Functional characterization of a plantâlike sucrose transporter from the ...

New Phytologist

Research

Functional characterization of a plant-like sucrose transporter from the beneficial fungus Trichoderma virens. Regulation of the symbiotic association with plants by sucrose metabolism inside the fungal cells Walter A. Vargas1,2, Frankie K. Crutcher1 and Charles M. Kenerley1 1

Department of Plant Pathology and Microbiology Texas A&M University, College Station, TX 77843, USA; 2Present address: Centro Hispanoluso de

Investigaciones Agra´rias (CIALE), Departamento de Microbiologia y Gene´tica, Universidad de Salamanca, 37185 Salamanca, Spain

Summary Author for correspondence: W.A. Vargas Tel: +34 923 294500 Email: [email protected] Received: 20 July 2010 Accepted: 17 September 2010

New Phytologist (2011) 189: 777–789 doi: 10.1111/j.1469-8137.2010.03517.x

Key words: fungi, sucrose uptake, sucroseH+ symporters, symbiotic association, Trichoderma virens.

• Sucrose exuded by plants into the rhizosphere is a crucial component for the symbiotic association between the beneficial fungus Trichoderma and plant roots. In this article we sought to identify and characterize the molecular basis of sucrose uptake into the fungal cells. • Several bioinformatics tools enabled us to identify a plant-like sucrose transporter in the genome of Trichoderma virens Gv29-8 (TvSut). Gene expression profiles in the fungal cells were analyzed by Northern blotting and quantitative real-time PCR (qRT-PCR). Biochemical and physiological studies were conducted on Gv29-8 and fungal strains impaired in the expression of TvSut. • TvSut exhibits biochemical properties similar to those described for sucrose symporters from plants. The null expression of tvsut caused a detrimental effect on fungal growth when sucrose was the sole source of carbon in the medium, and also affected the expression of genes involved in the symbiotic association. • Similar to plants, T. virens contains a highly specific sucrose ⁄ H+ symporter that is induced in the early stages of root colonization. Our results suggest an active sucrose transference from the plant to the fungal cells during the beneficial associations. In addition, our expression experiments suggest the existence of a sucrosedependent network in the fungal cells that regulates the symbiotic association.

Introduction In plants, sucrose (Suc) is produced as one of the final products of photosynthesis and is the main form of photoassimilates that are transported to heterotrophic tissues, such as roots (Dennis & Blakeley, 2000; Koch, 2004). Suc movement within the plant is facilitated by well-characterized Suc ⁄ H+ symporters (Suc transporters) that move Suc against a concentration gradient (Shakya & Sturm, 1998; Noiraud et al., 2000; Barth et al., 2003; Flementakis et al., 2003; Yao Li et al., 2003; Dimou et al., 2005; Kru¨gel et al., 2008). Expression experiments have demonstrated that Suc transporters are expressed in various tissues, including the outer cell layers of the root tips (Barth et al., 2003). As a result, expression of these transporters in the outermost root

2010 The Authors New Phytologist 2010 New Phytologist Trust

cells is a phenomenon that is probably controlled by plant cells to provide a resource for the development of heterotrophic organisms in the rhizosphere. Plant-produced nutrients that are secreted into the rhizosphere become part of an intricate chemical communication that initiates interactions between the host and colonizing nonpathogenic microorganisms (Bais et al., 2006). As part of such a dialogue, many molecules produced by both partners are active participants in metabolite trafficking that establishes and regulates the symbiotic associations (Bais et al., 2004, 2006; Pozo et al., 2005). During the interaction between plants and mycorrhizal fungi, carbohydrate metabolism within the root cells has been demonstrated to play an essential role in the establishment and maintenance of the symbiotic association (Blee & Anderson, 1998; Nehls et al.,

New Phytologist (2011) 189: 777–789 777 www.newphytologist.com

New Phytologist

778 Research

2001; Nehls, 2008). Plant-produced enzymes have been proposed to hydrolyze Suc, and the resulting monosaccharides are transported into the fungal cells (Blee & Anderson, 1998; Nehls et al., 2001). Importantly, the hexose concentration in the apoplast appears to control the fungal metabolism during the symbiosis, with the monosaccharides acting as nutrients and, at the same time, as signals that regulate gene expression in the fungal cell (Nehls et al., 2001; Schaarschmidt et al., 2007a,b; Nehls, 2008). Despite the importance of plant-produced monosaccharides for the association of mycorrhizal fungi with plant roots, novel evidence has shown that the beneficial rootcolonizing fungus Trichoderma virens is able to degrade Suc exuded by plants (Vargas et al., 2009). The disruption of Suc degradation in T. virens showed that Suc metabolism is involved in the control of fungal development, root colonization and proliferation in the rhizosphere. The capability of intracellular Suc degradation in T. virens suggests that in its natural environment, this fungus obtains Suc from the surrounding medium (either the soil or from the roots) for further metabolism (Vargas et al., 2009). Molecular and physiological studies revealed that intracellular Suc metabolism is an important element of T. virens physiology in the rhizosphere, and its ability to colonize maize roots. However, the molecular mechanisms leading to the transport of the disaccharide remained to be discovered. Initially our knowledge of Suc transport in fungal species was limited to the characterization of an a-glucoside transporter from Schizosaccharomyces pombe, similar to Suc transporters from plants, able to transport mainly maltose and, to a lesser extent, Suc and other disaccharides (Reinders & Ward, 2001). During the preparation of this manuscript, a high-affinity Suc carrier from Ustilago maydis (UmSrt, similar to mosaccharide transporters from plants) was described as a virulence factor (Wahl et al., 2010). In this report, we describe the identification and functional characterization of a plant-like Suc transporter from T. virens (TvSut) with high specificity toward Suc transport, and with biochemical and molecular properties similar to those described for plant Suc ⁄ H+ symporters. The presence of a functional Suc transporter in T. virens strongly suggests that this fungal species evolved a specific mechanism that enables the fungal cells to obtain and metabolize Suc from plant roots during the symbiotic association. Additionally, evidence for a regulatory network that depends on Suc metabolism and regulates several aspects of the symbiotic association is presented. Overall, this research expands our knowledge of Suc metabolism in T. virens and discloses novel regulatory aspects during symbiotic associations. In contrast to the role of UmSrt in the interaction between maize and U. maydis, our results demonstrate that a plant-like Suc transporter in T. virens is induced during the establishment of a beneficial interaction with plants.

