples (2 pl) from cultured unstimulated PBMC were amplified by 25 cycles of PCR using actin-specific primers. Lanes 5 represent the diluent (2 pl of H20) only. Reaction products were run on a 1% agarose gel in the presence of appropriate molecular weight markers (arrow).
4108
INFECT. IMMUN.
AUSIELLO ET AL.
TNFa.
GM-CSF
IFN y
5
IL2
20
48
72 hours
p Actin 1 2 3 4
1 2 3 4
1 2 3 4 t1 2 3 4
FIG. 4. Effects of serial cDNA dilution on cytokine mRNA expression. Human PBMC were cultured in the presence of MP (50 p.g/ml). After 48 h, RNA was extracted and reverse transcribed. The cDNA obtained was serially diluted and assayed for the presence of specific cytokine mRNA by 25 cycles of PCR as described in Materials and Methods. Reaction products were run on a 1% agarose gel in the presence of appropriate molecular weight markers (arrows) and with use of the cytokine-specific primers, as indicated. Lanes: 1, undiluted cDNA; 2, 1:5 dilution; 3, 1:25 dilution; 4, 1:125 dilution.
mapping and PCR. The results clearly indicated that for both MP- and IL-2-stimulated cells, the IFN--y mRNA signals obtained with the two techniques were comparable. Effects of CHX on cytokine mRNA levels. To evaluate whether MP-mediated cytokine induction was a primary response not requiring protein synthesis, we analyzed the expression of the corresponding mRNA in the presence of CHX. Figure 7 shows the results of one representative experiment performed with PBMC preincubated for 10 min with CHX (50 ,ug/ml) and then treated for 5 h with each stimulant. Two distinct patterns of variation in cytokine mRNA expression were observed in CHX-treated cultures, depending on the stimulant used. In the first, CHX induced accumulated levels of mRNAs for IL-10, IL-4, IFN-y, and GM-CSF which were either undetectable or at the threshold of detection at 5 h in control cells. In particular, IFN--y mRNA was substantially elevated in CHX-treated PBMC either unstimulated or stimulated with IL-2 or MP. In the second pattern, CHX inhibited the accumulation of PPDinduced IL-2 mRNA and MP-induced GM-CSF mRNA while having variable effects on the expression of IL-6 mRNA, in agreement with previous reports (1, 9, 41). MP-induced IL-6 mRNA expression was inhibited by CHX in the samples from the donor used for the experiment reported in Fig. 7 but not in samples from the other three donors. Apart from the variations in the effect of CHX on IL-6 mRNA, the patterns described above were consistently observed in samples from the three other donors tested. Cytokine detection by ELISA. TNF-ot, IL-4, IL-6, and IFN-,y production was measured by ELISA on supernatants of IL-2- or MP-stimulated PBMC collected at different time intervals (Fig. 8). Although with a different kinetics, particularly relevant for TNF-a in the donor represented in Fig. 5, both MP and IL-2 induced TNF-a, IFN-y, and IL-6 but not IL-4 production. The lack of IL-4 production was evident even after prolonged incubation (144 h) in the presence of the stimulant, when PBMC cultures proliferate extensively (4, 5) (Table 1). Tests of the other three donors produced similar qualitative results and no production of IL-4.
DISCUSSION In this study, we analyzed cytokine mRNA expression and cytokine production in PBMC stimulated by Candida MP in comparison with stimulation of the same PBMC cultures by PPD or IL-2. To our knowledge, a simultaneous
IL 1 p IL 2 IL 6
IFN y IL 4
IL 5
IL 1 0
TNF a
GM-CSF 1234 1234
1234
1234
FIG. 5. Kinetics of cytokine mRNA expression in IL-2, MP-, or PPD-activated PBMC, as detected by PCR analysis. Human PBMC were cultured either in the absence (lanes 1) or in the presence of IL-2 (100 U/ml) (lanes 2), MP (50 ,ug/ml) (lanes 3), or PPD (10 ,ug/ml) (lanes 4). At the indicated time, cells were harvested and lysed, and total RNA was extracted and reverse transcribed. The cDNAs obtained were assayed for the presence of specific cytokine mRNA by 25 cycles of PCR as described in Materials and Methods. Reaction products were run on 1% agarose gels in the presence of appropriate molecular weight markers (leftmost lane). 1-Actin is the positive transcription control.
