Functional characterization of a putative b-lactamase ... - Springer Link

Biotechnol Lett (2011) 33:2425–2430 DOI 10.1007/s10529-011-0704-7

ORIGINAL RESEARCH PAPER

Functional characterization of a putative b-lactamase gene in the genome of Zymomonas mobilis K. Narayanan Rajnish • Sheik Abdul Kader Sheik Asraf Nagarajan Manju • Paramasamy Gunasekaran

•

Received: 18 June 2011 / Accepted: 8 July 2011 / Published online: 28 July 2011 Ó Springer Science+Business Media B.V. 2011

Abstract Zymomonas mobilis ZM4 is resistant to b-lactam antibiotics but there are no reports of a b-lactam resistance gene and its regulation. A putative b-lactamase gene sequence (ZMO0103) in the genome of Z. mobilis showed a 55% amino acid sequence identity with class C b-lactamase genes. qPCR analysis of the b-lactamase transcript indicated a higher level expression of the b-lactamase compared to the relative transcript quantities in antibioticsusceptible bacteria. The putative b-lactamase gene

was cloned, expressed in Escherichia coli BL21 and the product, AmpC, was purified to homogeneity. Its optimal activity was at pH 6 and 30°C. Further, the b-lactamase had a higher affinity towards penicillins than cephalosporin antibiotics. Keywords Alcohol dehydrogenase b-Lactamase Functional genomics ORF Quantitative PCR Zymomonas mobilis

Introduction Electronic supplementary material The online version of this article (doi:10.1007/s10529-011-0704-7) contains supplementary material, which is available to authorized users. K. N. Rajnish S. A. K. S. Asraf N. Manju P. Gunasekaran (&) Department of Genetics, Center for Excellence in Genomic Sciences, School of Biological Sciences, Madurai Kamaraj University, Madurai 625021, India e-mail: [email protected] K. N. Rajnish e-mail: [email protected] S. A. K. S. Asraf e-mail: [email protected] Present Address: N. Manju Institute for Immunology, Medical School Hannover, Bldg. K11, Floor H0, OE 9422 Carl-Neuberg-Str. 1, 30625 Hannover, Germany e-mail: [email protected]

Zymomonas mobilis, a Gram negative, anaerobic, micro aerotolerant, ethanologenic bacterium, uses the Entner–Doudoroff pathway to metabolize glucose. The genome of Z. mobilis ZM4 consists of a singular, circular chromosome of 20,56,416 bp with an average G?C content of 46% (Seo et al. 2005). Z. mobilis is resistant to a wide-range of antibiotics (Bochner et al. 2010). Although, antibiotic resistance has been reported in Z. mobilis, there are no reports of molecular characterization of the genes involved in antimicrobial resistance and their regulation. An examination of the Z. mobilis genome revealed the presence of a putative b-lactamase encoded by the ORF ZMO0103. In this study, several bioinformatics tools were used to predict the functional properties of the putative b-lactamase in Z. mobilis to the utmost possible accurateness. We also report here the cloning and expression of the putative b-lactamase

123

2426

gene in E. coli and further characterization of the purified b-lactamase.

Materials and methods Bacterial strains, plasmids and culture conditions Zymomonas mobilis ZM4 (NRRL, Peoria, USA) was grown in rich medium glucose (RMG) (20 g glucose l–1, 20 g KH2PO4 l–1 and 10 g yeast extract l-1) under static condition at 30°C. E. coli DH5a (Invitrogen, CA, USA) and E. coli BL21 (DE3) (Novagen, CA, USA) were grown at 37°C with agitation in LB medium (10 g tryptone l-1; 5 g yeast extract l-1; 10 g NaCl l-1; pH 7.2). When necessary, media were supplemented with 100 mg ampicillin ml-1 and/or 30 mg kanamycin ml-1. Bioinformatics analysis The primary sequence was analysed using Protparam. Homology and similarity searching of b-lactamase protein sequence against several sequences in the NR database was performed using BLAST P. Multiple sequence alignment and analysis were performed using ClustalW2. Recombinant DNA techniques and real time PCR analysis Restriction enzymes, T4 DNA ligase, T4 DNA polymerase, Taq DNA polymerase were from MBI Fermentas (Opelstrasse, Germany) and used according to the manufacturer’s instructions. The RNeasy mini kit, Plasmid mini kit and QIAquick gel extraction kit (Qiagen, Hilden, Germany) were used for the isolation of total RNA, plasmid DNA and gel extraction respectively. The AmpC gene sequence was amplified by PCR with primers AmpCF (50 -G CGCATATGATTCAAGCCGCTGAGCCGGTCAAT30 ) and AmpCR (50 -GCGGCTCGAG TTCTTATGG GATGCCTTGTCTTTC-30 ) with flanking NdeI and XhoI restriction sites, respectively and then cloned into the pTZ57R (MBI Fermentas, Germany). E. coli DH5a was transformed with the recombinant plasmid (pTZE103). The insert in the recombinant plasmid was then confirmed by restriction analysis and PCR. The resulting recombinant plasmid was digested with