New Phytologist (2011) 189: 777–789 www.newphytologist.com

Materials and Methods Fungal strains and plant culture Trichoderma virens Gv29-8 (wild-type) and T. virens Dtvinv2 (T. virens mutant strain impaired in the expression of tvinv; Vargas et al., 2009) were routinely maintained on potato dextrose agar (PDA) (Difco, Sparks, MD, USA), unless otherwise indicated. Seedlings of maize inbred line B73 used in this study were grown in a hydroponic system at room temperature (Djonovic´ et al., 2006) or in pots containing soil-less mix (Metromix 366, Sun Gro Horticulture, Bellevue, WA, USA), and grown in a growth chamber at 25C with a 14 h photoperiod and 60% humidity. Nucleic acid manipulation and gene expression experiments Genomic DNA from T. virens was obtained as previously described (Djonovic´ et al., 2006). Total RNA from fungal tissue was prepared using the TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) and DNAse-treated and cleaned using a DNA-free kit (Ambion, Austin, TX, USA). RNA quality was analyzed by electrophoresis on agarose gels. Southern and northern blots were performed using Hybond-N+ membranes (Amersham Biosciences) according to the manufacturer’s suggestions. For Northern blotting assays, the probes were PCR-amplified fragments from fungal DNA and radioactively labeled using [32P]dCTP. The amplified fragments corresponded to exons of each gene, and the correct amplification product was confirmed by sequencing. The primers used for the PCR reactions are listed in Table 1. For semiquantitative reverse transcription PCR (RTPCR), total RNA (2.5 lg) was reverse-transcribed with the First-Strand cDNA Synthesis Kit (GE Healthcare, Piscataway, NJ, USA) using random hexamer pd (N)6 as a primer. To define the optimal number of PCR cycles for linear amplification of each gene, a range of PCR amplifications was performed and the products were electrophoresed and stained with ethidium bromide. Quantitative real-time RT-PCR (qRT-PCR) experiments were performed using the QuantiTect SYBR green RTPCR kit (Qiagen). The reactions were conducted using a 20 ll reaction 1X QuantiTect SYBR Green Master Mix, 1X RT QuantiTect Mix, 200 nM primers (Table 1) and 500 ng total RNA. The reactions were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The absence of primer-dimers was confirmed in reactions without RNA. The primer sets Sm1F ⁄ Sm1R, SutF ⁄ SutR, InvF qRT/ InvR qRT and ActinF/ActinR were used to assay the expression of sm1, tvsut and tvinv, respectively. Actin was used as the reference control (primer set actinF ⁄ actinR). qRT-PCR


New Phytologist

Research

Table 1 Primers used in PCR reactions

Protoplast preparation and transformation

Primer

Sequence

SutF SutR ActinF ActinR Sut1UpF Sut1UpR

CCTCGCCAGCAACAACATTCTA GAATCTTGAACTGGGTGTTGC GTATCATGATCGGTATGGGTCAGA TAGAAGGTGTGGTGCCAGATCTT CCTACCTCTACTTACCGTGAATTG ATTGATGTGTTGACCTCCACAATGCATCGTAGTC GGCTGGTGGTA AACTGAGCACTTGCCACAACAGC TCTGGATATAAGATCGTTGGTGTCGCGATGCGG ACCAAGATGATGATG CCTACCTCTACTTACCGTGAATTGAGTA AACTGAGCACTTGCCACAACAGCAACCATA GTGGAGGTCAACACATCAAT GACACCAACGATCTTATATCCAGA TCCACACACCTTATTCTCGACGCA ACAAACGGTAGAACGCCAAAGCAC ATCGCCAGTATTTCGCTGGGATCT GCGGCAGTCGTTTGATGGATTTGA ACGCTGCTTCTGGCTTCAACATT CTTTAGAGACCGCAGTTCTTAACA

T. virens protoplasts were isolated after cell wall digestion and transformed using the linear fragments according to the method described by Baek & Kenerley (1998). Transformants were selected on PDA medium supplemented with hygromycin (100 lg ml)1) and 0.5 M mannitol (for osmotic stability of protoplasts). Disruption of the tvsut gene in transformants was confirmed by PCR and Southern blot analysis.

SutDwnR Sut1DwnF SutNestF SutNestR HygF HygR InvF RT InvR RT Sut1F qRT Sut1R qRT Sm1F Sm1R

experiments were independently repeated three times (with similar results) and each reaction was performed in triplicate using relative quantification analysis. The expression of each specific gene was normalized vs the control reference with the formula 2DDCT where DCT ¼ CT specific gene - CTGAPc gene; DDCT = DCT - arbitrary constant (the highest DCT) (PE Applied Biosystems Sequence Detector User Bulletin #2, Applied Biosystems, Foster City, CA, USA). Construction of tvsut allele replacement cassette by double-joint PCR A DNA fragment consisting of a hygromycin resistance gene (hygB) flanked by DNA regions from the 5¢ and 3¢ends of the tvsut gene was amplified by double-joint PCR (Kuwayama et al., 2002). The 5¢ (1022 bp) and the 3¢ (1104 bp) fragments of tvsut were amplified using the primer pairs SutUpF ⁄ SutUpR and SutDwnF ⁄ SutDwnR, respectively. A 1430 bp fragment containing the hygB gene, trpC promoter and terminator was amplified from the vector pCSN44 (Fungal Genomic Stock Center) with the primers HygF ⁄ HygR. The three purified fragments were mixed in a 1 : 3 : 1 molar ratio and joined by PCR (Kuwayama et al., 2002). The PCR product was used as a template for a final amplification step using the primer pair SutNestF ⁄ SutNestR, which are nested in the 5¢ and 3¢-fragments of tvsut, respectively. Primer sequences are presented in Table 1. The final PCR product expected was a 3556 bp DNA fragment with the hygB cassette fused to the 5¢ and 3¢-regions of tvsut. The two strands of all the DNA fragments generated during the double-joint PCR process were sequenced to assess fidelity.


Growth rate comparison Cultures of Gv29-8, Dtvsut1, Dtvsut2 and Dtvsut3 were compared for colony morphology and radial growth. Spore suspensions (107 spores ml)1) of each strain were prepared and 3 ll of that suspension were inoculated in the center of plates containing Vogel’s minimum medium (VM) or VM supplemented with 1.5% Suc (VMS). Plates were visually inspected for production of aerial hyphae, color, and morphology of the colony. The diameter of the colonies was recorded after 36 h of growth at 27C. Each treatment contained four replicates and each experiment was repeated three times. Sucrose uptake assays Many studies characterizing Suc transporters required the use of genetically engineered yeast strains or Xenopus oocytes as heterologous expression systems (Riesmeier et al., 1992; Boorer et al., 1996). However, the study of TvSut was performed using T. virens protoplasts, as this fungus lacks any extracellular Suc hydrolyzing enzyme (Vargas et al., 2009) that would interfere or negate these assays. Thus, for transport experiments, T. virens was incubated for 48 h in VMS. The fungal tissue was washed with cold distilled water before protoplast preparation. Isolated protoplasts were resuspended in 0.5 M mannitol in 20 mM sodium phosphate buffer, pH 5 (suspension solution). Transport assays were conducted in aliquots containing 1 mg of fungal protoplasts. Suc uptake was initialized by adding [14C]-Suc to a final concentration of 1 mM (7.4 kBq ml)1), and incubated at 27C. For all uptake experiments, cells were filtered on nitrocellulose filters (0.22 lm pore size) at different times after the addition of the radiolabeled substrate, and washed with an excess of cold suspension solution. Where indicated, 10 mM D-glucose was included in the assays. Incorporation was determined by scintillation counting. Root colonization assays Maize seeds were inoculated with chlamydospore preparations (Weaver & Kenerley, 2005) of either the wild-type or the mutant strains and grown in Metromix in growth


779

New Phytologist

780 Research

chambers at 25C. After 2 wk incubation, roots were washed, surface-disinfected with 1% NaClO, dried and ground in the presence of 100 mM phosphate buffer (pH 7), 20 mM MgCl2 and Silwet L-77 (root-grinding buffer). Serial dilutions of the ground roots were plated on Gliocladium virens selective medium (GVSM) (Park et al., 1992) and the number of colonies was determined after 3 d. Data were expressed as colony-forming units (CFU) g)1 fresh root. Bioinformatics and statistics Sequence comparisons were performed using deduced amino acid sequences for Suc transporters retrieved from the databases at the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/BLAST/). Sequence alignments and graphical representations of phylogenetic trees were performed with MEGA (version 4) software (Tamura et al., 2007). Transmembrane domains and topology predictions were calculated using the resources available at ExPASy proteomics tools (http://www.expasy.ch/tools/), or at the Protein Structure Prediction Server (PSIPRED, http://bioinf.cs.ucl.ac.uk/psipred/). Promoter and genomic sequence analyses were performed using the DiAlign and DiAlign TF from the Genomatix Software (http://www. genomatix.de). Statistical analysis was performed by one-way ANOVA followed by Tukey’s honestly significant difference (HSD) test using VassarStat: (http://faculty.vassar.edu/ lowry/VassarStats.html).