examination of multiple cytokine messages in human PBMC stimulated by a well-defined, dominant Candida immunogen (4, 6, 46) has not been previously reported. For some cytokines (IL-1,1, IL-2, IL-6, and IFN-y), this study also attempted a comparison of two sensitive and reliable methods of studying gene expression, i.e., Si nuclease mapping nuclease and PCR analysis. Despite quantitative variations detected in the different donors, presumably reflecting a different degree of natural sensitization to C. albicans, the overall cytokine profile observed in MP-stimulated PBMC clearly demonstrated a consistent production of IL-1,B, TNF-ao, IL-6, GM-CSF, IL-2, and IFN--y but no or very low production of IL-4, IL-5,
CANDIDAL MANNOPROTEINS AND CYTOKINES
VOL. 61, 1993
B
A
1 2 3
23
t
FIG. 6. Expression of IFN-y mRNA in IL-2- and MP-activated PBMC, as detected by Si mapping and PCR analysis. PBMC of a single donor were cultured in complete medium alone (lanes 1) or in the presence of IL-2 (100 U/ml) or MP (50 ±gltml) (lanes 2 or 3, respectively). After 48 h, total RNA was extracted and analyzed for the presence of specific IFN-y mRNA by S1 mapping (A) or PCR (B) as described in Materials and Methods. The arrow points to the molecular weight markers.
and IL-10. This profile was similar to that observed with another antigenic activator, PPD (15, 27, 38). Mitogenic stimulation induced by IL-2 showed a slightly different cytokine profile, as very little IL-6 and no IL-2 itself were produced. The substantial inability of MP-activated PBMC to produce consistent levels of IL-4, IL-5, and IL-10 could not be ascribed to technical faults or unsuitable experimental conditions, as the messages for these cytokines were promptly detected in the mitogenic, anti-CD3 antibodystimulated cells or, albeit to a low intensity, in PPD-stimulated, CHX-treated cultures. Kinetics of mRNA expression demonstrated that whatever the stimulant, PBMC cultures produced early and abundant messages for IL-1lB and TNF-a which persisted at high levels for 48 to 72 h. It is of interest that under our experimental conditions, some expression of the genes for these two important inflammatory and immunomodulatory
+CHX -CHX I
+CHX -CHX
-%,
A--l
0
A_
cytokines was also observed in control, unstimulated cultures. In contrast, IFN--y mRNA was expressed relatively late (20 to 48 h) unless it was superinduced by CHX (see below). This temporal pattern of IFN--y gene expression is totally consistent with previous observations made by ourselves (4, 5) and others (22) on IFN-y production in human PBMC. Consistent with cytokine messages was the actual cytokine production, as IL-2, IFN--y, TNF-a, and IL-6, but no IL-4, were detected by ELISA in MP-stimulated PBMC. Recent data support the notion that in humans, as in mice, two functionally distinct T-helper (Th) lymphocyte subsets (Thl and Th2) are involved in differential responses to microbial antigens (27, 38, 45). Del Prete et al. (15) have shown that human T-cell lines and a vast majority of PPD-specific T-cell clones secreted IL-2 and IFN-y but no, or limited amounts of, IL-4 and IL-5. A direct comparison of our results with those obtained in T-cell lines or clones is inappropriate because we have not determined the cellular source of the cytokines detected in this study. Nonetheless, the absence or very low production of IL-4, IL-5, and IL-10 in our MP- or PPD-stimulated cells is noticeable and would suggest that among the responding Th cells, the Thl subset predominates. In this context, relevant are the observations made in a murine vaccination model with attenuated yeast-form cells of C. albicans, in which the protective response correlated with the production by murine splenocytes in vitro of large amounts of the Thl cytokines IL-2 and IFN--y coupled with downregulation of the Th2 cytokines IL-4 and IL-6 (7, 13, 39, 40). Of interest is that a strong delayed-type hypersensitivity response, a typical in vivo correlate of Thl lymphocyte activation, is elicited by MP in the murine model described above (38a). However, other cellular types certainly contribute to the cytokine pattern detected in our PBMC cultures, as suggested by prompt, abundant, and long-lasting IL-13, TNF-a, and IL-6 mRNA production. Monocytes, neutrophils, and NK lymphocytes respond to MP stimulation with abundant production of IL-13 and/or IL-6 and TNF-a (4, 5, 33, 34, 43). Blanchard et al. (8) have shown that NK lymphocytes are
3 Actin
11aooo
GM-CSF IL1 IL2
TNF ax
IL4 400
TNF a
IL1O IL 5
IFN y 1E IL6~~~~~~t
1234 1 234 1234 1234 FIG. 7. Effect of CHX treatment on cytokine mRNA expression in IL-2-, MP-, or PPD-activated PBMC. Human PBMC were preincubated or not with CHX (50 JLg/ml) for 10 min and then cultured for 5 h either in the absence (lanes 1) or in the presence of IL-2 (100 U/ml) (lanes 2), MP (50 Fg/ml) (lanes 3), or PPD (10 pg/ml) (lanes 4). Total RNA was extracted and reverse transcribed as described in Materials and Methods.
