Original Article
Functional and Molecular Characterization of NOS Isoforms in Rat Neutrophil Precursor Cells Sachin Kumar,1 Anupam Jyoti,1 Ravi Shankar Keshari,1 Manish Singh,2 Manoj Kumar Barthwal,1 Madhu Dikshit1*
1
Cardiovascular Pharmacology Unit, Central Drug Research Institute, Lucknow, Uttar Pradesh, India
2
Electron Microscopy Unit, Central Drug Research Institute, Lucknow, Uttar Pradesh, India
Received 2 October 2009; Revision Received 9 November 2009; Accepted 8 December 2009 Grant sponsors: Department of Biotechnology (New Delhi, India) (M. D.), Council of Scientific and Industrial Research (New Delhi, India) (S. K.). *Correspondence to: Madhu Dikshit, Cardiovascular Unit, Pharmacology Division, Central Drug Research Institute, Lucknow-226 001, India Email:
[email protected] Published online 26 January 2010 in Wiley InterScience (www.interscience. wiley.com)
Abstract Previous studies from this laboratory have demonstrated importance of neutrophilderived nitric oxide (NO) in free radical generation, characterized nitric oxide synthase (NOS) isoforms, and have reported subcellular distribution of NOS in rat peripheral neutrophils. Maximum number of neutrophils are added per day to the circulation from bone marrow, thus neutrophils might add substantial amount of NO in the bone marrow. NO generating ability and NOS isoforms characteristics in bone marrow neutrophil precursor cells is, however, still unexplored. This study was, therefore, undertaken to investigate NO generation ability and the molecular/biochemical characteristics of NOS isoforms in neutrophil precursor cells. The neutrophil precursors were separated on Percoll density gradient and characterized by Giemsa staining, CD markers, and by their size and granularity at various stages of maturation as Bands 1, 2, and 3. Mature neutrophils were efficient in free radical generation and phagocytosis, whereas immature cells had more mitochondria and myeloperoxidase. Amount of NO augmented from immature to mature neutrophils as assessed by fluorescent probe DAF-2DA and Griess reagent. Measurement of NOS enzyme activity further confirmed the functional status of NOS in these cells. NOS isoforms were differentially expressed during neutrophil maturation as confirmed by enzyme activity, Western blotting, flowcytometry, and RT-PCR. Expression of nNOS was predominantly stable in all the stages of neutrophil maturation. iNOS expression was, however, consistently augmented during maturation, whereas eNOS expression was downregulated with neutrophil maturation. Furthermore, all NOS isoforms proteins were distributed in cytosol as well as nucleus as assessed by confocal microscopy. This study for the first time report biochemical and molecular characteristics of NOS isoforms in rat neutrophil precursor cells. ' 2010 International Society for Advancement of Cytometry
DOI: 10.1002/cyto.a.20852 © 2010 International Society for Advancement of Cytometry
Key terms nitric oxide; NOS; neutrophils; neutrophil precursor cells; maturation
NEUTROPHILS (PMNs) are orchestrating cells of the innate immune system (1,2), circulating through the body and extravasating to the sites of infection and injury, to perform important roles in the host defense. This process involves recruitment of lysosomes and various types of granules to release proteolytic enzymes, antimicrobial peptides, and free radical formation (1,2). PMN development in the bone marrow has classically been divided into six stages myeloblasts (MBs), promyelocytes (PMs), myelocytes (MCs), metamyelocytes (MMs), band cells (BCs), and segmented neutrophil on the basis of cell size, nuclear morphology, and granule content (3,4). Production of these cells is continuous to provide the continual demand for the tissues and mostly to maintain the circulating pool in the blood. Nitric oxide (NO), a versatile signaling molecule, mediates immune response, vasodilation, neurotransmission, proliferation, and apoptosis (5–8). NO is synthesized by a class of NADPH-dependent NO synthases (NOSs) by catalyzing the conversion of L-Arginine to L-Citrulline and NO (5,9). NOS exists in three isoforms, Cytometry Part A 77A: 467477, 2010
ORIGINAL ARTICLE neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS). Constitutive NOS (cNOS) including eNOS and nNOS are calcium dependent and produce low level of NO; however, iNOS produce large amount of NO for prolonged period of time, is induced by inflammatory cytokines, and is calcium independent (10). Ability of neutrophils to synthesize NO was first discovered by its ability to relax aortic rings (11) and by the inhibition of platelet aggregation (12,13), which was abolished by NOS inhibitors. Nitrite (NO22) content (14,15) correlate with NO production in rat and human PMNs. Neutrophils generate NO at a rate of 10– 100 nmoles/5 min/106 cells, comparable to the endothelial cells, thus contributing much to the amount of NO in circulation (16). Malawista et al. (17) reported first that NO generation by neutrophils is involved in their antimicrobial function. Interestingly, NO was later identified to modulate diverse signaling cascades in neutrophil to regulate various functions such as adhesion, chemotaxis, phagocytosis, respiratory burst, apoptosis, and PMN-mediated bacterial killing or tissue damage (18). Previous studies from this laboratory have also demonstrated NO-mediated modulation of neutrophil free radical generation (19–22). Reports depicting the characteristics of NOS isoforms present in neutrophils are limited as compared to investigations in other cells/cell lines. However, presence of both nNOS and iNOS has been accepted unequivocally (23–25), whereas occurrence of eNOS in human neutrophils (26), is still being advocated. Rodents are commonly exploited for the various NO-mediated investigations. However, Interspecies differences in terms of NOS expression and enzymatic NO production have been reported (15,27,28). Specifically, rat neutrophils constitutively express nNOS and generate higher levels of NO; whereas human neutrophils express low level of enzyme at mRNA and protein level. The previous reports from this laboratory have shown the presence of nNOS and iNOS and their subcellular localization but failed to detect eNOS in peripheral rat PMNs (29,30). Studies in iNOS2/2 mice demonstrated recently that circulating neutrophils maintain physiological blood pressure (31), as neutrophil depletion led to reduction in blood pressure, suggesting their requirement in maintaining the optimal vascular tone. Michurina et al. (32) demonstrated that exposure of irradiated mice to systemic NOS inhibition increased the number of stem cells in the bone marrow followed by a transient increase in the number of neutrophils in the peripheral blood by an unidentified mechanism. Endogenous NO causes vasodilation in rat bone marrow, bone, and spleen during accelerated hematopoiesis (33). Bone marrow stromalcell-derived eNOS seems to be essential for the mobilization of stem and progenitor cells (34). While, iNOS induction in human bone marrow and CD341 cells was seen after stimulation with IFNc or TNF-a, which were suggested to be the negative regulator of haematopoiesis (35). Moreover, a strong correlation was established between nNOS expression in bone marrow cells and their ability to support hematopoietic stem cells (HSCs) (36). NO donors regulated HSC number even when treatment occurred before the initiation of circulation 468
and rescued HSCs, whereas nNOS/eNOS knockdown blocked HSC development (37). Thus, NO also seems to be a key regulator of hematopoiesis in bone marrow, but NO derived from bone marrow neutrophils and status of NOS isoforms during neutrophil maturation is not yet explored. This study has been thus undertaken to explore NOS isoforms in rat neutrophils precursor cells.