Results Identification of a putative Suc transporter in Trichoderma virens genome sequence In a previous report, we described the intracellular degradation of Suc by T. virens, which strongly suggested that the fungal cells are able to uptake this disaccharide (Vargas et al., 2009). BLAST searches of the T. virens genome led to the identification of TvSut, a genomic sequence encoding a hypothetical protein, with 53% similarity to SpSut1, the a-glucoside transporter from S. pombe (Supporting Information, Table S1, Fig. 1). TvSut also exhibited 50% similarity to the functionally characterized Citrus sinensis Suc transporter 1 (Table S1). In general, of the 99 sequences homologous to TvSut that were analyzed, 41 corresponded to plant Suc transporters, with 21 functionally characterized proteins (Table S1). The rest of the sequences corresponded to fungal putative transporters suggested as monosaccharide or Suc transporters (Table S2), including a second putative transporter from T. virens named TvSuC (Fig. S1). All the identified sequences displayed between 40 and 74% similarity to TvSut with E-values < 10)30. A phylogenetic reconstruction, using fungal Suc carriers and plant Suc transporters, suggested that the fungal sequences are


more related to the plant homologs belonging to the clade III described by Zhou et al. (2007) (Fig. 2a). Further phylogenetic analysis, using 22 fungal sequences, revealed that TvSut clustered in a different group of sequences than SpSut, suggesting an early diversification of Suc transporters in the fungal lineage (Fig. 2b). Also, all the Suc transporters analyzed displayed a poor sequence alignment with UmSrt protein (Wahl et al., 2010), and when the sequence was included in the phylogenetic analysis it did not group with any of the fungal or plant sequences studied, suggesting that plant-like Suc transporters and UmSrt are distantly related (not shown). The deduced amino acid sequence of TvSut displays molecular characteristics similar to those described for the three different families of Suc transporters from plants. The deduced amino acid sequence contains 683 residues, and topological analyses predicted 12 transmembrane domains with intracellular amino- and carboxyl-terminal domains (Fig. S2, Notes S1) [Correction added after online publication 10 December 2010: in the preceding text, the number of residues was corrected from 642 to 683]. In addition, three His residues (located in the predicted extracellular loops 2, 4 and 5) are also conserved in plant Suc transporters (Fig. S2, Notes S1). These His residues in TvSut may be involved in the transport activity as described for plant-derived Suc transporters (Lu & Bush, 1998). Even though TvSut was calculated to contain an extended central loop, characteristic of members of the SUC3 subfamily, its predicted isoelectric point (pI) and calculated apparent molecular weight were more similar to SUC12 from Vitis vinifera (Barth et al., 2003) (Table 2). Modeling and folding predictions suggested TvSut is structurally related to well-characterized transporters such as glycerol-3P transporter and lactose permease from Escherichia coli (Huang et al., 2003; Mirza et al., 2006). Expression of tvsut To better understand the relevance of TvSut for T. virens growth, mRNA levels were compared by Northern blotting under different cultural conditions. The mRNA levels were analyzed in samples prepared from fungal mycelia incubated in the presence of different carbon sources or collected from hydroponic systems containing maize seedlings. Northern blotting experiments demonstrated that tvsut was expressed in Suc-containing medium or in the presence of plants (Fig. 3a). A time-course experiment showed the presence of mRNA for tvsut within 24 h incubation of the fungal hyphae with Suc, increasing after 48 h culture (Fig. 3b). The expression pattern for tvsut was similar to that detected for the intracellular invertase from T. virens (Vargas et al., 2009). The expression of TvSuC was also evaluated in the same conditions, but no expression was detected in the presence of Suc or plant roots (Fig. S3a, data not shown). These observations indicated that the expression of tvsut and tvinv is coordinated at the transcriptional level and depends on


New Phytologist

Research

Fig. 1 Sequence comparison of a putative sucrose transporter of Trichoderma virens, TvSut, and an a-glucoside transporter, SpSut1, from Schizosaccharomyces pombe (Spombe). The sequences were aligned using the ‘BLAST two sequences’ at the National Center for Biotechnology Information website (http://blast.ncbi.nlm.nih.gov/ bl2seq/wblast2.cgi). Identical residues in both sequences are shaded black and conservative changes are dashed gray.

(a)

(b)

Fig. 2 Sequence comparison and phylogenetic reconstruction using plant sucrose (Suc) transporters (a) and fungal sequences homologous to TvSut (b). Neighbor-joining and maximum parsimony trees were constructed with MEGA 4.1, with a bootstrap trial of 1000. The consensus tree after neighbor-joining is presented; similar topologies were determined with both algorithms. Plant sequences were obtained from Zhou et al., (2007). Fungal sequences as presented in Supporting Information, Table S2: Anidulans, XP_659893; Aterreus, XP_001218032; Aoryzae, XP_001817063; Aniger, XP_001395017; Aclavatus, XP_001273956; Bfuckeliana, XP_001557374; Cimmitis, XP_001242155; Gzeae, XP_387066; Mgrisea, XP_369923; Ncrassa, XP_956769; Nfischeri, XP_001266016; Pnodorum, XP_001806562; Ptritici-repentis, XP_001931621; Ylipolytica, XP_502863; SpSut1 from Schizosaccharomyces pombe, NP_594387; Pcarinii, AAG38546; Panserina, XP_001907927; Ssclerotiorum, XP_001586461; Um_X757428, X_757428.

the presence of Suc in the medium. This coordination in gene expression was further supported by the presence of putative regulatory motifs conserved in the genomic regions located immediately upstream of the translation start site of tvsut and tvinv (Fig. 3c). The sequence AGATCCTC displays a similar structure to the a1bMRE4 element, a DNA motif identified in DNAase I protection assays used to ana-


lyze metal-responsive elements in Pleurotus ostreatus (Faraco et al., 2003). Moreover, that element includes the canonic GATC motif, which binds transcription factors belonging to the GATA family present in eukaryotes, including fungi (Lowry & Atchley, 2000; Newton et al., 2001; Reyes et al., 2004) that might be involved in the control of gene expression during root colonization.