4109
1--A :
500 I
0
24
48
72
96
120
hours
144
IL4
E 200
IxIl
0
24
48
72
96
120
144
hours
FIG. 8. IL-6, TNF-a, IL-4, and IFN-y production in IL-2- or MP-activated PBMC. Human PBMC were cultured in the absence (0) or in the presence of IL-2 (100 U/ml) (U) or MP (50 tLg/ml) (A) in RPMI medium. Culture supernatants were collected at different time intervals (5, 20, 48, 72, and 144 h), and cytokine production was measured by ELISA. The PBMC donor was different from that studied for mRNA PCR in Fig. 5.
4110
AUSIELLO ET AL.
stimulated by intact Candida cells, which express MP antigens on their surface (12), to produce GM-CSF. The expression of IFN--y and GM-CSF genes, whatever their cellular sources, coupled with the absence of IL-4 gene expression during MP-induced PBMC activation, may have special significance for the anticandidal state of normal human subjects. In fact, IFN-y and GM-CSF are strong activators, whereas IL-4 is an inhibitor, of the activity of those natural immunoeffectors (polymorphonuclear cells and macrophages) which play a decisive role in the defense against disseminated candidiasis (21, 25, 30). Overall, the MPactivated PBMC seem to express a full set of cytokines probably produced by the monocytes and the Thl and NK lymphocytes. We speculate that recognition of MP constituents by the aforementioned cells, as well as by neutrophils (34), may represent a key factor in the natural resistance of
immunocompetent subjects to candidiasis. CHX has been shown to superinduce mRNA for some cytokines (1, 9, 23, 41). In our experiments, CHX manifested quite divergent effects on the expression of cytokine mRNA. There was superinduction of IFN--y, but also of IL-4 and IL-10, mRNA accumulation, that may be explained by stabilization of the mRNA, which is constitutively expressed in PBMC but markedly unstable. In contrast, IL-2 mRNA accumulation was clearly inhibited by CHX, indicating that protein synthesis is required for PBMC activation. Presumably, the induction of this mRNA is a secondary phenomenon that is mediated by intermediary proteins synthesized in response to specific stimuli. Although nuclear run-on experiments are necessary to understand the exact mechanism of the effect of CHX on regulation of RNA accumulation, these data suggest that the expression of cytokine mRNA following MP stimulation may be differentially regulated, even considering the different cell types which certainly participate in the whole MP-induced activation process in human PBMC. ACKNOWLEDGMENTS Thanks are due to C. Baglioni (Albany, N.Y.), G. De Libero (Basel, Switzerland), and F. Malavasi (Torino, Italy) for reviewing the manuscript and providing constructive criticisms. Thanks are also due to S. Mochi for primer synthesis. This work was supported by grants from CNR (Italy) Special Project "A.C.R.O." and Ingegneria Genetica (Contract 91.00054.99) and from the National AIDS Project, Istituto Superiore di SanitaMinistero della Sanita (contract 6206-021). REFERENCES 1. Akashi, M., A. H. Loussararian, D. C. Adelman, M. Saito, and H. P. Koeffler. 1990. Role of lymphotoxin in expression of interleukin-6 in human fibroblasts. J. Clin. Invest. 85:121-129. 2. Arai, K., F. Lee, A. Miyajima, S. Miyatake, N. Arai, and T. Yokota. 1990. Cytokines: coordinators of immune and inflammatory responses. Ann. Rev. Biochem. 59:783-836. 3. Ashman, R. B., and J. M. Papadimitriou. 1990. What's new in the mechanisms of the host resistance to Candida albicans infection? Pathol. Res. Pract. 186:527-534. 4. Ausiello, C. M., C. Palma, A. Maleci, G. C. Spagnoli, C. Amici, G. Antonelli, C. U. Casciani, and A. Cassone. 