MATERIALS AND METHODS Bovine serum albumin (BSA), 5,6-diaminofluorescein diacetate (DAF-DA:10 lM), 20 ,70 -dichlorofluorescein diacetate (DCFDA-10 lM), dihydroehidium (DHE-10 lM), nicotinamide adenine dinucleotide phosphate reduced (NADPH), NxNitro-L-arginine methyl ester (L-NAME, 2 mM), paraformaldehyde (PFA-4%), Percoll, phenyl methyl sulfonyl fluoride (PMSF-100 lg/ml), phorbol 12-myristate 13-acetate (PMA-50 nM), propidium iodide (PI-5 lg/ml), 5,6,7,8-tetrahydrobiopterin (BH4-1 mM), and Tween 20 were obtained from Sigma Aldrich Co. (MO). Healthy SD rats (150–180 g) used in this study were kept under hygienic conditions. Isolation of PMNs from Blood Rat blood (19) was collected under ether anaesthesia by cardiac puncture in sodium citrate (0.129 M, pH 6.5, 9:1 v/v). Blood was centrifuged at 2,000 rpm for 20 min at 208C and the buffy coat was subjected to dextran sedimentation (1% w/ v) for 30 min at 378C. Upper leukocyte rich layer was transferred to a fresh tube and centrifuged at 2,000g for 20 min at 208C (3K30 Sigma Centrifuge, Germany). Pellet was suspended in 2 ml Hank’s balanced salt solution (HBSS) [Composition (mM): NaCl 138; KCl 2.7; Na2HPO4 8.1; KH2PO4 1.5; Glucose 10; pH 7.2–7.4] and loaded on the top of the 2 ml Histopaque density gradient (1119 and 1083) and centrifuged at 700g for 30 min at 208C. PMNs rich layer was recovered from the interface of Histopaque 1119 and 1083 and contaminating RBCs were removed by hypotonic lysis. The cells were washed and suspended in HBSS. PMNs were counted in Neuber’s chamber and the viability of the cells was determined by Trypan blue dye exclusion. Purity of isolated PMNs was checked by immunolabeling using anti-rat CD 11b-FITC, anti-rat CD 45-PE monoclonal antibodies and analysis by flow cytometer (FACS Calibur, Becton Dickinson) using appropriate compensation. Isolation of Neutrophil Precursor Cells from Rat Bone Marrow Neutrophil precursors from bone marrow were isolated according to method described by Cowland and Borregaard (38) with minor modification using Percoll gradient (1.065, 1.080, and 1.086). Briefly, bone marrow was flush out with PBS containing sodium citrate. Following sedimentation of debris (5–10 min), the clear supernatant containing leukocytes was removed and the cells were recovered by centrifugation (200g for 10 min at room temperature). The pellet was resuspended in PBS (48C), which was added slowly onto the Percoll density gradients and centrifuged at 1,000g for 20 min at 48C. After centrifugation, bone marrow cells were separated into NOS in Neutrophil Precursors
ORIGINAL ARTICLE three bands having MBs/PMs, MCs/MMs, and BCs/segmented neutrophils (SCs) in Bands 3, 2, and 1, respectively. Nitrite Estimation Nitrite content in the rat neutrophils and precursors was measured by the Griess reagent. Cells were sonicated on ice and centrifuged at 2,000g for 20 min at 48C; the supernatant thus obtained was treated with cadmium chloride to reduce nitrate to nitrite to measure total nitrite. Samples were treated with Griess reagent and incubated for 30 min at 378C. Concentration of nitrite was estimated by measuring the absorbance at 548 nm using sodium nitrite as standard (21).
NO Generation by Flow Cytometry Flow cytometry offers an effective tool in studying real time generation of NO in live cells. Rat neutrophils and precursors (2 3 106 cells/ml) were incubated with DAF-2DA (10 lM) for 5 min. DAF-2DA reacts rapidly and irreversibly with NO to produce a highly reactive fluorescent product triazolo fluorescein (DAF-2T). Fluorescence of 10,000 cells was acquired by gating the neutrophil population and was analyzed by Cell Quest program to determine the mean fluorescence using FACS Calibur, Becton Dickinson (39).
Nitric Oxide Synthase Activity NO production was assessed by the formation of L-[3H] citrulline from L-[3H] Arginine. Rat neutrophils and precursor cells (1 3 107 cells) were sonicated in incubation buffer (Hepes 25 mM; NaCl 140 mM; KCl 5.4 mM; MgCl2 1 mM; pH 7.4) and then incubated in presence of cofactors BH4 (10 lM), NADPH (1 mM), FAD (5 lM), FMN (25 lM), and calmodulin (10 lg/ml) in presence or absence of CaCl2 (2 mM) and EGTA (5 mM) as indicated. Reaction was initiated by the addition of L-[3H] arginine and was continued for 30 min at 378C. Reaction was stopped by addition of ice-cold stop buffer [NaCl, 118 mM; KCl, 4.7 mM; KH2PO4, 1.18 mM; NaHCO3, 1 mM; EDTA, 4 mM; Nx-Nitro-L-arginine methyl ester (L-NAME), 2 mM; pH 5.5]. The mixture was passed through Dowex 50WX (T-400) columns. Radioactivity in the eluent was measured using beta scintillation counter (LKB Wallace 1409, Liquid Scintillation counter) as described by Saini et al. (29). NO synthesis in the neutrophil lysate has been reported as pmol of L-[3H] citrulline formed/30 min/107 cells.