781

New Phytologist

782 Research

Table 2 Comparison of TvSut with sucrose (Suc) transporters from different subfamilies of Arabidopsis thaliana, Vitis vinifera and SpSut1 from Schizosaccharomyces pombe A. thalianaa

MWapp N pI Km

V. viniferab

SUC1

SUC2

SUC3

SUC12

SUC27

SpSut1c

TvSut

54.86 513 9.25 0.5

54.53 512 9.55 0.77

63.97 594 5.81 1.9

65.25 608 6.5 0.88

53.97 505 10.23 8–10

61.74 553 6.18 36.3

73.8 683 5.95 1.5 ± 1

MWapp, calculated apparent molecular weight (kDa); N, number of amino acid residues; pI, predicted isoelectric point; Km, affinity constant Data set from Barth et al. (2003); Sauer & Stolz (1994); Meyer et al. (2000). bData set taken from Barth et al., 2003; Zhang et al., 2007. c Data set from Reinders & Ward (2001); Km for Suc uptake (mM). [Correction added after online publication 10 December 2010: in column 7 (TvSut), the values were corrected as follows: 69.08 was corrected to 73.8; 643 was corrected to 683 and 6.7 was corrected to 5.95]. a

To gain a better understanding of the regulation of Suc metabolism in T. virens cells during plant-root colonization, the expression of tvsut was analyzed at different time-points after inoculation. In a recent report, Chacoń et al. (2007) described that, 10 h after inoculation of tomato with T. harzanium, changes in fungal gene expression and hyphal morphology were observed. By 18 h, the fungus had colonized the root epidermis and cortex by growing in the intercellular spaces. In Fig. 4 we present the time-course gene expression of tvsut determined by qRT-PCR. Relative mRNA level for tvsut was determined in T. virens mycelium collected at 10, 24, 36 and 48 h post-inoculation in hydroponic systems containing maize plants. The expression profile revealed that, 10 h post-inoculation, tvsut was already induced, reaching the highest level between 36 and 48 h post-inoculation (Fig. 4). Similarly, the expression of tvinv was also detected after 10 h inoculation (data not shown). Combining all of our results suggests the presence of regulatory mechanisms that control the expression of tvsut and tvinv, at early stages of root colonization.

wild-type, a 1.9 kb fragment was expected in the null mutant, and both bands were expected in ectopic integration events (see scheme in Fig. 5a). All three mutants (Dtvsut1, Dtvsut2

(a)

(b)

(c)

tvsut encodes a functional Suc transporter in T. virens To determine whether tvsut encodes a functional Suc transporter, T. virens strains impaired in the expression of tvsut were generated. A disruption cassette was constructed by double-joint PCR strategy (Fig. 5a,b) (Kuwayama et al., 2002). The final PCR amplification product was transformed into protoplasts of T. virens Gv29-8 and transformants were selected for hygromycin resistance. Twenty-four independent transformants were evaluated for tvsut disruption by PCR; only three transformants, Dtvsut1, Dtvsut2 and Dtvsut3, did not amplify the wild-type allele from genomic DNA (not shown). To confirm the insertional mutagenesis of tvsut, the three candidates were further analyzed by Southern blotting. The blots were probed with a 0.8 kb DNA fragment PCR-amplified from T. virens genomic DNA (depicted in Fig. 5a). After DNA digestion with BamHI, a 1.2 kb hybridizing fragment was expected for the


Fig. 3 tvsut mRNA is accumulated in the presence of sucrose (Suc) or plant roots. (a) mRNA accumulation (Northern blotting) for tvsut was determined in T. virens tissue cultivated for 4 d in Vogel’s minimal medium (VM), or VM supplemented with 1.5% glycerol (VMY), glucose (VMG) or Suc (VMS). The expression was also determined in fungal tissue collected from hydroponic systems where T. virens was co-inoculated with maize plants (Maize) or cultivated only in Murashige-Skoog (MS) medium. The probe for tvsut was PCR-amplified using the SutF ⁄ SutR primers listed in Table 1. (b) Time-course of the tvsut induction in the presence of Suc determined by Northern blotting. T. virens spores were inoculated in VMY medium, incubated for 48 h, mycelia were transferred to fresh VMY or VMS, and then samples collected at 0, 24 and 48 h for analysis. The probe for tvsut was PCR-amplified using the SutF ⁄ SutR primers listed in Table 1. (c) Analysis and comparison of the promoter regions of tvsut and tvinv. The genomic regions upstream of the translation start site were compared for both genes. Black-shaded bases highlight conserved nucleotides.


New Phytologist

Research (a)

(b)

(c)

Fig. 4 Time-course of the induction of tvsut in hydroponic systems containing maize plants. Trichoderma virens spores were inoculated in Vogel’s minimal medium supplemented with 1.5% glycerol (VMY), and after 48 h incubation the mycelia were transferred to hydroponic systems containing maize seedlings. Fungal tissue was collected at the moment of inoculation and 10, 24, 36 or 48 h postinoculation. Total RNA samples were prepared and used to test tvsut expression using the quantitative real-time reversetranscription PCR technique. tvsut mRNA relative accumulation was normalized to the highest expression level determined at 48 h. Bars depict the average ± SD of three independent experiments.

and Dtvsut3) presented the expected hybridization pattern for the null allele with a single integration of the disruption cassette (Fig. 5c). In agreement, the accumulation of transcripts for tvsut was not detected by semiquantitative RT-PCR in any of the mutant strains (Fig. 6a). To determine how the null expression of tvsut affects Suc transport in the mutant strains, protoplasts from Gv29-8 and the three tvsut mutant strains were assayed for uptake of [14C]-Suc. Fig. 6(b) illustrates that the null expression of tvsut was detrimental to the incorporation of Suc into the protoplasts. During the characterization of Suc transporters from plants, it has been noticed that the presence of 1 mM glucose enhances the activity of Suc transporters. Glucose metabolism has been proposed as providing the energy required for transport and ⁄ or activating the plasma membrane H+-ATPase for the stimulation of Suc uptake (Gahrtz et al., 1994; Barth et al., 2003). In the case of T. virens, a similar scenario occurs, with Suc uptake being enhanced by the presence of glucose (Fig. 6b). These results demonstrate that tvsut encodes a functional Suc transporter activated by the metabolism of glucose in T. virens cells. Biochemical properties of Suc transport in T. virens To further study the ability of T. virens to transport Suc, the uptake of [14C]-Suc was assayed in the presence of various unlabeled compounds representing potential competitors for Suc transport, or in the presence of two inhibitors of plant Suc transporters (the un-coupler dinitrophenol (DNP) and the His residue modifier, diethylpyrocarbonate


Fig. 5 Disruption of tvsut. (a) Scheme of the gene-deletion strategy. The expected sizes in wild-type (1.2 kb) and mutant alleles (1.9 kb), after genomic DNA digestion with BamHI and hybridization with the probe as indicated (PCR-generated using primers SutF ⁄ SutR). (b) Amplification of the three primary products and the final construct after joint PCR.1 kb, 1 kb Plus Ladder (Invitrogen); tvsut up fragment; Hyg fragment; tvsut down fragment; joint, the fusion PCR product using the three primary products. (c) Southern analysis of Trichoderma virens wild-type (Gv29-8) strain and tvsut deletion transformants (Dtvsut1, Dtvsut2 and Dtvsut3). Autoradiograph of DNA gel blot hybridized with the [32P]-dCTP-labeled probe indicated in (a). Fifteen micrograms of genomic DNA were digested with BamHI and loaded per lane. The expected molecular sizes for native and deletion events are indicated on the left.

(DEPC)). Among the competitors, only unlabeled Suc demonstrated a significant effect on the uptake of [14C]-Suc (Fig. 7a). DNP significantly reduced the amount of Suc taken up by fungal protoplasts (Fig. 7b), suggesting that the transport mechanism in T. virens is an H+-energized process. Another characteristic of Suc ⁄ H+ symporters in plants is the presence of conserved His residues in the extracellular loops that are related to Suc-binding sites (Lu & Bush, 1998). The significant effect of DEPC on Suc uptake (Fig. 7b) suggests that, as in plants, His residues are also involved in the molecular mechanisms of TvSut for Suc transport. In addition, we found that Suc transport in T. virens is pH-dependent, with maximum uptake in protoplasts incubated at pH 5 (Fig. 7c), with an estimated Km of 1.5 ± 1 mM for Suc uptake (Table 2). These results demonstrate that TvSut displays a remarkable resemblance to the molecular mechanisms that govern Suc transport in plants (Table 2).


