JOHN R. PUDDEFOOT, ANTHONY W. GOODE and. GAVlN P. VINSON. *Depurtment of Biochemistry, Medicul College of S t. Burtholomew's Hospituf, London ...
633rd MEETING, LONDON to the Fokl cutting site. For further analysis of the ScaI-FokI and Fok I-Pvull fragments, pairs of complementary oligonucleotides representing these regions were synthesized, respectively, A R E 1:
5 ’-CTATAA ATATCACAGCTCGAATGTTAGCCAAGTTGTTCTCTCTTA ACTCT-3' and ARE2:
5 ’-TATAGGATGTTTGA ACATAGTACGTGATGTTCTCAAGATAGTAATGAAAT-3’ in each of which the putative 15-nucleotide hormone response element, comprising the two ‘arms’ of the imperfect 6-base palindrome and the 3-base spacer [ 11, is underlined. In DNA cellulose competition assays, both A R E l (50% competition at 0.05 g equivalents) and ARE2 (73% competition at 0.05 g equivalents) effectively reduced binding of androgen receptor to immobilized calf-thymus DNA. Mutation of the right arm to TTTTCT [ l o ]abolished competitive ability in both cases. Alteration of the left arm of A R E l to TTGCAA and that of ARE2 to ATTAAG reduced competitive effectiveness at 0.05 g equivalents to 24% and 41‘%, respectively. Deletion of the three bases immediately 5’ to the TGTTCT motif, i.e. those prospectively responsible for the critical spacing of dyadic response elements [ l l ] , abolished the effectiveness of ARE2 and reduced that of ARE 1 t o 28% at 0.05 g equivalents. In the latter case, however, removal of the ‘spacer’ creates TGTTAGCCATGTTCT, which has greater similarity to ARE2 than does the natural sequence. In terms of binding of androgen receptor, therefore, both putative intronic AREs behave as response elements, with the right arm of the imperfect palindrome placing more stringency on binding than the left arm. ARE2 has the greater similarity to the response elements of the MMTV LTR and, most remarkably, to the most active synthetic ele-
56 1 ment GGTACANNNTGTTCT devised by Ham el af. 131. This is in line with the relative performances of A R E l and ARE2 in transfection assays [ 101, but their role in vivo, and the requirement for the co-operativity of other enhancer factors, including possible A R E elements in the promoter region, remains open to critical appraisal. I . Beato, M., Chalepakis, G., Schauer, M. & Slater, E. P. ( 1989)J. Steroid Riochem. 32,737-748 2. Cato, A. C. B., Henderson, D. & Ponta, H. ( 1 987) E M H O J . 6 , 363-368 3. Ham, J., Thomson, A,, Needham, M., Wehh, P. & Parker, M. (1988)Nucleic Acids Res. 16,5263-5276 4. Otten, A. D., Sanders, M. M. & McKnight, G. S. (1088) Mol. Endocrinol. 2, 143- 147 5. Denison, S. H., Sands, A. & Tindall, D. J. (1989) Endocrinolohy 124, 1091-1093 6. Perry, S. T., Viskochil, D. H., Ho, K.-C., Fong, K., Stafford, D. W., Wilson, E. M. & French, F. S. ( 1 985) in Hegulution 01 Androgen Action (Bruchovsky, N., Chapdelaine, A. & Neumann, F., eds.), pp. 167- 174, Congressdruck R. Bruckner, Berlin 7. Rushmere, N. K., Parker, M. G. & Davies, P. (1987) Mol. Cell. Endocrinol. 51,259-265 8. Van Dijck, Winderickx, J., Heyns, W. & Verhoeven, G. ( I 989) Mol. Cell. Endocrinol. 64, 195-204 9. Claessens, F., Rushmere, N. K., Peeters, B., Davies, P. & Rombauts, W. ( 1 989)Arch. Int. I’hysiol. Hiochem. 97, B I 5 10. Claessens, F., Celis, L., Peeters, B., Heyns, W., Verhoevcn, G. & Romhauts, W. ( 1 989) Biochem. Biophys. Rex Cbmmun. 164, 833-840 1 1 . Umesono, K. & Evans, R. M. ( 1989) (211 (Cumhridgc., Mus.~.) 57,1139-1 146 12. Fried, M. & Crothers, D. M. (1981) Nucfeic Acids Hex 9, 6 505-6525
Received 22 November 1989