Free Radical Generation Rat PMNs/BMCs (2 3 106 cells/ml) were incubated with vehicle or various inhibitors for 10 min at 378C and subsequently loaded with 20 ,70 -dichlorodihydro-fluorescein diacetate (DCF-DA, 10 lM) or dihydroethidine (DHE, 10 lM) for 5 min, and finally, phorbol 12-myristate 13-acetate (PMA, 50 nM) was added to the suspension. Each sample was monitored for free radical generation by acquiring 10,000 cells, which were subsequently analyzed by Cell Quest program (FACS Calibur, Becton Dickinson, USA) (39). Cytometry Part A 77A: 467477, 2010
Myeloperoxidase Activity MPO activity was evaluated following the method of Graff et al. (40). Neutrophils were freeze–thawed consecutively for three times and then sonicated in three cycles of 10 s each at 95 W (W-385 Heat System, Ultrisonics). Hexadecyl-trimethyl ammonium bromide was incubated to the cell lysate at 378C for 30 min and centrifuged at 3,000g for 20 min at 208C. Supernatant was taken for evaluation of enzymatic activity. Enzyme kinetics was run for 3 min at 15 s intervals using odianisidine (200 lM) and H2O2 (150 lM) at 378C. Optical density was recorded at 463 nm and was converted to units of concentration by using molar extinction coefficient for oxidized o-dianisidine e 5 10,062 [M 3 cm]21. Activity of MPO has been expressed as lM/min/107 cells. Phagocytic Activity Phagocytosis was measured in neutrophils using flow cytometry as previously described by Bazzoni et al. (41). Escherichia coli were heat inactivated at 608C for 30 min and labeled with FITC (50 lg/ml) in the dark at room temperature for 1 h. Labeled bacteria were washed twice in PBS. Neutrophils were incubated in presence of bacteria at 1:50 as mentioned for 30 min and analyzed immediately by flow cytometry. To differentiate between phagocytosed and adherent bacteria, Trypan blue (20 ll of a stock solution of 2 mg/ml for 5min) was added to the suspension to quench the fluorescence of the adherent bacterial population and reanalyzed on flow cytometer (FACS Calibur, Becton Dickinson, USA). NO Level in Different Stages of Cell Cycle Bone marrow neutrophil precursor cells/neutrophils were fixed, permeabilized after incubation with fluorescence detector DAF-2DA. After washing, 7-aminoactinomycin D (7AAD) was added to stain DNA for 30 min. Finally, 10,000 events were analyzed on flow cytometer for NO content versus cell cycle stages in the various band cells. Western Blotting A total of 5 3 106 cells were suspended in protein extraction buffer [0.1 M NaCl, 0.01 M Tris HCl pH 7.4, 0.001 M EDTA pH 7.4, 1 lg/ml aprotinin, 100 lg/ml phenylmethylsulfonyl fluoride (PMSF), Pepstatin 20 lg/ml, Sodium orthovenadate (Na3VO4) 2 mM, DFP 1 mM] for 30 min on ice (29). Centrifuged at 13,000 rpm, 20 min, 48C, Protein concentrations were measured by BCA protein assay reagent kit (Pierce). Samples containing equal amounts of protein in Laemmli buffer were separated by 8–12% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Amersham). Nonspecific binding was blocked overnight with TBST [Tris 25 mM, NaCl 150 mM, tween 20 (0.1%)] containing 5% (w/v) BSA at 48C. Membranes were incubated with nNOS (1:1000), iNOS (1:1000), and eNOS (1:1000) (BD Biosciences) in TBST (0.1% v/v) with 5% BSA for 3 h at RT. After five washes with TBST, the membranes were probed with HRP-labeled secondary antibody (1:10,000, with TBST with 5% BSA) for 2 h at RT. Membranes were washed 10 times with TBST. Proteins were 469
ORIGINAL ARTICLE
Figure 1. Diagrammatic representation of rat bone marrow cells isolated by Percoll density gradient and their characterization. (A) Neutrophil precursors were isolated after centrifugation at 1,000g for 30 min, further characterized by using Flow cytometer (FSC/SSC) and Geimsa staining. Immature promyelocyte (Band 3) exhibited less granularity and were larger in size, whereas mature neutrophils were smaller in size with higher granularity. Neutrophil nucleus with maturation exhibited multilobulated shape and increase in acidic cytoplasm. (Pictures were taken by using 320 objective lens and are representative of 10 independent experiments; bar 10 lm), Mitotracker red was used to assess the mitochondrial presence in neutrophil precursors isolated from bone marrow. Images were captured by fluorescence microscope using 340 objective lens; bar 10 lm. (B) Representing the functional maturation of neutrophil precursor cells PMA (50 nM) stimulated free radical generation showed maximum stimulation in mature cells (left panel) (Data presented as DCF fluorescence). DHE response after stimulation with PMA in middle panel, 106 cells were preincubated with DCF-DA/DHE (10 lM) for 5 min then stimulated with PMA for 30 min at 378C. 10,000 cells were acquired in each experiment. Free radical, O22 generation is presented as DCF or DHE mean stimulation index (MSI). ** P \ 0.001 in comparison to the controls (n 5 3). Phagocytic activity was measured by incubating the cells with FITC-labeled bacteria (E.coli) in 1 PMN: 50 bacteria ratio (right panel). Fluorescence of phagocytic FITC-labeled bacteria was measure by using Flow cytometer. Flourescence due to the adhered bacteria was quenched by using Trypan blue. Data are representative of minimum three individual experiments.
detected using ECL detection kit and visualized on HyperfilmTM (Amersham Biosciences, UK). Immunoprecipitation PMNs (5 3 107 ml21) were lyzed in radio immunoprecipitation assay buffer [PBS containing 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, and protease inhibitors (as in protein extraction buffer)] for 15 min. The supernatant was precleared with protein A/G agarose (Amersham biosciences, Upsala, Sweden) and incubated with 1 lg primary antibodies 470
(nNOS, iNOS, and eNOS); after 2 h, 20 ll protein A/G agarose was added and incubated for 1 h. The beads were washed, resuspended in gel loading buffer, denatured at 958C for 5 min, and subsequently analyzed by Western blotting. RT-PCR Analysis Total RNA from neutrophils and its precursors was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized from RNA (5 lg) by using first strand cDNA synthesis kit (Fermentas, Canada) as per manufacturer’s NOS in Neutrophil Precursors
ORIGINAL ARTICLE
Figure 2. Bar diagrams representing MPO activity, nitrite content, NO level, and NOS activity during neutrophil maturation. (A) MPO activity was assessed by using o-dianisidine and H2O2 as substrate and its activity is represented as lM/107cells/min (* P \ 0.01and **P \ 0.001 in comparison to the Band 3). (B) Total nitrite was calculated in 1 3 107 cells by Griess reagent to assess the NO22 and NO32 content after reduction of nitrate to nitrite by cadmium. (Data are presented as Mean value SEM of minimum five experiments; *P \ 0.01and **P \ 0.001 in comparison to the Band 3). (C) 106 cells were incubated with DAF-2DA (10 lM) a probe for NO for 30 min. Then 10,000 cells were acquired by using flow cytometry. Cells were incubated with BH4 (1 mM) for 30 min, which led to the augmentation of NO level. (Data have been presented as Mean stimulation index SEM of three experiments; *P \ 0.01 in comparison to the Band 3 and #P \ 0.01 in comparison to BH41 Band 3). (D) NOS activity was measured in 107 cells by using 3H labeled-L-arginine to 3H-L-citruline conversion, Calcium independent (iNOS) and dependent NOS activity (Constitutive NOS) were estimated in the presence of 5 mM EDTA and 2 mM CaCl2, respectively, and its activity is represented as pmol/107cells/30min.(Data have been presented as Mean SEM of minimum three experiments; #P \ 0.01 in comparison to the cNOS of respective bands and *P \ 0.001 in comparison to the Band 3 iNOS).