783

New Phytologist

784 Research (a)

(b)

Fig. 6 The functional expression of tvsut is required for the uptake of [14C]-sucrose (Suc). (a) The accumulation of mRNA from tvsut was assayed in the Trichoderma virens wild-type, Dtvsut1, Dtvsut2 and Dtvsut3. Fungal tissue was cultured for 48 h in Vogel’s minimal medium supplemented with 1.5% Suc (VMS) and used for total RNA extraction. Reverse transcription-PCR assays were performed using 2.5 lg total RNA and 25 cycles of PCR amplification (in the linear range for amplification). PCR products were resolved on 1% agarose gel and visualized after ethidium bromide staining. The amplification of actin was used as loading control for the amplification. (b)Transport rates for [14C]-Suc were determined for T. virens wild-type, Dtvsut1, Dtvsut2 and Dtvsut3 strains in the presence (solid line) or absence (dashed line) of 10 mM glucose. The initial concentration of [14C]-Suc was 1 mM in all experiments.

Suc metabolism in T. virens contributes to regulate several aspects important for the symbiotic association with plants Carbohydrate metabolism provides the energy and structural skeletons to support growth and development of organisms. We previously demonstrated the importance of Suc degradation in the growth and development of T. virens as well as its influence on the colonization of plant roots (Vargas et al., 2009). As with the mutants impaired in the degradation of Suc, the mutants impaired in Suc uptake grew similar to the wild type strain on Vogel’s minimum medium (Fig. 8a). However, they grew significantly slower, compared to the Gv29-8 strain, when cultured in the same medium supplemented with Suc as the sole carbon source (Fig. 8b). In contrast to the mutants impaired in the expression of tvinv (Vargas et al., 2009), there was no difference in root colonization of maize plants for the Dtvsut strains and WT (Fig. 8c). In our previous report, plant-derived Suc was proposed to be involved in the chemical interaction between T. virens and plant cells to control root colonization (Vargas et al., 2009). To further understand the regulation of gene expression in T. virens mediated by Suc, and possibly affecting Trichoderma–plant interactions, we compared the expression of tvinv, tvsut, and sm1 (Suc-responsive genes) in the wild-type, Dtvinv2 (Vargas et al., 2009) and Dtvsut1 strains incubated in the presence of Suc. Quantitative RT-PCR experiments revealed that the level of expression of tvinv is significantly reduced by the null expression of the trans-


porter (Table 3). However, the expression of tvsut was independent of the expression of tvinv (Table 3). Levels of expression of tvsut in the Dtvinv2 strain were similar to those of Gv29-8. Interestingly, the expression of sm1 (encoding a small protein secreted by T. virens that induces defense responses in plants), which is up-regulated in the presence of plants or Suc (Djonovic´ et al., 2006; Vargas et al., 2008), was significantly reduced in both mutant strains, with the lowest levels of expression detected in Dtvinv2 (Table 3).

Discussion Chemical communication and metabolite exchange play essential roles in the establishment and maintenance of symbiotic associations; in the rhizosphere, plants provide a rich environment that supports those associations and microbial communities (Bais et al., 2004, 2006; Pozo et al., 2005). Driven by the beneficial effects afforded by Trichoderma species to crops, comprehension of the molecular events that govern the association of these fungi with roots and the colonization of the rhizosphere has increased in the last decades (Harman et al., 2004). As part of the molecular events associated with the symbiotic interactions of T. virens and maize, an intracellular invertase (TvInv) is produced in the fungal cells for degradation of plant-derived Suc (Vargas et al., 2009). In this report, we demonstrate that Suc uptake into T. virens cells is mainly imported by TvSut, a specific Suc transporter with biochemical properties similar to plant-encoded Suc carriers (Lu & Bush, 1998; Shakya &


New Phytologist

Research

(a)

(b)

(a)

(c) (b)

Fig. 7 Characterization of sucrose (Suc) uptake by Trichoderma virens protoplasts. (a) Suc transport in the presence of potential competitors. The (nonradiolabeled) potential competitors were added in a 10-fold excess with respect to Suc (10 mM). The assays were performed in the presence of 10 mM D-glucose. The data represent the percentage of [14C]-Suc transported into the cells normalized to the control without the addition of any competitor (100%). Bars represent the average ± SD of three independent analyses. Bars with letters in common did not differ significantly according to Tukey’s honestly significant difference (HSD) test at a significant level of 5%. Mal, maltose; Tre, trehalose; Raf, rafinose; Mel, melezitose. (b) Effect of uncoupler dinitrophenol (DNP) and His inhibitor diethylpyrocarbonate (DEPC) on Suc transport. The inhibitors were used in a final concentration of 100 lM. The assays were performed in the presence of 10 mM D-glucose. The data represent the percentage of [14C]-Suc transported into the cells normalized to the control without the addition of any effector (100%). Bars represent the average ± SD of three independent analyses. Bars with letters in common did not differ significantly according to Tukey’s HSD test at a significant level of 5%. (c) Effect of pH on Suc uptake. Measurements were performed in the presence of 100 mM sodium phosphate buffer at pH 4.5, 5.0 and 5.5. The assays were performed in the presence of 10 mM Dglucose. The data represent the percentage of [14C]-Suc transported into the cells normalized to maximum activity detected (100%). Bars represent the average ± SD of three independent analyses. Bars with letters in common did not differ significantly according to Tukey’s HSD test at a significant level of 5%.

Sturm, 1998; Meyer et al., 2000; Noiraud et al., 2000; Weise et al., 2000; Weschke et al., 2000; Reinders et al., 2002; Barth et al., 2003; Ramsperger-Gleixner et al., 2004; Kru¨gel et al., 2008). The identification and functional characterization of TvSut complements the previous study on the ability of mycelia of T. virens to metabolize Suc (Vargas et al., 2009). The results presented in this study show that during its sym-


(c)

Fig. 8 Effect of disrupting tvsut on the growth of T. virens in the presence of Suc and root colonization. Wild type (Gv29-8), Dtvsut1, Dtvsut2, or Dtvsut3 strains were inoculated in the center of plates containing (a) VM (minimal) or (b) VMS (VM supplemented with 1.5% Suc) medium [correction added after online publication 10 December 2010: the text preceding the descriptor for panels (a) and (b) was updated from VMS medium to (a) VM (minimal) or (b) VMS (VM supplemented with 1.5% Suc) medium]. The plates were incubated at 27C, and the growth was compared after 36 h. For every strain, three plates were inoculated in each experiment. The bars depict the mean value ± SD of three independent experiments. Bars with letters in common did not differ significantly according to Turkey’s HSD test at a significant level of 5%. (c) Colonization of maize plants inbred lines B73 by wild-type (Gv29-8), Dtvsut1, Dtvsut2, and Dtvsut3 strains. The experiment was performed twice and CFUs were determined from roots of five different plants for each treatment [correction added after online publication 10 December 2010: the descriptor text for panel (c) which was previously not provided within the figure legend is now included.]. The bars depict the mean value ± SD determined in pictures taken in two independent experiments. Bars with letters in common did not differ significantly according to Turkey’s HSD test at a significant level of 5%.