123

Biotechnol Lett (2011) 33:2425–2430

NdeI and XhoI and the 1.4 kb insert was gel purified and cloned into the expression vector pET-30b(?) (Novagen, CA, USA) and used to transform E. coli BL21 (DE3). The insert in the recombinant plasmid (pZTE103) was then confirmed by restriction analysis and PCR. Total RNA was extracted from mid-growth phase cultures of Z. mobilis as described previously (Conway et al. 1991) and treated with 10 U DNase 1(MBI Fermentas, Germany) and was purified using an RNeasy column (Qiagen, Germany). RevertAid First Strand cDNA Synthesis kit (MBI Fermentas, Germany) was used for the synthesis of first strand cDNA from total RNA template using gene-specific primers (50 –30 ) [ZMO0103 F: TGACTGGATGGAATTGGATACG, ZMO0103 R: CCGCGCGATGCACAA, adhB F: CGCAGAAGCCACCATTCAG, adhB R: GCTGGAATACCAATGGAAGCA]. adhB (alcohol dehydrogenase B) gene (Rajnish et al. 2008) was used as endogenous control. The relative quantification of gene expression was performed in an Applied Biosystems 7500 Real-time PCR system according to manufacturer’s instructions (Applied Biosystems, USA). The PCR products were subjected to dissociation-curve analysis to confirm the presence of single amplicon from the cDNA template. Determination of minimum inhibitory concentration The minimal inhibitory concentration (MIC) of different antibiotics were determined by microtitre broth dilution method using sterile 96-well microtitre plates (Andrews 2001). The concentrations of antibiotic used for Z. mobilis and recombinant E. coli were in the range of 0.25–2000 lg/ml and 0.25–150 lg/ml respectively. Cloning, expression and purification of b-lactamase A mid-growth phase culture (0.6 OD600) of E. coli BL21 (DE3) (pZTE103) was induced with 0.4 mM IPTG for 4 h at 37°C. The cells were processed to obtain soluble and insoluble proteins. SDS-PAGE analysis was performed to examine the target proteins in the soluble and insoluble fraction. The inclusion fractions were purified and solubilized (see Chap. 5 of The Recombinant Protein Handbook, Amersham


Biosciences). The refolded protein was desalted and subjected to purification using His-select nickel affinity column and stored at 4°C.

2427

Results and discussion Bioinformatic analysis of the gene ZMO0103 of Z. mobilis

Protein estimation and enzyme assay The protein estimation was determined with Lowry’s assay using BSA as standard. b-lactamase assay was performed by monitoring the hydrolysis of b-lactam. The reaction was initiated by addition of 10 ll enzyme extract to 2 ml 0.1 mM b-lactam antibiotic in 10 mM phosphate buffer, pH 7 (preincubated at 37°C). Absorbance was read at 240 nm for every 3 min. One enzyme unit was defined as the amount of b-lactamase necessary to hydrolyse 1 lmol substrate per minute under the assay condition. Specific activity was expressed as enzyme units per milligram protein. The data represents the average of three independent experiments. Effect of pH, temperature and additives on enzyme activity The effect of pH on b-lactamase activity was measured by performing assays in 50 mM citrate buffer (pH 2–5), 50 mM sodium acetate buffer (pH 4–7), 50 mM sodium phosphate buffer (pH 6–9) and 50 mM Tris/HCl buffer (pH 8–9) using 0.1 mM benzylpenicillin as substrate. For stability at different pH levels, the b-lactamase was pre-incubated in 50 mM buffer at 30°C for 30 min and the residual activity was measured. b-Lactamase activity was measured from 25 to 80°C in 50 mM sodium phosphate buffer (pH 7.0) using 0.1 mM benzylpenicillin as substrate. For determination stability, the b-lactamase was pre-incubated in 50 mM of sodium phosphate buffer (pH 7.0) at 25 to 80°C for 30 min and the residual activity then measured. Metal ions and other additives were added at 10 mM and the residual activity was measured after 30 min using as 0.1 mM benzylpenicillin as substrate. Substrate specificity was studied using benzylpenicillin, ampicillin, cephalosporin C, cephalexin, methicillin and penicillin V at 0.1 mM. The kinetic parameters of the purified b-lactamase (km, kcat, kcat/km) were determined using a Hanes plot with above-mentioned substrates at 50–1 mM. The GRAPHPAD prism enzyme kinetics software (La Jolla, CA, USA) was used to determine kinetic parameters.