protocol. To explore different isoforms of NOS in neutrophils and precursor cells, gene specific primers were procured from Sigma (USA) as previously reported by Saini et al. (29). The primers used for nNOS (50 AACGATCGGCCCTTGGTAGAC30 ; 50 GGGCGGAGCTTTGTGCGATTTG-30 ) amplified a 96base pair (bp) fragment, iNOS (50 GGACCACCTCTATCA GGAA-30 ; 50 CCTCATGATAACGTTTCTGGC-30 ) amplified a 314-bp fragment, eNOS (50 TGCTGCCCGAGATATCTTC AGT-30 ; 50 GGCTGCCTTTTTCCAGTTGTTC-30 ) amplified a 356-bp fragment and b-actin (50 ATCGTGGGGCCGCCCCT AGGC30 ; 50 TGGCCTTAGGGTTCAGAGG30 ) amplified a 244bp fragment. The amplification reactions for 30 cycles were denaturation, 948C, 30 s; annealing, 49, 60, 65, and 468C, 1 min for nNOS, iNOS, eNOS and b-Actin, respectively; and extension, 728C, 1 min. The PCR products were analyzed by electrophoresis on a 1.0% agarose gel and visualized with ethidium bromide staining. The electrophoresis PCR products Cytometry Part A 77A: 467477, 2010
were analyzed on gel document system (Amersham Biosciences, Sweden). Confocal Microscopy To explore the intracellular distribution of NOS isoforms in neutrophils and precursors, cells were fixed in 4% (w/v) paraformaldehyde in PBS (pH 7.4) at 258C for 30 min and washed twice for 5 min each with PBS containing 0.5% (w/v) glycine. The washed cells were allowed to adhere on 0.01% (w/ v) poly-L-lysine coated cover slips, permeabilized with 0.2% (v/v) Triton X-100 (5–10 min), and blocked with 10% (v/v) goat serum in PBS for 30 min. Cells were incubated overnight at 48C with monoclonal antibodies against iNOS/nNOS/eNOS at a dilution of 1:200 and subsequently stained with alexa flour 488 secondary antibodies (1:500), at 48C for 4 h in dark. Nuclei were stained with propidium iodide (PI, 5 lg/ml) at 258C for 15 min. Cover slips were mounted in the mounting 471
ORIGINAL ARTICLE
RESULTS BMC Isolation and Characterization The Purity of MBs/PMs (Band 3), MCs/MMs (Band 2) and BCs/SCs (Band 1) were ascertained by Giemsa staining, CD 11b labeling, and by their FSC/SSC characteristics using flow cytometry (Fig. 1A), which demonstrated remarkable differences in these populations from larger promyelocyte cells to smaller neutrophils with high granularity and basic cytoplasmic promyelocyte to acidic mature cells. Moreover, immature (Band 3) cells exhibited maximum mitotracker fluorescence exhibiting presence of mitochondria (Fig. 1A, right panel), which decreased with the neutrophil maturation (Band 1). The CD 11b1 cells in Band 3 (12% 4% cells) increased consistently to 54% 8% cells (P \ 0.001) in Band 2 and 92% 6% cells (P \ 0.001) in Band 1 (mature neutrophils).
Figure 3. Photograph presenting the presence of NOS isoforms after IP/Western blotting and RT-PCR in rat neutrophil precursors and peripheral PMNs. (A) Immunoprecipitation was used to assess iNOS, eNOS, and nNOS proteins in bone marrow cells by using 200 lg protein from each stage. Lysates were immunoprecipitated by 1 lg NOS isoform antibodies and then same antibodies were used to probe for Western blotting. Lactoferrin, was used to distinguish Band 3 as it is found only in specific granules. (Values below bands indicate the fold change in comparison to Band 3 expression; Figures are representative of 3 experiments). (B) mRNA expression of the NOS isoforms in neutrophil precursors by RT-PCR. c-DNA was prepared using Retroscript cDNA synthesis kit after total RNA isolation. RT-PCR was performed for all the stages using specific primer for NOS isoforms. Products were resolved on 1% agarose gel and pictures were acquired by using Gel doc system (Figures are representation of 3 experiments).
medium (Oncogene, CA) and images were acquired under Carl Zeiss LSM 510 META Confocal Microscope using 63 3 1.4 NA Plan Apochromate lens. Adobe Photoshop 71 Software was used for further analysis and presentation of images. Control samples were processed similarly as mentioned earlier, omitting the primary antibodies (29).
Statistical Analysis Data are represented as Mean SEM, of at least 3–5 independent experiments, and were analyzed by one way ANOVA test followed by Newman-Keuls post analysis. Student’s t-test analysis was also used in comparing the Control versus treated as specified in legends. Data were considered significant at P \ 0.05. 472
Functional Studies PMA stimulated free radical generation from different neutrophil precursor cells as measured with DCDHF-DA fluorescent dye was maximal in mature cells (Fig. 1B), whereas superoxide specific fluorescent dye dihydro ethidium (DHE) indicated PMA induced O22 radicals generation in these cells. Superoxide generation was significantly augmented in Band 2 and Band 1, whereas absent in immature Band 3 cells (Fig. 1B). Thus, NOX components which appear in specific granules at Band 2 stage and mature cells. Mature neutrophils (Band 1) also showed maximum phagocytic activity in contrast to immature cells as measured by FITC labeled bacteria (E.coli) (Fig. 1B). Myeloperoxidase Activity, Nitrite Level, NO Level, and NOS Activity Myeloperoxidase (MPO) is packed in azurophil granules and is synthesized at the promyelocytic stage of neutrophil maturation, i.e., Band 3. The activity of MPO was reduced from immature Band 3 cells to mature neutrophils (Fig. 2A). Stable metabolites of NO, metabolite nitrite (NO2 2 ) and nitrate 7 (NO2 ) in Band 3 cells (0.22 0.06 lM/10 cells) was less than 3 peripheral PMNs (0.92 0.06 lM, P \ 0.001) (Fig. 2B). NO florescent probe DAF-2DA (10 lM) was also used to detect the NO production in these cells, which was more in the mature cells as compared to immature neutrophils (Fig. 2C). Addition of NOS cofactor, BH4 significantly augmented NO release from immature and mature neutrophils (Fig. 2C). NOS enzyme activity was measured by using 3H-L-Arginine and its conversion to 3H-L-Citrulline, which was maximal in the mature cells. Calcium independent NOS (iNOS) activity was more in Band 1 as compared to Bands 3 and 2 cells (Fig. 2D). Calcium dependent NOS activity was, however, less than calcium independent NOS activity in all the cells and was almost comparable at all the stages (Fig. 2D). Nitric Oxide Synthases Expression Presence of NOS isoforms was investigated in the PMNs and its precursor cells after immuno precipitation, as we could not detect NOS protein in these cells by Western blotting. Level of nNOS expression in PMNs and precursors was steady NOS in Neutrophil Precursors
ORIGINAL ARTICLE
Figure 4. Histogram overlays representing the nNOS (A) eNOS (B) expression in neutrophil precursors. Cells were labeled with NOS antibodies (1:100) overnight at 48C after fixation and permeabilization and fluorescence were taken by using FACS Calibur of Alexa Flour 488 (Secondary antibody) in FL1 channel. Only secondary antibody was used to ensure specific labeling (Figures are representative of three experiments). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]
except in immature Band 3, whereas iNOS protein increased with maturation (Fig. 3A). Furthermore, eNOS protein was higher in immature Band 2 and Band 3 and was downregulated in the mature PMNs (Fig. 3A). mRNA expression of iNOS, nNOS, and eNOS were analyzed by RT-PCR. All the three NOS isoforms were expressed in neutrophil precursor cells. nNOS was almost equally expressed at all the stages in bone marrow cells (Fig. 3B), whereas iNOS expression was augmented with maturation. Furthermore, eNOS was most expressed in Band 2 (MCs/MMs) stage (Fig. 3B).