785

New Phytologist

786 Research Table 3 Expressiona of tvinv, tvsut and sm1 in Gv29-8, Dtvinv and Dtvsut strains

Gv29-8 Dtvinv2b Dtvsut1

tvinv

tvsut

sm1

1 nd 0.08 ± 0.02

1 1 ± 0.3 nd

1 0.26 ± 0.08 0.4 ± 0.3

nd, not determined. a Data obtained by quantitative real-time reverse transcription PCR (qRT-PCR) experiments. The results represent the expression level relative to the wild-type strain, expressed as the mean value ± SD of three independent experiments. b Vargas et al. (2009).

biotic interaction, T. virens obtains Suc from the rhizosphere by a highly specific mechanism resembling the process that U. maydis and plants use for Suc mobilization (Wahl et al., 2010). However, TvSut is more closely related to both Suc transporters from plants and putative Suc symporters from other fungal species than to UmSrt (high-affinity Suc carrier from U. maydis) (Fig. 2, Table S3). When UmSrt was included in the phylogenetic studies, this Suc carrier did not group with any of the clades containing plant or fungal sequences (not shown). This suggests that, unlike TvSut, UmSrt1 might not belong to the well-known families of Suc transporters from plants. However, we also found two genomic regions in U. maydis encoding putative plant-like Suc transporter homologs of TvSut (Fig. 2, Table S2). An examination of the fungal sequences revealed that despite being closely related, TvSut and the functionally characterized SpSut grouped in different phylogenetic clades (Fig. 2). These observations suggest an early radiation of Suc transporters in the fungal lineage, and, in the case of T. virens, Suc-rich niches (i.e. the rhizosphere or within plant tissues) might have selected for a Suc-specific transporter with very similar properties to those of plants. The presence of putative transporters in many fungal strains, with a high degree of similarity to TvSut (Table S2), suggests that plant-like Suc transporters are probably present in other fungal species. However, their specificity, biochemical properties, and physiological role presumably will differ depending on the evolutionary history of each species and the natural environments they inhabit. In the case of the rhizosphere competent species T. virens, TvSut is related to the establishment of a beneficial association with plant roots, but in the case of a pathogenic fungus, Suc uptake is associated with virulence factors (Wahl et al., 2010). For the optimal use of resources, a coordinated regulation of the expression of genes involved in the metabolism of such resources is required. In mycorrhizal fungi, the up-regulation of fungal hexose-transporters and enhanced carbohydrate metabolism during root colonization has been demonstrated (Blee & Anderson, 1998; Hahn & Mendgen, 2001; Nehls et al., 2001; Nehls, 2008). In the fungal species Thermomyces lanuginosus, previous studies suggested a


simultaneous uptake of radiolabeled Suc and induction of invertase activity when the fungal cells were cultured in the presence of Suc (Chaudhuri et al., 1999). Similarly, the pattern of mRNA accumulation for tvsut, during root colonization or saprophytic growth, parallels the expression of tvinv encoding the T. virens intracellular invertase (Vargas et al., 2009). The simultaneous induction of tvinv and tvsut in T. virens cells suggests a strict coordination and regulation of the mechanisms controlling gene expression in a Sucdependent manner at early stages of root colonization (Fig. 4). One of the most intriguing issues is how the presence of Suc is perceived, resulting in the expression of tvinv and tvsut. Suc uptake experiments suggested the presence of a TvSut-independent entry of Suc into T. virens cells, as protoplasts from Dtvsut mutant strains were still able to incorporate low amounts of Suc (Figs 6b, S4). The presence of an alternative pathway for Suc uptake into the cell may be a key element for the initial Suc perception and induction of tvsut and tvinv. In addition to tvsuC, a second homolog to plant Suc transporters (denoted as TvSuC, with 50% similarity to TvSut and 30% similarity to CsSut1) was identified in the T. virens genome (accession no. FN677489, Fig. S1). However, tvsuC expression was not detected in wild-type or in Dtvsut strains cultivated in the presence of Suc or in the presence of plants (Fig. S3). Moreover, the expression of tvsuC was not detected, by Northern blotting or RT-PCR experiments, in T. virens cells cultured in the presence of glucose or glycerol (data not shown). The lack of expression of tvsuC suggests that this putative transporter is not related to Suc uptake in the conditions assayed. Sequence analyses of the T. virens genome revealed no homologous sequences to bacterial-type Suc carriers previously described, such as Suc permease or Suc-specific phosphotransferase transporters (Slee & Tanzer, 1982; Kakinuma & Unemoto, 1985; Gunasekaran et al., 1990; Postma et al., 1993, 1996; Jahreis et al., 2002; Kim et al., 2004). Additionally, no homologous sequences to UmSrt were identified in T. virens genome. Based on these observations, none of the well-known pathways for Suc uptake seem to be conserved in T. virens. However, putative unspecific disaccharide permeases, detected in the genome of T. virens (not shown), may be responsible for the initial entry of the disaccharide. This type of transporter is known to translocate a wide variety of sugars, including Suc, with different affinities in various microorganisms (Mortberg & Neujahr, 1986; Cheng & Michels, 1989; Cuneo et al., 2009). Thus, in T. virens, any of these unspecific disaccharide transporters may allow a small amount of Suc inside the cell to trigger the expression of Suc metabolism-related genes. Previous observations suggested that the hydrolysis of plant-produced Suc inside the fungal cells is important for controlling root colonization (Vargas et al., 2009). Studies


New Phytologist (a)

(b)

Fig. 9 Schematic representation of the sucrose (Suc)-dependent events likely to lead to the control of the symbiotic association between Trichoderma virens and plant roots. Initially, an unspecific transporter would carry low amounts of Suc inside the cell to prime the expression of tvsut and tvinv (a). Later, once tvinv is being expressed, a second network dependent on Suc hydrolysis is activated to control additional aspects related to the establishment of the symbiotic association (b). Then the expression of tvsut will amplify the original signal by transporting increased amounts of Suc that keep the regulatory events on. CWDEs, cell wall-degrading enzymes.

of the T. virens–maize association demonstrated that the null expression of tvsut did not affect the production of secreted hydrolytic enzymes (data not shown) or the ability of the fungal hyphae to colonize maize roots (Fig. 8c). Possibly the TvSut-independent Suc influx, discussed earlier, is sufficient to trigger the regulatory pathways leading to a controlled root colonization and hyphal growth in Dtvsut mutants. Then, T. virens cells would be able to use any alternative source of carbon from the plant to support growth inside roots. It is interesting to recall that despite being fully impaired on Suc degradation, the Dtvinv strain was still able to colonize plant roots. These phenomena suggest that when T. virens is unable to use Suc in the rizhosphere, alternative carbon sources can be utilized to support hyphal growth. The expression of a functional tvsut is crucial for the upregulation of tvinv, but the expression of tvsut does not require the functional expression of tvinv (Table 3). This observation suggests that Suc uptake by TvSut is a major event that enhances the expression of tvinv, which assures efficient metabolism of the disaccharide. Interestingly, the expression of cell wall-degrading enzymes (CWDEs) and the elicitor sm1 is up- and down-regulated, respectively, in mutant strains impaired in tvinv expression (Table 3, Vargas et al., 2009). We speculate that there exist at least two different Suc-dependent pathways in T. virens that can affect the regulation of gene expression; one that depends on the presence of the disaccharide in the cytoplasm (Fig. 9a), and another that is effective after its hydrolysis


Research

(Fig. 9b). Initially, an unspecific transporter (such as disaccharide permeases) would carry a small amount of Suc inside the cell to activate the expression of tvsut and tvinv (Fig. 9a). Once tvinv is expressed, a second network dependent on Suc hydrolysis is activated to control additional developmental events such as root colonization, production of CWDEs, and the elicitor Sm1 (Fig. 9b). These statements reflect our working hypothesis to explain the observed phenomena related to Suc perception and metabolism at early stages of root colonization, and the consequences on the symbiotic association in later stages. Additional experiments are being conducted to further clarify the molecular mechanisms involved in regulation of gene expression and carbohydrate metabolism inside the Trichoderma cells during rhizosphere colonization. The most studied models for sugar perception and signal transduction are among plants and yeasts (Rolland et al., 2006; Ramon et al., 2008). For instance, Suc signaling in plants can be mediated at two different stages: associated with the transport of the disaccharide, or after hydrolysis and metabolism (Lalonde et al., 1999; Koch, 2004; Rolland et al., 2006). In agreement with the regulatory phenomenon in plants, it is likely that T. virens acquired not only a very efficient pathway for Suc degradation similar to plants, but also inherited the mechanisms related to the perception and signaling induced by the disaccharide.