1991. Cell mediated cytotoxicity and cytokine production in peripheral blood mononuclear cells of glioma patients. Eur. J. Cancer 5:646-650. 5. Ausiello, C. M., C. Palma, G. C. Spagnoli, A. Piazza, C. U. Casciani, and A. Cassone. 1989. Cytotoxic effectors in human peripheral blood mononuclear cells induced by a mannoprotein complex of Candida albicans: a comparison with interleukin-2activated killer cells. Cell. Immunol. 121:349-359. 6. Ausiello, C. M., G. C. Spagnoli, M. Boccanera, I. Casalinuovo, F. Malavasi, C. U. Casciani, and A. Cassone. 1986. Proliferation
INFECT. IMMUN.
7.
8.
9.
10.
11. 12.
13.
14. 15.
16.
17.
18. 19. 20. 21.
22. 23.
24.
of human peripheral blood mononuclear cells induced by Candida albicans and its cell wall fractions. J. Med. Microbiol. 22:195-202. Bistoni, F., A. Vecchiarelli, E. Cenci, P. Puccetti, P. Marconi, and A. Cassone. 1986. Evidence for macrophage-mediated protection against lethal C. albicans infection. Infect. Immun. 51:668-674. Blanchard, D. K., M. B. Michelini-Norris, and J. Y. Djeu. 1991. Production of GM-CSF by large granular lymphocytes stimulated with Candida albicans: role in activation of human neutrophil function. Blood 77:2259-2265. Branch, M. A., N. A. Cicco, D. Riedel, T. Hirano, T. Kishimoto, R. H. Mertelsmann, and F. Herrmann. 1990. Mechanisms of differential regulation of interleukin-6 mRNA accumulation by tumor necrosis factor-a and lymphotoxin during monocytic differentiation. FEBS Lett. 263:349-354. Brawner, D. L., and J. M. Cutler. 1989. Oral Candida albicans isolates from nonhospitalized normal carriers, immunocompetent hospitalized patients, and immunocompromised patients with or without acquired immunodeficiency syndrome. J. Clin. Microbiol. 27:1335-1341. Cassone, A. 1989. Cell wall of Candida albicans, its functions and its impact on the host. Curr. Top. Med. Mycol. 3:249-314. Cassone, A., P. Marconi, F. Bistoni, E. Mattia, G. Sbaraglia, E. Garaci, and E. Bonmassar. 1981. Immunoadjuvant effect of Candida albicans and its cell wall fractions in a mouse lymphoma model. Cancer Immunol. Immunother. 10:181-189. Cenci, E., L. Romani, A. Vecchiarelli, P. Puccetti, and F. Bistoni. 1990. T cell subsets and IFN--y production in resistance to systemic candidosis in immunized mice. J. Immunol. 144:43334339. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159. Del Prete, G. F., M. De Carli, C. Mastromauro, R. Biagiotti, D. Macchia, P. Falagini, M. Ricci, and S. Romagnani. 1991. Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigens of Toxocara canis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profile of cytokine production. J. Clin. Invest. 88:346350. Djeu, J. Y., and D. K. Blanchard. 1987. Regulation of human polymorphonuclear neutrophil (PMN) activity against Candida albicans by large granular lymphocytes via release of PMNactivating factor. J. Immunol. 139:2761-2767. Djeu, J. Y., D. K. Blanchard, A. L. Richards, and H. Freidman. 1988. Tumor necrosis factor induction by Candida albicans from human natural killer cells and lymphocytes. J. Immunol. 142:4047-4052. Domer, J., K. Elkins, D. Ennist, and P. Baker. 1988. Modulation of immune responses by surface polysaccharides of Candida albicans. Rev. Infect. Dis. 10:419-423. Domer, J. E., and S. A. Moser. 1978. Experimental murine candidiasis: cell-mediated immunity after cutaneous challenge. Infect. Immun. 20:88-98. Ehlers, S., and K. A. Smith. 1991. Differentiation of T cell lymphokine gene expression: the in vitro acquisition of T cell memory. J. Exp. Med. 173:25-36. Garner, R. E., U. Kuruganti, L. A. Al-Hussaini, C. W. Czarniecki, and J. E. Domer. 