ImmunoLabelling of Cells Immunolabeling of NOS isoforms in bone marrow cells confirmed the presence of these proteins during neutrophils maturation. As at each stage, cells were found to have distinct autofluorescence or secondary antibody labeling, respective controls for the overlay were, therefore, used for each stage to analyze the data. Expression of eNOS was maximum in Band 2 stage (Fig. 4B), which was subsequently downregulated with maturation. nNOS expression in rat neutrophil precursor cells was studied with the help of antibody labeling after fixation and permeabilization. nNOS labeling was higher in comparison to eNOS, whereas nNOS MSI indicate similar expression in all the stages of neutrophil maturation (Fig. 4A). Moreover, NOS isoforms expression and localization in rat neutrophils and precursors was explored with confocal microscopy after antibody staining. Secondary antibody in separate slide (defined as negative control) was used to ensure the specific labeling, and Z stack were used to have the picture of each plain at condition where no labeling was observed in the negative controls. nNOS labeling was highest among all the NOS isoforms in bone marrow and peripheral neutrophils Cytometry Part A 77A: 467477, 2010
(Fig. 5A). Expression of eNOS was more in bone marrow cells, which was further downregulated in the peripheral neutrophils (Fig. 5C), whereas iNOS expression was induced with maturation in peripheral PMNs (Fig. 5B). Nitric Oxide Level and Cell Cycle Stages During neutrophil maturation, neutrophil precursors undergo cell division and differentiation. Hence, cell cycle status of different bands was studied, the immature (band 3) cells were mitotically active and had highest number of cells in S phase in comparison to other mature cells (Figs. 6A and 6B). Mature cells (Band 1) were mostly in G0/G1 phase of the cell cycle. NO level in the cells in different cell cycle stages was also explored. Cells were analyzed for the cell cycle stage by 7AAD labeling after treatment with DAF for 30 min. DAF fluorescence was maximal in G2/M phase of cell cycle (Fig. 6C).
DISCUSSION NO regulates several important functions of neutrophils, including chemotaxis, adhesion, apoptosis, and PMNmediated bacterial killing or tissue damage. The presence of nNOS and iNOS in rat peripheral PMNs has been well documented (15,27,29,30,42,43). As neutrophils precursors constitute the major fraction of bone marrow niche, NO produced from these cells might act as a paracrine effector to regulate hematopoiesis in the bone marrow. This study explored the expression and functional status of NOS isoforms during neutrophils maturation and results obtained suggest presence of all the NOS isoforms in these cells and confirm their NO generating abilities. Neutrophil precursor cells, following separation on Percoll density gradient, were characterized by CD11b and Geimsa staining (Fig. 1), which demonstrated [90% enrich473
ORIGINAL ARTICLE
Figure 5. Pictures representing localization of nNOS (A) iNOS (B) eNOS (C) in rat neutrophil precursors cells as presented (a) PMNs (b) Band 1 (c) Band 2 (d) Band 3 (e) Secondary antibody (f) DIC image. NOS immuno labeling were done after permeabilization of cells with 0.05% Tween 20 in PBS containing 3% BSA (blocking Buffer) and labeling with anti-rabbit Alexa flour 488 secondary antibody against nNOS antibody and nuclear staining with propidium iodide. (Images were captured by using 363 objective lens; bar 10 lm).
ment of cells in each sample, which were used for NOS characterization. Flowcytometry experiments were performed after gating, to obtain the data from highly pure population, sorting of cells by using stage specific CD markers could not be performed due to the nonavailability of these markers for rats. Measurement of free radical generation, phagocytic activity, and mitochondrial content, were therefore used to confirm the purity and enrichment of the isolated cells (38). NO content in the neutrophil precursor cells was investigated by DAF-2DA, a fluorescent probe for NO (44). NO generation in neutrophil precursors was evaluated by flow cytometry (29,42,45). NO levels further increased in the presence of NOS cofactor, BH4 (5,9), suggesting presence of functional NOS (Fig. 2C). As DAF also reacts with dihydroascorbate (DHA) (46), as well as N2O3 (44), a NO metabolite formed by the reaction of 2 NO with nitrite. Total nitrite content (NO2 2 1NO3 ) in rat 474
neutrophil precursor cells was, therefore, measured to confirm NO status, which also exhibited similar trend of increase from immature Band 3 to mature neutrophils (Fig. 2B). NOS enzymatic activity measurement with 3H-L-Arginine (14,15,29) also exhibited same trend. Calcium independent NOS (iNOS) activity (15,29) was increased from Band 3 to neutrophils, whereas calcium dependent NOS activity remained comparable at all the stages. NOS isoforms at protein and transcript level were also evaluated to identify the isoforms being expressed during neutrophil maturation. Lactoferrin was used to assess the purity and to distinguish Band 3 as this protein appears in specific granules (3). nNOS expression was stable during maturation, iNOS consistently increased with maturation (Figs. 3A and 3B), whereas eNOS was down regulated that could be the reason that most of the researchers failed to find eNOS in neutrophils (14,15,27,29,30,42). Amin et al. (28) reported that iNOS NOS in Neutrophil Precursors
ORIGINAL ARTICLE
Figure 6. Figure representing the cell cycle status of bone marrow cells and DAF fluorescence in different cell cycle stages. (A) Cell cycle distribution in neutrophil precursors as assessed by propidium iodide (PI) staining and analyzed by Modfit software (B) Bar diagram representing the distribution of cells in different cell cycle phases (C) Bar diagrams representing the NO level in different cell cycle stages as assessed by 7-AAD and DAF-2DA staining; minimum 5,000 cells were acquired of each phase in each band cells. Data are presented as % of cells and DAF fluorescence SEM*, **P \ 0.01, \ 0.001 in comparison to the G1 phase of Band 3 cells (n 5 3).