Functional characterization of an androgen response element F. CLAESSENS? N. RUSHMERE,t L. CELIS,* B. PEETERS,* P. DAVlESt and W. ROMBAUTS* *AJdelirigBiochemie, c‘umpi4s Gasthuisberg, K . U. Leuven, .WO Leirven. Rel~iirmarid t Terioviu Institute tor Cancer Keseurch, Utiive&y of Wules, College of Medicine, Curd# CF4 4xx. U.K . The synthesis of prostatic binding protein (PBP) in rat ventral prostate is strongly dependent on the presence of androgens. This dependency can at least in part be explained by transcriptional regulation of the genes coding for the components C I , C2 and C 3 of PBP. Wc have screened the complete C I , C2A and C3( I ) genes and their flanking sequences for regions displaying affinity in vim) f o r the androgen receptor in a DNA-cellulose competition assay. Two affinity regions were detected in each gene: one in the promoter region and one in the first intron. These results are in agreement with earlier reports on the 5’ part o f theC3( I ) g e n e [ l ] . While attempts t o delimit androgen response elements (AREs) in the promoter region of C3(1) have been unsuccessful 121, we now have demonstrated that the 450 bp intronic fragment o f C3( 1 ) confers androgen responsiveness Ahhreviations used: PBP, prostatic binding protein: ARE, androgen response clement: GRE. glucocorticoid response element: PRE, progesterone response element; tk-CAI; thymidine kinase promoter in front of a chloramphenicol acetyltransferase: MMTV LIK. mouse mammary tumour virus long terminal repeat: 5a-DH7; 5 *-dihydrotestosterone.
VOl. 1 x
to a heterologous promoter in T-47D cells 131. A 204 bp subfragment, containing two elements: core I and core 11, which resemble the consensus for the glucocorticoid response element (GRE) [4] displays identical properties (Table I). The inductive effect of 100 nM-Sa-DHT was abolished by addition of 100 ,LAMof the anti-androgenic compound nilutamide (RU 23908; obtained from J. P. Raynaud, Roussel Uclaf), and is therefore mediated by the androgen receptor. In each core element we have substituted the G in 5‘TGTTCT-3’ by T. Functional analysis has revealed that only core 11 has the ability to act as an ARE (Table 1 ).This clement (S’-AGTACGTGATGTTCT-3’) shows a high degree of similarity to the GRE consensus (S’-GGTACAnnnTGTTCT-3‘), which can also act as an ARE [51.The substitution in core I has no effect on the androgen response. Mutation of core I1 in the 204 bp intronic fragment results in a total loss o f affinity ;TI vitro o f the fragment for the androgen receptor in DNA-cellulose cornpetition analysis, while mutation o f core I results only in a minor decrease. Furthermore, core II, cloned as an oligonucleotide in the polylinker site of the pBLCAT2 vector 161, clearly confers affinity in v i m to a vector fragment. Surprisingly, this oligonucleotide construct is not responsivc to androgens when transfccted in T-47D cells (Table 1 ). Because of the resemblance of the C 3 ARE with the GRE/PRE consensus, we have tried t o induce the androgen responsivc tk-CAT constructs with progcsteronc and dcxamethasone and found that they are inducible with thcsc steroids. Moreover, the substitution in the ARE (core 11)
BIOCHEMICAL SOCIETY TRANSACTIONS
562
Table 1 . Results of induction experiments Schematic configuration of the tkCAT constructs is given in the middle. The codes are given at the left, the induction factors (IFs) obtained in T-47D cells or L 929 cells with either 100 n M Sa-DHT (A), 0.1 P M progesterone ( P ) or 0.1 P M dexamethasone ( G )are given at the right. Induction factors are obtained by dividing the amount of acetylated chloramphenicol obtained in extracts from transfected cells grown in medium without hormone, by that obtained in the extracts of cells grown in the presence of hormones.