Acknowledgements We would like to thank J.C. Mandawe for technical assistance and Profs M. Kolomiets, S. Sukno and M. Thon, for critical reading of the manuscript. This work was supported by grants from the US Department of Agriculture National Research Initiative (2003-35316-13861) and the National Science Foundation (IOB0445650) to C.M.K.

References Baek JM, Kenerley CM. 1998. The arg2 gene of Trichoderma virens: cloning and development of a homologous transformation system. Fungal Genetics and Biology 23: 34–44. Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM. 2004. How plants communicate using the underground information superhighway. Trends in Plant Science 9: 26–32. Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM. 2006. The roles of root exudates in rhizosphere interactions with plants and other organisms. Annual Review of Plant Biology 57: 233–266. Barth I, Meyer S, Sauer N. 2003. PmSUC3: characterization of a SUT2 ⁄ SUC3-Type sucrose transporter from Plantago major. Plant Cell 15: 1375–1385. Blee K, Anderson AJ. 1998. Regulation of arbuscule formation by carbon in the plant. Plant Journal 16: 523–530. Boorer KJ, Loo DDF, Frommer WB, Wright EM. 1996. Transport mechanism of the cloned potato H+ ⁄ sucrose transporter StSUT1. Journal of Biological Chemistry 271: 25139–25144. Chacoń MR, Rodrı´guez-Galań O, Benı´tez T, Sousa S, Rey M, Llobell A, Delgado-Jarana J. 2007. Microscopic and transcriptome analyses of


787

788 Research early colonization of tomato roots by Trichoderma harzianum. International Microbiology 10: 19–27. Chaudhuri A, Bharadwaj G, Maheshwari R. 1999. An unusual pattern of invertase activity development in the thermophilic fungus Thermomyces lanuginosus. FEMS (Federation of European Microbiological Societies) Microbiology Letters 177: 39–45. Cheng Q, Michels C. 1989. The maltose permease encoded by the MAL61 gene in Saccharomyces cerevisiae exhibits both sequence and structure homology to other sugar transporters. Genetics 123: 477–484. Cuneo MJ, Chagela A, Beese LS, Hellinga HW. 2009. Structural adaptations modulate monosaccharide, disaccharide and trisaccharide specificities in periplasmic maltose-binding proteins. Journal of Molecular Biology 389: 157–166. Dennis DT, Blakeley SD. 2000. Carbohydrate metabolism. In: Buchanan BB, Gruissem W, Jones RL, eds. Biochemistry and molecular biology of plants. Rockville, MD, USA: American Society of Plant Physiologists, 630–675. Dimou M, Flemetakis E, Delis C, Aivalakis G, Spyropoulos KG, Katinakis P. 2005. Co-expression of two sugar transporters in primary and lateral roots of etiolated Glycine max seedlings. Plant Growth Regulation 45: 259–266. Djonovic´ S, Pozo MJ, Dangott LJ, Howell CR, Kenerley CM. 2006. Sm1, a proteinaceous elicitor secreted by the biocontrol fungus Trichoderma virens induces plant defense responses and systemic resistance. Molecular Plant-Microbe Interactions 19: 838–853. Faraco V, Giardina P, Sannia G. 2003. Metal-responsive elements in Pleurotus ostreatus laccase gene promoters. Microbiology 149: 2155–2162. Flementakis E, Dimou M, Cotzur D, Efrose RC, Aivalakis G, Colebatch G, Udvardi M, Katinakis P. 2003. A sucrose transporter, LjSUT4, is up-regulated during Lotus japonicus nodule development. Journal of Experimental Botany 54: 1789–1791. Gahrtz M, Stolz J, Sauer N. 1994. A phloem specific sucrose-H+ symporter from Plantago major L. supports the model of apoplastic phloem loading. Plant Journal 9: 93–100. Gunasekaran P, Karunakaran T, Cami B, Mukundan AG, Preziosi L, Baratti J. 1990. Cloning and sequencing of the sacA gene: characterization of a sucrase from Zymomonas mobilis. Journal of Bacteriology 172: 6727–6735. Hahn M, Mendgen K. 2001. Signal and nutrient exchange at biotrophic plant-fungus interfaces. Current Opinion in Plant Biology 4: 322–327. Harman GE, Howell CR, Viterbo A, Chet I, Lorito M. 2004. Trichoderma species-opportunistic, avirulent plant symbionts. Nature Reviews Microbiology 2: 43–56. Huang Y, Lemieux MJ, Song J, Auer M, Wang DN. 2003. Structure and mechanism of the glycerol-3-phosphate transporter from Escherichia coli. Science 301: 603–604. Jahreis K, Bentler L, Bockmann J, Hans S, Meyer A, Siepelmeyer J, Lengeler JW. 2002. Adaptation of sucrose metabolism in the Escherichia coli wild-type strain EC3132. Journal of Bacteriology 184: 5307–5316. Kakinuma Y, Unemoto T. 1985. Sucrose uptake is driven by the Na+ electrochemical potential in the marine bacterium Vibrio alginolyticus. Journal of Bacteriology 163: 1293–1295. Kim HS, Park HJ, Heu S, Jung J. 2004. Molecular and functional characterization of a unique sucrose hydrolase from Xanthomonas axonopodis pv glycines. Journal of Bacteriology 186: 411–418. Koch K. 2004. Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Current Opinion in Plant Biology 7: 235–246. Kru¨gel U, Veenhoff LM, Langbein J, Wiederhold E, Liesche J, Friedrich T, Grimm B, Martinoia E, Poolman B, Ku¨hn C. 2008. Transport and sorting of the Solanum tuberosum sucrose transporter SUT1 is affected by posttranslational modification. Plant Cell 20: 2497–2513.