BLAST P analysis of the Z. mobilis proteome using Escherichia coli MG1655 AmpC b-lactamase as query indicated the presence of three putative b-lactamases encoded by the ORF’s ZMO0103, ZMO1650 and ZMO1967. A b-lactamase with a significant E-value of 2e-05 was selected. Analysis of the deduced protein sequence of ZMO0103 using the BLAST P program revealed 55% amino acid sequence identity to the class C-b- lactamase [P 85302.1] of Pseudomonas fluorescens (Pierrard et al. 1998). The putative b-lactamase comprises 472 amino acids with a predicted molecular mass of 52.28 kDa and a theoretical isoelectric point (pI) of 9.62. The alkaline pI of Z. mobilis AmpC is comparable with the earlier reports of class C b-lactamases (Nadjar et al. 2001). The domain analysis of the protein deduced from the ORF ZMO0103 indicated the presence of the b-lactamase domain AmpC and hence the putative b-lactamase was designated as AmpC (Jacoby 2009). Multiple sequence alignment revealed the SXSK, a characteristic motif of AmpC b-lactamases with the conserved serine active site and also YXN motif (Fig. 1). The serine of the SXSK motif is considered to be involved in the reaction mechanism (Joris et al. 1988).

Determination of antimicrobial susceptibility The minimum inhibitory concentrations (MIC) of different b-lactams and non b-lactams were determined. Z. mobilis ZM4 was highly resistant to benzylpenicillin ([1024 lg/ml), cephalothin ([1024 lg/ml), penicillin V ([1024 lg/ml), cephalexin (512 lg/ml), and cephalosporin C ([512 lg/ml). Similarly, when AmpC was expressed in E. coli BL21 (pZTE103), the recombinant strain exhibited high level resistance to benzylpenicillin ([128 lg/ml), cephalexin (128 lg/ ml) and penicillin V (128 lg/ml). This strain was susceptible to non b-lactams such as nalidixic acid, chloramphenicol and aminoglycosides (streptomycin, neomycin and gentamicin) thus indicating the AmpC specificity for b-lactam antibiotics. The control E. coli BL21 (DE3) carrying pET-30b(?) was susceptible to b-lactams and non b-lactam antibiotics.

123

2428


Fig. 1 ClustalW2 analysis of putative b-lactamase of Z. mobilis. Multiple sequence alignment of blactamase of Z. mobilis was performed using ClustalW2 with different b-lactamases of Morganella morganii, Enterobacter cloaceae, Pseudomonas fluorescens and Providencia stuartii. Asterisks and dots indicate identical and similar amino acids respectively. The boxes represent the motifs of class C- b-lactamase, SXSK motif and YXN motif

Transcript analysis of ZMO0103 To study the expression level of the gene ZMO0103 in Z. mobilis, qPCR analysis was performed as described in the Materials and methods. The Ct value of ZMO0103 transcript indicated that the ZMO0103 expression was greater when compared to the relative transcript quantities in antibiotic-susceptible bacteria like E. coli strain ATCC 25922 (Corvec et al. 2003). This shows that the putative b-lactamase is expressed in higher level in Z. mobilis ZM4 and thus contributing to high resistance to b-lactam antibiotics

Fig. 2 a SDS-PAGE analysis of cellular proteins of IPTG induced recombinant E. coli BL21 (DE3). Recombinant E. coli BL21 (DE3) at the mid-log phase (0.6 OD600nm) was induced with 0.4 mM IPTG for 6 h at 37°C. The cells were harvested and processed further. Soluble and insoluble proteins were resolved on 12% SDS-PAGE, and the gel was stained with Coomassie Brilliant Blue R250. Lane M molecular weight marker. Lane 1 total proteins of E. coli BL21 (DE3) pET-30b