1992. Effect of in vivo administration of recombinant murine gamma interferon on in vitro lymphoproliferative responses following immunization with Candida albicans. Infect. Immun. 60:1927-1935. Gauchat, R. E., D. Gauchat, A. L. De Weck, and B. M. Stadler. 1989. Cytokine mRNA levels in antigen-stimulated peripheral blood mononuclear cells. Eur. J. Immunol. 19:1079-1085. Gessani, S., F. Belardelli, A. Pecorelli, P. Puddu, and C. Baglioni. 1989. Bacterial lipopolisaccharide and gamma interferon induce transcription of beta interferon mRNA and interferon secretion in murine macrophages. J. Virol. 63:2785-2789. Gessani, S., P. McCandless, and C. Baglioni. 1988. The glucocorticoid dexamethasone inhibits synthesis of interferon by decreasing the level of its mRNA. J. Biol. Chem. 283:7454-7458.
VOL. 61, 1993
CANDIDAL MANNOPROTEINS AND CYTOKINES
25. Ho, J. L., S. H. He, M. J. C. Rios, and E. A. Wick. 1992. Interleukin-4 inhibits human macrophage activation by tumor necrosis factor, granulocyte-monocyte colony-stimulating factor, and interleukin-3 for antileishmanial activity and oxidative burst capacity. J. Infect. Dis. 165:344-351. 26. Klein, R. S., C. A. Harris, C. Butukus Small, B. Moll, M. Lesser, and G. H. Friedland. 1984. Oral candidiasis in high risk patients as the initial manifestation of the acquired immunodeficiency syndrome. N. Engl. J. Med. 311:354-357. 27. Maggi, E., P. Parronchi, R. Manetti, C. Simonelli, M. P. Piccinni, F. Santini Rigin, M. De Carli, M. Ricci, and S. Romagnani. 1992. Reciprocal regulatory effects of IFN-y and IL-4 on the in vitro development of human Thl and Th2 clones. J. Immunol. 148:2142-2147. 28. Marconi, P., A. Cassone, M. Baccarini, L. Tissi, E. Garaci, E. Bonmassar, L. Frati, and F. Bistoni. 1983. Relationship between tumor load, route of inoculation and response to immunotherapy in murine lymphoma model. J. Natl. Cancer Inst. 71:299305. 29. May, L. T., C. D. Helfgott, and P. B. Segal. 1986. Anti-,8interferon antibodies inhibit the increased expression of HLA-B7 mRNA in tumor necrosis factor-treated human fibroblasts: structural studies of the 02 interferon involved. Proc. Natl. Acad. Sci. USA 83:8957-8961. 30. Morrison, C. J., E. Brummer, R. A. Isenberg, and D. A. Stevens. 1987. Activation of murine polymorphonuclear neutrophils for fungicidal activity by recombinant -y-interferon. J. Leukocyte Biol. 41:434-440. 31. Murphy, J. W. 1990. Immunity to fungi. Curr. Opin. Immunol. 2:360-367. 32. Odds, F. C. 1988. Candida and Candidosis, p. 124-152. Bailliere Tindall, London. 33. Palma, C., A. Cassone, D. Serbousek, C. A. Pearson, and J. Y. Djeu. 1992. Lactoferrin release and interleukin-1, interleukin-6, and tumor necrosis factor production by human polymorphonuclear cells stimulated by various lipopolysaccharides: relationship to growth inhibition of Candida albicans. Infect. Immun. 60:4604-4611. 34. Palma, C., D. Serbousek, A. Torosantucci, A. Cassone, and J. Y. Djeu. 1992. Identification of a mannoprotein fraction from Candida albicans enhancing human PMNL functions and involvement of lactoferrin in PMNL inhibition of Candida growth. J. Infect. Dis. 166:1103-1112. 35. Peppel, K., J. M. Vinci, and C. Baglioni. 1991. The AU-rich sequences in the 3' untranslated region mediated t.e increased turnover of interferon mRNA induced by glucocorticoids. J. Exp. Med. 173:349-355. 36. Podzorski, R. P., G. R. Gray, and R. D. Nelson. 1990. Different effects of native Candida albicans mannan and mannan-derived oligosaccharides on antigen-stimulated lymphoproliferation in vitro. J. Immunol. 144:707-712.