New Phytologist Kuwayama H, Obara S, Morio K, Katho M, Urushihara H, Tanaka Y. 2002. PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Research 30: e2. Lalonde S, Boles E, Hellmann H, Barker L, Patrick JW, Frommer WB, Ward JM. 1999. The dual function of sugar carriers: transport and sugar sensing. Plant Cell 11: 707–726. Lowry JA, Atchley WR. 2000. Molecular evolution of the GATA family of transcription factors: conservation within the DNA-binding domain. Journal of Molecular Evolution 50: 103–115. Lu JM-Y, Bush DR. 1998. His-65 in the proton-sucrose symporter is an essential amino acid whose modification with site-directed mutagenesis increases transport activity. Proceedings of the National Academy of Sciences, USA 95: 9025–9030. Meyer S, Melzer M, Truernit E, Hu¨mmer C, Besenbeck R, Stadler R, Sauer N. 2000. AtSUC3, a gene encoding a new Arabidopsis sucrose transporter, is expressed in cells adjacent to the vascular tissue and in a carpel cell layer. Plant Journal 24: 869–882. Mirza O, Guan L, Verner G, Iwata S, Kaback HR. 2006. Structural evidence for induced fit and a mechanism for sugar ⁄ H+ symport in LacY. EMBO Journal 25: 1177–1183. Mortberg M, Neujahr H. 1986. Transport and hydrolysis of disaccharides by Trichosporum cutaneum. Journal of Bacteriology 168: 734–738. Nehls U. 2008. Mastering ectomycorrhizal symbiosis: the impact of carbohydrates. Journal of Experimental Botany 59: 1097–1108. Nehls U, Mikolajewski S, Magel E, Hampp R. 2001. Carbohydrate metabolism in ectomycorrhizas: gene expression, monosaccharide transport and metabolic control. New Phytologist 150: 533–541. Newton A, Mackay J, Crossley M. 2001. The N-terminal zinc finger of the erythroid transcription factor GATA-1 binds GATC motifs in DNA. Journal of Biological Chemistry 276: 35794–35801. Noiraud N, Delrot S, Lemoine R. 2000. The sucrose transporter of celery. Identification and expression during salt stress. Plant Physiology 122: 1447–1456. Park YH, Kenerley CM, Stack JP. 1992. Inoculum dynamics of Gliocladium virens associated with roots of cotton seedlings. Microbial Ecology 23: 169–170. Postma PW, Lengeler JW, Jacobson GR. 1993. Phosphoenolpyruvate: carbohydrate phosphotransferase systems of bacteria. Microbiological Reviews 57: 543–594. Postma PW, Lengeler JW, Jacobson GR. 1996. Phosphoenolpyruvate: carbohydrate phosphotransferase systems. In: Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE, eds. Escherichia Coli and Salmonella: cellular and molecular biology. Washington, DC, USA: American Society for Microbiology, 1149–1174. Pozo MJ, Van Loon LC, Pieterse CMJ. 2005. Jasmonates – Signals in plant-microbe interactions. Journal of Plant Growth Regulation 23: 211–222. Ramon M, Rollan F, Sheen J. 2008. Sugar sensing and signaling. In: The Arabidopsis book. Rockville, MD, USA: American Society of Plant Biologists. doi: 10.1199/tab.0111 [WWW document].URL http:// www.aspb.org/publications/arabidopsis [accessed on 9 July 2008]. Ramsperger-Gleixner M, Geiger D, Hedrich R, Sauer N. 2004. Differential expression of sucrose transporter and polyol transporter genes during maturation of common plantain companion cells. Plant Physiology 134: 147–160. Reinders A, Schulze W, Ku¨hn C, Barker L, Schulz A, Ward JM, Frommer WB. 2002. Protein-protein interactions between sucrose transporters of different affinities colocalized in the same enucleate sieve element. Plant Cell 14: 1567–1577. Reinders A, Ward JM. 2001. Functional characterization of the aglucoside transporter Sut1p from Schizosaccharomyces pombe, the first


New Phytologist fungal homologue of plant sucrose transporters. Molecular Microbiology 39: 445–454. Reyes JC, Muro-Pastor MI, Florencio FJ. 2004. The GATA family of transcription factors in Arabidopsis and rice. Plant Physiology 134: 1718–1732. Riesmeier JW, Willmitzer L, Frommer WB. 1992. Isolation and characterization of a sucrose carrier cDNA from spinach by functional expression in yeast. EMBO Journal 13: 4705–4713. Rolland F, Baena-Gonzalez E, Sheen J. 2006. Sugar sensing and signaling in plants: conserved and novel mechanisms. Annual Review of Plant Biology 57: 675–709. Sauer N, Stolz J. 1994. SUC1 and SUC2: two sucrose transporters from Arabidopis thaliana: expression and characterization in baker’s yeast and identification of the histidine-tagged protein. Plant Journal 6: 67–77. Schaarschmidt S, Gonza´lez MC, Roitsch T, Strack D, Sonnewald U, Hause B. 2007a. Regulation of arbuscular mycorrhization by carbon. The symbiotic interaction cannot be improved by increased carbon availability accomplished by root-specifically enhanced invertase activity. Plant Physiology 143: 1827–1840. Schaarschmidt S, Kopka J, Ludwig-Mu¨ller J, Hause B. 2007b. Regulation of arbuscular mycorrhization by apoplastic invertases: enhanced invertase activity in the leaf apoplast affects the symbiotic interaction. Plant Journal 51: 390–405. Shakya R, Sturm A. 1998. Characterization of source- and sink-specific sucrose ⁄ H+ symporters from carrot. Plant Physiology 118: 1473–1480. Slee AM, Tanzer JM. 1982. Sucrose transport by Streptococcus mutans, evidence for multiple transport systems. Biochimica et Biophysica Acta 692: 415–424. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. Vargas WA, Djonovic´ S, Sukno SA, Kenerley CM. 2008. Dimerization controls the activity of fungal elicitors that trigger systemic induced resistance in plants. Journal of Biological Chemistry 283: 19804–19815. Vargas WA, Mandawe JC, Kenerley CM. 2009. Plant-derived sucrose is a key element in the symbiotic association between Trichoderma virens and maize plants. Plant Physiology 151: 792–808. Wahl R, Wippel K, Goos S, Ka¨mper J, Sauer N. 2010. A novel highaffinity sucrose transporter is required for virulence of the plant pathogen Ustilago maydis. PLoS Biology 8: e1000303. Weaver M, Kenerley C. 2005. Density independent population dynamics by Trichoderma virens in soil and defined substrates. Biocontrol Science and Technology 15: 847–857. Weise A, Barker L, Ku¨hn C, Lalonde S, Buschmann H, Frommer WB, Ward JM. 2000. A new subfamily of sucrose transporters, SUT4, with low affinity ⁄ high capacity localized in enucleate sieve elements of plants. Plant Cell 12: 1345–1355.


Research Weschke W, Panitz R, Sauer N, Wang Q, Neubohn B, Weber H, Wobus U. 2000. Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant Journal 21: 455–467. Yao Li C, Shi JX, Weiss D, Goldschmidt EE. 2003. Sugars regulate sucrose transporter gene expression in citrus. Biochemical and Biophysical Research Communications 306: 402–407. Zhang YL, Meng QY, Zhu HL, Guo Y, Gao HY, Luo YB, Lu J. 2007. Functional characterization of a LAHC sucrose transporter isolated from grape berries in yeast. Plant Growth Regulation 54: 71–79. Zhou Y, Qu H, Dibley KE, Offler CE, Patrick JW. 2007. A suite of sucrose transporters expressed in coats of developing legume seeds includes novel pH-independent facilitators. Plant Journal 49: 750–764.

Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Sequence alignment of TvSut and TvSuC. Fig. S2 Topological model for TvSut. Fig. S3 Expression of tvsuC in Trichoderma virens, Gv29-8 and Dtvsut cells, incubated in the presence of Suc and plant roots. Fig. S4 Sucrose intake by Dtvsut1. Notes S1 Topological predictions of TvSut. Table S1 TvSut homologs in plants Table S2 TvSut homologs in fungal strains Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.


789

Functional characterization of a plantâlike sucrose transporter from the ...

Functional characterization of a plantâlike sucrose transporter from the ...

Functional characterization of a plantâlike sucrose transporter from the ...

Functional characterization of a plantâlike sucrose transporter from the ...