123

(Supplementary Fig. 1). Induction of Z. mobilis AmpC with benzylpenicillin did not increase the b-lactamase activity. The absence of the AmpR upstream to AmpC in Z. mobilis genome accounts for the constitutive expression of b-lactamase as reported previously in Acinetobacter baylyi (Beceiro et al. 2007). Expression of the Z. mobilis putative b-lactamase gene in E. coli The ORF ZMO0103 was cloned into the expression vector pET-30b(?). The resultant recombinant plasmid

(?). Lane 2 soluble proteins of recombinant E. coli BL21 (DE3). Lane 3 target protein present in the insoluble fraction as inclusion bodies b SDS-PAGE analysis of purified b-lactamase. The inclusion bodies were solubilised with urea and refolded by drop dilution method. The refolded protein was purified using IMA Chromotography. Lane 1 purified blactamase. Lane M molecular weight marker


2429

pZTE103 was transferred into E. coli BL21 (DE3) as described in the Materials and methods. SDS–PAGE analysis of the proteins of E. coli BL21 (pZTE103) induced with IPTG revealed this protein appeared in inclusion bodies. Similarly, Rinas and Bailey (1993) overexpressed the TEM b-lactamase which resulted in formation of inclusion bodies in E. coli JM101.These inclusion bodies was solubilized, the b-lactamase was refolded and purified. The purified b-lactamase appeared as single band corresponding to a molecular mass of 52 kDa (Fig. 2). Kinetic analysis and effect of inhibitors on b-lactamase activity The purified recombinant b-lactamase showed maximum activity at pH 6 and 30°C. It was stable for 30 min at pH 3–8 and from 25 to 70°C. Further increase in pH 8 and temperature above 70°C lead to loss of 90% b-lactamase activity (Fig. 3). A similar characteristic profile for the b-lactamase of Neisseria gonorrhoeae was reported (De Castillo et al. 1998). The presence of Ca2?, Mg2? and Na? had no effect on the b-lactamase activity, whereas Hg2? inhibited b-lactamase as reported earlier (Hirai et al. 1980). Addition of PCMB (p-chloromercuribenzoate) strongly inhibited (98% inhibition) b-lactamase activity of Z. mobilis AmpC. A similar effect had been reported in Bacteroides fragilis b-lactamase (Yotsuji et al.1983). The low km value for the hydrolysis of benzylpenicillin (26 ± 0.81 lM) and penicillin V (46 ± 2 lM) by Z. mobilis AmpC suggested that penicillins were good substrates when compared to cephalosporin C (252 ± 2.5 lM). The kcat values for hydrolysis of benzylpenicillin (4.3 ± 0.47 S-1) and ampicillin (3.3 ± 0.08 S–1) suggested that they are preferred substrates for Z. mobilis AmpC. The catalytic efficiency (kcat/km) values for benzylpenicillin (0.16 lM-1S-1), ampicillin (0.04 lM-1S-1) much higher than to that of cephalexin (0.002 lM-1S-1), and cephalosporin C (0.001 lM-1S-1). This rate of hydrolysis of ampicillin (3.3 ± 0.08 S-1) by Z. mobilis AmpC was 1.8 times lower than that of the class C b-lactamase of Psychrobacter immobilis A5 (Feller et al. 1997). Similarly, cephalosporin C (2.5 ± 0.35 S-1) hydrolysis by Z. mobilis AmpC was 2.5 fold lower than that of the Moraxella catarrhalis b-lactamase (Eliasson et al. 1992). The low kcat values for the

Fig. 3 a Effect of pH on the relative activity (triangle) and relative stability (square) of b-lactamase. The effect of pH on b-lactamase activity was determined by incubation of the purified enzyme in buffer at pH ranging from 2 to 9. b-Lactamase activity (0.5 U/ml) at pH 6 was set as 100% and the relative stability is expressed as the percentage of the activity at pH 6 and 30°C. The stability of the enzyme was determined by incubation of the purified enzyme in buffers with pH ranging from 2 to 9 for 30 min. b-Lactamase activity (0.5 U/ml) at pH 6 was set as 100% and the relative stability is expressed as the percentage of the activity at pH 6 and 30°C. b Effect of temperature on the relative activity (triangle) and relative stability (square) of b-lactamase. The effect of temperature on b-lactamase activity was determined by incubation of the purified enzyme in buffer at temperatures ranging from 25 to 90°C. The stability of the enzyme was determined by incubation of the purified enzyme in buffers with temperature range of 25 to 90°C for 30 min. Enzyme activity (0.5 U/ml) at pH 6 was set as 100% and the relative stability is expressed as the percentage of the activity at pH 6 and 30°C