37. Quinti, I., C. Palma, E. C. Guerra, M. J. Gomez, I. Mezzaroma, F. Aiuti, and A. Cassone. 1991. Proliferative and cytotoxic responses to mannoproteins of Candida albicans by peripheral blood lymphocytes of HIV-infected subjects. Clin. Exp. Immunol. 85:485-492. 38. Romagnani, S. 1992. Induction of Thl and Th2 responses: a key role for the natural immune response? Immunol. Today 13:379381. 38a.Romani, L., et al. Unpublished data. 39. Romani, L., A. Mencacci, U. Grohmann, S. Mocci, P. Mosci, P. Puccetti, and F. Bistoni. 1992. Neutralizing antibody to interleukin-4 induces systemic protection and T helper type 1-associated immunity in murine candidiasis. J. Exp. Med. 176:19-25. 40. Romani, L., S. Mocci, C. Bietta, L. Lafaloni, P. Puccetti, and F. Bistoni. 1991. Thl and Th2 cytokine secretion patterns in murine candidiasis: association of Thl responses with acquired resistance. Infect. Immun. 59:4647-4654. 41. Sanceau, J., J. Wijdenes, M. Revel, and J. Witzerbin. 1991. IL-6 and IL-6 receptor modulation by IFN--y and tumor necrosis factor-a in human monocytic cell line (THP-1). Priming effect of IFN-y. J. Immunol. 147:2630-2637. 42. Scaringi, L., P. Marconi, M. Boccanera, L. Tissi, F. Bistoni, and A. Cassone. 1988. Cell wall components of Candida albicans as immunomodulator: induction of natural killer and macrophagemediated peritoneal cell cytotoxicity in mice by mannoprotein and glucan fractions. J. Gen. Microbiol. 134:1265-1274. 43. Scaringi, L., E. Rosati, P. Cornacchione, R. Rossi, and P. Marconi. 1992. In vivo modulation of lymphokine activated killer cell activity by cell wall components of Candida albicans. Cell. Immunol. 139:438-454. 44. Shirai, T., H. Ito, C. W. Todd, and B. Wallace. 1985. Cloning and expression in Escherichia coli of the gene for human tumour necrosis factor. Nature (London) 313:803-806. 45. Street, N. E., and T. R. Mosmann. 1991. Functional diversity of T lymphocytes due to secretion of different cytokine patterns. FASEB J. 5:171-177. 46. Torosantucci, A., C. Bromuro, M. J. Gomez, C. M. Ausiello, F. Urbani, and A. Cassone. 1993. Identification of a 65-kDa mannoprotein as a main target of human cell-mediated immune response to Candida albicans. J. Infect. Dis. 168:427-435. 47. Torosantucci, A., C. Palma, M. Boccanera, C. M. Ausiello, G. C. Spagnoli, and A. Cassone. 1990. Lymphoproliferation and cytotoxic responses of human peripheral blood mononuclear cells to mannoprotein constituents of Candida albicans. J. Gen. Microbiol. 136:2155-2163. 48. Vieira, P., R. de Waal-Malefty, M. N. Dang, K. E. Johnson, R. Kastelein, D. F. Fiorentino, J. E. de Vries, M. G. Roncarlo, T. R. Mosmann, and K. W. Moore. 1991. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein-Barr virus open reading frame BCRF1. Proc. Natl. Acad. Sci. USA 88:1172-1176.
4111