was below the detectable level in neutrophils by Western blotting analysis. However, sensitive methods such as RT-PCR has shown expression of iNOS mRNA from neutrophils and indicated that very low levels of NOS protein expressed in neutrophils, which was induced after cell culture (15). Immunocytochemistry by flow cytometry and confocal microscopy (25,29) further confirmed these results (Figs. 4 and 5). nNOS is well-documented NOS isoform in neutrophils (27,29,30,47); we found similar level of expression during neutrophils maturation, suggesting continued and constitutive presence of nNOS during neutrophil maturation (Fig. 3). Moreover, nNOS labeling was highest among all the NOS isoforms in bone marrow and peripheral neutrophils (Fig. 5A). Level of nNOS expression in PMNs and precursors supports the reported observation of Wallerath et al. (47), who demonstrated nNOS expression in human bone marrow neutrophil but failed to report eNOS/iNOS. Recent study suggest that nNOS regulate hematopoiesis in vitro and in vivo (36); moreover, stromal cell lines widely used to maintain HSCs in culture expressed high level of nNOS. In yet another study, nNOS activity and its mRNA were found to be increased during neuronal cell differentiation and in human neuroblastoma cell line following trans-retinoic acid (RA)-induced neuronal differentiation (48). Cytometry Part A 77A: 467477, 2010
Moreover, eNOS protein appeared in immature Band 2 cells (MCs/MMs) and was subsequently downregulated in the mature PMNs (Fig. 3), Immunolabeling of eNOS confirmed its low expression. Mature neutrophils expressed very less eNOS that could be the reason that most of the researchers failed to detect eNOS in neutrophils (27,29,30,42). eNOS was dynamically expressed in endothelial progenitor cells and was down regulated in differentiated cells (49). eNOS-mRNA and protein levels as well as the bioactivity was decreased during erythroid differentiation, and human RBCs also contain some eNOS activity (50). iNOS protein was most commonly studied in the peripheral PMNs (15,25,28,29), which increased consistently with maturation in human PMNs (Fig. 5B). iNOS protein in PMNs was reported after cytokine treatment (51) and bacterial infection (52), whereas constitutive expression of iNOS was also reported (25). This data also suggests constitutive expression of iNOS, which was augmented with neutrophil maturation. As different granules are synthesized during maturation (38), it might be postulated that iNOS is synthesized continuously and packed in azurophilic, specific as well as in gelatinase granules (53). iNOS produces large amount of NO, it could be therefore important armor to intruders during phagocytosis. It justifies the need of continuous NO synthesis and further 475
ORIGINAL ARTICLE stimulation of iNOS after cytokine treatment in peripheral neutrophils. LPS-induced, amount of exhaled NO, due to enhanced iNOS expression and airway neutrophilia (54). Michurina et al. (32) have shown NO as a modulator of haematopoietic activity. Stromal cell-derived factor-1 (SDF1)/ CXCR4 plays a key role in neutrophils and myeloid cells mobilization from bone marrow (55). NO has been reported to upregulate SDF1 and CXCR4 in the ischemic brain to promote neuroblast cell migration after stroke (56). Although eNOS mediated stem cell migration to the ischemic myocardium via upregulation of SDF-1 has also been demonstrated (34,57). GCSF, a key regulator of neutrophil homeostasis, triggers bonemarrow neutrophils to release matrix metalloproteinase-9 (MMP9), to mobilize progenitor cells (58,59). G-CSF production from stromal cells is regulated by interleukin-17 (IL-17) released from a subset of T cells. IL-17 regulates granulopoiesis through IL-17/IL-23 pathway by ingestion of apoptotic neutrophils (60). Treatment of endothelial cells with IL-17 has been shown to induced iNOS expression and NO production (61), suggesting that NO might be modulating the granulopoietic signal from apoptotic neutrophils. A putative regulatory role for NO might be related to the microenvironment of HSCs (62). NO may be crucial for maintaining the quiescence of HSCs in the bone marrow niche through its antioxidant and antiproliferative effect. There are several other possible links between NO and hematopoiesis, including its potential to regulate proteolysis and to affect mobilization of HSCs (34). Endogenous NO produced from neutrophil precursor cells in bone marrow need to be further examined in the homing and release of cells from bone marrow. Taken together, this study demonstrates for the first time biochemical and molecular characterization of the NOS isoforms in rat neutrophil precursor cells. Particularly, nNOS expression was stable during maturation, iNOS consistently increased with maturation, whereas eNOS was more in the immature cells and was substantially reduced in the mature cells. As stromal cell derived NO has been shown to regulate hematopoiesis (32), studies are, however, required to explore the importance of NO derived from neutrophil precursor cells in hematopoiesis, which are highest in bone marrow and have the capability to produce NO efficiently. This study provides molecular characteristics of NOS isoforms in rat neutrophils starting from its origin in bone marrow to the mature peripheral PMNs.
ACKNOWLEDGMENTS We are highly thankful to Dr. V. K. Bajpai (Head EM unit) for his critical help for microscopy experiments. We acknowledge the excellent technical assistance of Mr. Vishwakarma for the flow cytometric studies. We also acknowledge help of Mr. C.P. Pandey during this study.
LITERATURE CITED 1. Nathan C. Neutrophils and immunity: Challenges and opportunities. Nat Rev Immunol 2006;6:173–182. 2. Segal AW. How neutrophils kill microbes. Annu Rev Immunol 2005;23:197–223. 3. Borregaard N, Cowland JB. Granules of the human neutrophilic polymorphonuclear leukocyte. Blood 1997;89:3503–3521.