-IR
T-47D
Codename
Configuration
pUTKAT 4
--(tkl
pMTVCAT
4
88/ 136
i
89/33
4
89/34
-I
89/70
MMTV
CAT
P
I .3
1.3
65
LTR 1
A
7
146
5.9
-
5.6
G
L 929
G
0.9
243
0.8
88
4.4
1.3
1 tk CAT 0.9 1.6 1.2 v
k
II m
totally abolishes this effect (Table 1). These findings are in agreement with the established affinity in “itro of the c3(1) intronic fragment for the glucocorticoid and progesterone receptors [7]. How the steroid specificity and the prostate specificity of the C 3 expression should be explained is as yet unclear. -Additional transcription factors, present in the prostate, might be involved in the androgen response. In LO29 cells, the C3 constructs are not responsive to dexamethasone, in contrast to the mouse mammary tumour virus long terminal repeat (MMTV LTR) promoter that is induced 88-fold (Table I ) . Possibly, these cells lack a necessary factor specifically involved in the steroid response of the C 3 constructs. Perhaps the need for such an additional factor could also explain why the oligonucleotide constructs are unresponsive to androgens in T-47D cells. In addition, the chromatin structure undoubtedly also plays an important role in the regulation of the C 3 gene expression [S]. Supported by grants from the Belgian F.G.W.O. and the National incentive program (810-25) o n fundamental research in life
t
k
l CAT
4.3
6.8
7.8
1.6
I .o
sciences of the Science Policy Programming Department. We are grateful to V. Feytons and R. De Greef for excellent technical assistance.
2. 3.
4. 5. 6,
7. 8.
Rushmere. N. K., Parker, M. G. & Davies, P. (1987) MoI. (‘(4 Endocrinol. 51,259-265 Parker, M. G., Webb, P., Mills, J. S., Needham, M. & White, K. (1988) J. Steroid Biochem. 30,47-5 1 Claessens, F., Celis, L., Peeters, B., Heyns, W., Verhoeven, G. & Rombauts, W. ( 1 989) Hiochem. Hiophy. Hes. (’ommiin. 164. 833-840 Beato, M. (1987)Biochim. Biophys. Acfu 910,OS- 102 Ham, J., Thompson, A., Needham, M., Webb, P. & Parker, M. G. (1988)Nucleic Acids Res. 16, 5263-5276 Luckow, B. & Schiitz, G. (1987) Nucleic Acids Kes.13, 5490 Davies, P. & Rushmere, N. K. (1988) Biochem. Soc. Truns. 16, 695-698 Buttyan, R. & Olsson, C . A. ( 19x6) Hiochem. Hiophys. Hes. (’ommun. 138,1334-1340
Received 24 November 1989
Regulation of epidermal growth factor receptor in breast cancer STEWART BARKER, C A M PANAHY, JOHN R. PUDDEFOOT, ANTHONY W. GOODE and GAVlN P. VINSON *Depurtment of Biochemistry, Medicul College of S t Burtholomew’s Hospituf, London EC1 M 6BQ and $Surgical Unit, The London Iiospitul (Whitechupel), London E l 2AD,
U.K. The progression of human breast cancer is thought to occur under the influence of the oestrogen. 17-/3 oestradiol (E,) Abbreviations used: E L , 17-8 oestradiol; ER, oestrogen receptor; EGFR, epidermal growth factor receptor; EGF, epidermal growth factor; Pg;progesterone;PgR, progesterone receptor.
acting via its intracellular receptor. It has also been shown that E, is able to stimulate the production of growth factors, such as transforming growth factor alpha (TGFa), by oestrogen receptor (ER)-positive breast cancer cell-lines [ 1 1. This mitogenic growth factor acts through the epidermal growth factor receptor (EGFR), which is a transmembrane protein found in a wide variety of tissue typcs. including some breast cancer cell lines. It has been thoroughly demonstrated that in primary breast cancers the presence of EGFR is inversely related t o the presence of ER, so that very seldom arc both rcccptor types detectable in the Same tumour 12). Furthcrrnorc, the presence o f EGFR in a tumour indicates ;I poorer prognosis 1 000