123

2430

hydrolysis of methicillin (0.9 ± 0.17 S-1) was similar to that reported by Galleni and Frere (1988). In summary, a putative b-lactamase has been cloned and expressed in E. coli BL21, and was identified as an AmpC. The results of bioinformatic analysis and characterization of the purified enzyme strongly indicated that ZMO0103 encodes a class C b-lactamase that specifically hydrolyses penicillins. Moreover, qPCR analysis revealed that the ORF ZMO0103 is expressed at a higher level than compared to the relative transcript quantities in antibioticsusceptible bacteria like E. coli strain ATCC 25922, which could be correlated to the high level of resistance to b-lactam antibiotics in Z. mobilis. Acknowledgements Authors thank University Grants Commission, New Delhi (F.4-5/2006 XI Plan) and Department of Science and Technology, New Delhi (SR/SO/BB-50/2007) for the financial support and Junior Research Fellowships to KNR, NM and SSA through the Centre for Excellence in Genomic Sciences. The support received from Centre for Advanced Studies in Functional Genomics and Networking Resource Centre in Biological Sciences, School of Biological Sciences, Madurai Kamaraj University are gratefully acknowledged. Authors thank K. Vijayshree for assisting in the real time PCR experiments.

References Andrews JM (2001) Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48:5–16 Beceiro A et al (2007) Molecular characterization of the gene encoding a new AmpC b-lactamase in Acinetobacter baylyi. J Antimicrob Chemother 59:996–1000 Bochner B et al (2010) Phenotype microarray profiling of Zymomonas mobilis ZM4. Appl Biochem Biotechnol 161:116–123 Conway T et al (1991) Cloning, characterization and expression of the Zymomonas mobilis eda gene that encodes 2-keto3-deoxy-6-phosphogluconate aldolase of the EntnerDoudoroff pathway. Mol Microbiol 5:2901–2911

123

Biotechnol Lett (2011) 33:2425–2430 Corvec S et al (2003) Comparison of two RT-PCR methods for quantifying AmpC specific transcripts in Escherichia coli strains. FEMS Microbiol Lett 228:187–191 De Castillo MC et al (1998) Properties of b-lactamase from Neisseria gonorrhoeae. Mem Inst Oswaldo Cruz, Rio de Janeiro 93:237–241 Eliasson I et al (1992) Characterization of cell-bound papainsoluble b-lactamases in BRO-1 and BRO-2 producing strains of Moraxella (Branhamella) catarrhalis and Moraxella nonliquefaciens. Eur J Clin Microbiol Infect Dis 11:313–321 Feller G et al (1997) Enzymes from cold-adapted microorganisms. The class C b-lactamase from the antarctic psychrophile Psychrobacter immobilis A5. Eur J Biochem 244:186–191 Galleni M, Frere JM (1988) A survey of the kinetic parameters of class C b-lactamases. Biochem J 255:119–122 Hirai K et al (1980) Purification and properties of a new b-lactamase from Pseudomonas cepia. Antimicrob Agents Chemother 17:355–358 Jacoby GA (2009) AmpC b-lactamases. Clin Microbiol Rev 22:161–182 Joris B et al (1988) The active-site-serine penicillin-recognizing enzymes as members of the Streptomyces R61 DDpeptidase family. Biochem J 250:313–324 Nadjar D et al (2001) Molecular characterization of chromosomal class C b-lactamase and its regulatory gene in Ochrobactrum anthropi. Antimicrob Agents Chemother 45:2324–2330 Pierrard A et al (1998) Inducible class C b-lactamases produced by psychrophilic bacteria. FEMS Microbiol Lett 161:311–315 Rajnish KN, Kishore Chowdry GM, Gunasekaran P (2008) Functional characterization of a putative endoglucanase gene in the genome of Zymomonas mobilis. Biotechnol Lett 30:1461–1467 Rinas U, Bailey JE (1993) Overexpression of bacterial haemoglobin causes incorporation of pre- b-lactamase into cytoplasmic inclusion bodies. Appl Environ Microbiol 59:561–566 Seo JS et al (2005) The genome sequence of the ethanologenic bacterium Zymomonas mobilis ZM4. Nat Biotechnol 23:63–68 Yotsuji A et al (1983) Properties of novel b-lactamase produced by Bacteroides fragilis. Antimicrob Agents Chermother 24:925–929