476
4. Bainton DF, Ullyot JL, Farquhar MG. The development of neutrophilic polymorphonuclear leukocytes in human bone marrow. J Exp Med 1971;134:907–934. 5. Bredt DS, Snyder SH. Nitric oxide: A physiologic messenger molecule. Annu Rev Biochem 1994;63:175–195. 6. Stamler JS. Redox signaling: Nitrosylation and related target interactions of nitric oxide. Cell 1994;78:931–936. 7. Li CQ, Wogan GN. Nitric oxide as a modulator of apoptosis. Cancer Lett 2005;226:1–15. 8. Villalobo A. Nitric oxide and cell proliferation. Febs J 2006;273:2329–2344. 9. Moncada S, Palmer RM, Higgs EA. Biosynthesis of nitric oxide from L-arginine. A pathway for the regulation of cell function and communication. Biochem Pharmacol 1989;38:1709–1715. 10. Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases: Structure, function and inhibition. Biochem J 2001;357(Part 3):593–615. 11. Rimele TJ, Sturm RJ, Adams LM, Henry DE, Heaslip RJ, Weichman BM, Grimes D. Interaction of neutrophils with vascular smooth muscle: Identification of a neutrophil-derived relaxing factor. J Pharmacol Exp Ther 1988;245:102–111. 12. Dikshit M, Kumari R, Srimal RC. Pulmonary thromboembolism-induced alterations in nitric oxide release from rat circulating neutrophils. J Pharmacol Exp Ther 1993;265:1369–1373. 13. Faint RW, Mackie IJ, Machin SJ. Platelet aggregation is inhibited by a nitric oxide-like factor released from human neutrophils in vitro. Br J Haematol 1991;77:539–545. 14. Rodenas J, Mitjavila MT, Carbonell T. Simultaneous generation of nitric oxide and superoxide by inflammatory cells in rats. Free Radic Biol Med 1995;18:869–875. 15. Miles AM, Owens MW, Milligan S, Johnson GG, Fields JZ, Ing TS, Kottapalli V, Keshavarzian A, Grisham MB. Nitric oxide synthase in circulating vs. extravasated polymorphonuclear leukocytes. J Leukoc Biol 1995;58:616–622. 16. Wright CD, Mulsch A, Busse R, Osswald H. Generation of nitric oxide by human neutrophils. Biochem Biophys Res Commun 1989;160:813–819. 17. Malawista SE, Montgomery RR, van Blaricom G. Evidence for reactive nitrogen intermediates in killing of staphylococci by human neutrophil cytoplasts. A new microbicidal pathway for polymorphonuclear leukocytes. J Clin Invest 1992;90:631–636. 18. Sethi S, Dikshit M. Modulation of polymorphonuclear leukocytes function by nitric oxide. Thromb Res 2000;100:223–247. 19. Sethi S, Singh MP, Dikshit M. Nitric oxide-mediated augmentation of polymorphonuclear free radical generation after hypoxia-reoxygenation. Blood 1999;93:333–340. 20. Sethi S, Sharma P, Dikshit M. Nitric oxide- and oxygen-derived free radical generation from control and lipopolysaccharide-treated rat polymorphonuclear leukocyte. Nitric Oxide 2001;5:482–493. 21. Seth P, Kumari R, Dikshit M, Srimal RC. Modulation of rat peripheral polymorphonuclear leukocyte response by nitric oxide and arginine. Blood 1994;84:2741–2748. 22. Patel S, Vemula J, Konikkat S, Barthwal MK, Dikshit M. Ion channel modulators mediated alteration in NO-induced free radical generation and neutrophil membrane potential. Free Radic Res 2009;43:514–521. 23. Gatto EM, Riobo NA, Carreras MC, Chernavsky A, Rubio A, Satz ML, Poderoso JJ. Overexpression of neutrophil neuronal nitric oxide synthase in Parkinson’s disease. Nitric Oxide 2000;4:534–539. 24. Greenberg SS, Xie J, Zhao X, Jie O, Giles TD. An in vivo cytokine and endotoxin-independent pathway for induction of nitric oxide synthase II mRNA, enzyme, and nitrate/ nitrite in alveolar macrophages. Biochem Biophys Res Commun 1996;227:160–167. 25. Cedergren J, Follin P, Forslund T, Lindmark M, Sundqvist T, Skogh T. Inducible nitric oxide synthase (NOS II) is constitutive in human neutrophils. APMIS 2003;111:963– 968. 26. Frutos d, Sanchez de Miguel L, Farre J, Gomez J, Romero J, Marcos-Alberca P, Nunez A, Rico L, Lopez-Farre A. Expression of an endothelial-type nitric oxide synthase isoform in human neutrophils: Modification by tumor necrosis factor-alpha and during acute myocardial infarction. J Am Coll Cardiol 2001;37:800–807. 27. Greenberg SS, Ouyang J, Zhao X, Giles TD. Human and rat neutrophils constitutively express neural nitric oxide synthase mRNA. Nitric Oxide 1998;2:203–212. 28. Amin AR, Attur M, Vyas P, Leszczynska-Piziak J, Levartovsky D, Rediske J, Clancy RM, Vora KA, Abramson SB. Expression of nitric oxide synthase in human peripheral blood mononuclear cells and neutrophils. J Inflamm 1995;47:190–205. 29. Saini R, Patel S, Saluja R, Sahasrabuddhe AA, Singh MP, Habib S, Bajpai VK, Dikshit M. Nitric oxide synthase localization in the rat neutrophils: Immunocytochemical, molecular, and biochemical studies. J Leukoc Biol 2006;79:519–528. 30. Chatterjee M, Saluja R, Kumar V, Jyoti A, Kumar Jain G, Kumar Barthwal M, Dikshit M. Ascorbate sustains neutrophil NOS expression, catalysis, and oxidative burst. Free Radic Biol Med 2008;45:1084–1093. 31. Morton J, Coles B, Wright K, Gallimore A, Morrow JD, Terry ES, Anning PB, Morgan BP, Dioszeghy V, Kuhn H, Chaitidis P, Hobbs AJ, Jones SA, O’Donnell VB. Circulating neutrophils maintain physiological blood pressure by suppressing bacteria and IFNgamma-dependent iNOS expression in the vasculature of healthy mice. Blood 2008;111:5187–5194. 32. Michurina T, Krasnov P, Balazs A, Nakaya N, Vasilieva T, Kuzin B, Khrushchov N, Mulligan RC, Enikolopov G. Nitric oxide is a regulator of hematopoietic stem cell activity. Mol Ther 2004;10:241–248. 33. Iversen PO, Nicolaysen G, Benestad HB. Endogenous nitric oxide causes vasodilation in rat bone marrow, bone, and spleen during accelerated hematopoiesis. Exp Hematol 1994;22:1297–1302. 34. Aicher A, Heeschen C, Mildner-Rihm C, Urbich C, Ihling C, Technau-Ihling K, Zeiher AM, Dimmeler S. Essential role of endothelial nitric oxide synthase for mobilization of stem and progenitor cells. Nat Med 2003;9:1370–1376. 35. Maciejewski JP, Selleri C, Sato T, Cho HJ, Keefer LK, Nathan CF, Young NS. Nitric oxide suppression of human hematopoiesis in vitro. Contribution to inhibitory action
NOS in Neutrophil Precursors
ORIGINAL ARTICLE
36.
37.
38. 39.
40.
41.
42.
43.
44.
45.
46.
47.
48. 49.
of interferon-gamma and tumor necrosis factor-alpha. J Clin Invest 1995;96:1085– 1092. Krasnov P, Michurina T, Packer MA, Stasiv Y, Nakaya N, Moore KA, Drazan KE, Enikolopov G. Neuronal nitric oxide synthase contributes to the regulation of hematopoiesis. Mol Med 2008;14:141–149. North TE, Goessling W, Peeters M, Li P, Ceol C, Lord AM, Weber GJ, Harris J, Cutting CC, Huang P, Dzierzak E, Zon LI. Hematopoietic stem cell development is dependent on blood flow. Cell 2009;137:736–748. Cowland JB, Borregaard N. Isolation of neutrophil precursors from bone marrow for biochemical and transcriptional analysis. J Immunol Methods 1999;232:191–200. Sharma P, Barthwal MK, Dikshit M. NO synthesis and its regulation in the arachidonic-acid-stimulated rat polymorphonuclear leukocytes. Nitric Oxide 2002;7:119– 126. Graff G, Gamache DA, Brady MT, Spellman JM, Yanni JM. Improved myeloperoxidase assay for quantitation of neutrophil influx in a rat model of endotoxin-induced uveitis. J Pharmacol Toxicol Methods 1998;39:169–178. Bazzoni F, Cassatella MA, Laudanna C, Rossi F. Phagocytosis of opsonized yeast induces tumor necrosis factor-alpha mRNA accumulation and protein release by human polymorphonuclear leukocytes. J Leukoc Biol 1991;50:223–228. Chatterjee M, Saluja R, Kanneganti S, Chinta S, Dikshit M. Biochemical and molecular evaluation of neutrophil NOS in spontaneously hypertensive rats. Cell Mol Biol (Noisy-le-grand) 2007;53:84–93. Carreras MC, Poderoso JJ, Cadenas E, Boveris A. Measurement of nitric oxide and hydrogen peroxide production from human neutrophils. Methods Enzymol 1996;269:65–75. Kojima H, Nakatsubo N, Kikuchi K, Kawahara S, Kirino Y, Nagoshi H, Hirata Y, Nagano T. Detection and imaging of nitric oxide with novel fluorescent indicators: Diaminofluoresceins. Anal Chem 1998;70:2446–2453. Sharma P, Raghavan SA, Dikshit M. Role of ascorbate in the regulation of nitric oxide generation by polymorphonuclear leukocytes. Biochem Biophys Res Commun 2003;309:12–17. Zhang X, Kim WS, Hatcher N, Potgieter K, Moroz LL, Gillette R, Sweedler JV. Interfering with nitric oxide measurements. 4,5-diaminofluorescein reacts with dehydroascorbic acid and ascorbic acid. J Biol Chem 2002;277:48472–48478. Wallerath T, Gath I, Aulitzky WE, Pollock JS, Kleinert H, Forstermann U. Identification of the NO synthase isoforms expressed in human neutrophil granulocytes, megakaryocytes and platelets. Thromb Haemost 1997;77:163–167. Ogura T, Nakayama K, Fujisawa H, Esumi H. Neuronal nitric oxide synthase expression in neuronal cell differentiation. Neurosci Lett 1996;204:89–92. Liu Z, Jiang Y, Hao H, Gupta K, Xu J, Chu L, McFalls E, Zweier J, Verfaillie C, Bache RJ. Endothelial nitric oxide synthase is dynamically expressed during bone marrow
Cytometry Part A 77A: 467477, 2010
50. 51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61. 62.
stem cell differentiation into endothelial cells. Am J Physiol Heart Circ Physiol 2007;293:H1760–H1765. Cokic VP, Schechter AN. Effects of nitric oxide on red blood cell development and phenotype. Curr Top Dev Biol 2008;82:169–215. Evans TJ, Buttery LD, Carpenter A, Springall DR, Polak JM, Cohen J. Cytokine-treated human neutrophils contain inducible nitric oxide synthase that produces nitration of ingested bacteria. Proc Natl Acad Sci USA 1996;93:9553–9558. Wheeler MA, Smith SD, Garcia-Cardena G, Nathan CF, Weiss RM, Sessa WC. Bacterial infection induces nitric oxide synthase in human neutrophils. J Clin Invest 1997;99:110–116. Le Cabec V, Cowland JB, Calafat J, Borregaard N. Targeting of proteins to granule subsets is determined by timing and not by sorting: The specific granule protein NGAL is localized to azurophil granules when expressed in HL-60 cells. Proc Natl Acad Sci USA 1996;93:6454–6457. McCluskie K, Birrell MA, Wong S, Belvisi MG. Nitric oxide as a noninvasive biomarker of lipopolysaccharide-induced airway inflammation: Possible role in lung neutrophilia. J Pharmacol Exp Ther 2004;311:625–633. Suratt BT, Petty JM, Young SK, Malcolm KC, Lieber JG, Nick JA, Gonzalo JA, Henson PM, Worthen GS. Role of the CXCR4/SDF-1 chemokine axis in circulating neutrophil homeostasis. Blood 2004;104:565–571. Cui X, Chen J, Zacharek A, Roberts C, Yang Y, Chopp M. Nitric oxide donor up-regulation of SDF1/CXCR4 and Ang1/Tie2 promotes neuroblast cell migration after stroke. J Neurosci Res 2009;87:86–95. Li N, Lu X, Zhao X, Xiang FL, Xenocostas A, Karmazyn M, Feng Q. Endothelial nitric oxide synthase promotes bone marrow stromal cell migration to the ischemic myocardium via upregulation of stromal cell-derived factor-1alpha. Stem Cells 2009;27:961–970. Petit I, Szyper-Kravitz M, Nagler A, Lahav M, Peled A, Habler L, Ponomaryov T, Taichman RS, Arenzana-Seisdedos F, Fujii N, Sandbank J, Zipori D, Lapidot T. GCSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4. Nat Immunol 2002;3:687–694. Basu S, Hodgson G, Katz M, Dunn AR. Evaluation of role of G-CSF in the production, survival, and release of neutrophils from bone marrow into circulation. Blood 2002;100:854–861. Stark MA, Huo Y, Burcin TL, Morris MA, Olson TS, Ley K. Phagocytosis of apoptotic neutrophils regulates granulopoiesis via IL-23 and IL-17. Immunity 2005;22:285– 294. Miljkovic D, Trajkovic V. Inducible nitric oxide synthase activation by interleukin-17. Cytokine Growth Factor Rev 2004;15:21–32. Suda T, Arai F, Hirao A. Hematopoietic stem cells and their niche. Trends Immunol 2005;26:426–433.
477
