Fungal Genetics and Biology

Fungal Genetics and Biology 61 (2013) 120–132

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger Ziyu Dai a,⇑, Uma K. Aryal b,1, Anil Shukla b, Wei-Jun Qian b, Richard D. Smith b, Jon K. Magnuson a, William S. Adney e,2, Gregg T. Beckham c,d, Roman Brunecky e, Michael E. Himmel e, Stephen R. Decker e, Xiaohui Ju f, Xiao Zhang f, Scott E. Baker a,g,⇑ a

Fungal Biotechnology Team, Chemical and Biological Processes Development Group, Pacific Northwest National Laboratory, Richland, WA 99352, United States Biological Sciences Division and Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, WA 99352, United States National Bioenergy Center, National Renewable Energy Laboratory, Golden, CO, United States d Department of Chemical Engineering, Colorado School of Mines, Golden, CO, United States e Biosciences Center, National Renewable Energy Laboratory, Golden, CO, United States f Bioproducts, Science Engineering Laboratory, Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Richland, WA 99354, United States g Environmental Molecular Science Laboratory, Pacific Northwest National Laboratory, Richland, WA 99352, United States b c

a r t i c l e

i n f o

Article history: Received 24 July 2013 Accepted 16 September 2013 Available online 25 September 2013 Keywords: Asparagine-linked glycosylation 3 (ALG3) Aspergillus niger Filamentous fungi N-linked glycosylation Trichoderma reesei cellobiohydrolase (Cel7A) Protein secretion and expression

a b s t r a c t Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl a-1,3-mannosyltransferase (also known as ‘‘asparaginelinked glycosylation 3’’, or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3D) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3D delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM + cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM + cAMP and spore production on CM. The alg3D also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3D, 63% of which were secreted at higher levels in alg3D strain than the parent. The rCel7A expressed in the alg3D mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function. ! 2013 Elsevier Inc. All rights reserved.

1. Introduction ⇑ Corresponding authors. Addresses: Fungal Biotechnology Team, Chemical and Biological Process Development Group, Pacific Northwest National Laboratory, P.O. Box 999, MSIN: K8-60, Richland, WA 99352, United States (Z. Dai), Environmental Molecular Science Laboratory, Pacific Northwest National Laboratory, 3335 Innovation Blvd, MSIN: K8-91, Richland, WA 99352, United States (S.E. Baker). Fax: +1 509 372 4732. E-mail addresses: [email protected] (Z. Dai), [email protected] (S.E. Baker). 1 Present address: Department of Biochemistry, Purdue University, West Lafayette, IN 47907, United States. 2 Present address: Center for Agricultural, Environmental Biotechnology, RTI International, Research Triangle Park, NC 27709, United States. 1087-1845/$ - see front matter ! 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.fgb.2013.09.004

Filamentous fungi, such as Aspergillus niger, are well known for their ability to produce a variety of products including heterologous proteins of industrial interest and organic acids on an industrial scale (Nevalainen et al., 2005; Punt et al., 2002; Magnuson and Lasure, 2004). Some industrial A. niger strains can grow in liquid cultures with more than 20% glucose or sucrose and be able to convert almost the entire supplied carbohydrates to citric acid. In particular, A. niger has been extensively studied and optimized for citric acid production and is currently the primary source of

Z. Dai et al. / Fungal Genetics and Biology 61 (2013) 120–132

commercial production of citric acid (Magnuson and Lasure, 2004). In addition to citric acid, A. niger has been explored for production of other organic acids and secondary metabolites (Nielsen et al., 2009; Frisvad et al., 2011; Chiang et al., 2011). Production of both proteins and chemicals in A. niger is tightly controlled and regulated spatially and temporally at different levels. Various research efforts have examined the morphology of A. niger (Dai et al., 2004; Driouch et al., 2012), its protease dynamics in cultures (Braaksma and Punt, 2008; van den Hombergh et al., 1997), its bioprocessing strategies (Wang et al., 2005), and its genomics (Andersen et al., 2011) to understand the underlying cellular mechanisms. For example, comparative genomics was applied to compare citric-acid-producing and enzyme-producing A. niger strains (Andersen et al., 2011), proteomics was used to examine secretory responses to culture conditions (de Oliveira et al., 2011), and a combination of both genomics and proteomics was used to examine enzyme or organic acid production (Jacobs et al., 2009; Tsang et al., 2009). Although past studies examined potential involvement of the selected genes in the production of organic acids or proteins, the effects of altering or deleting such genes on growth, development, and protein production are still not well investigated. N-linked protein glycosylation is one of the most common posttranslational modifications, wherein glycans are primarily linked to asparagine (N) and involved in a variety of biochemical and cellular processes (e.g., cell to cell recognition, cell signaling, host-defense, and protein secretion and function) in various organisms (Adney et al., 2009; Beckham et al., 2012; Nam et al., 2008; Trombetta and Parodi, 2003; Yang et al., 2009). Glycosylation motifs have been identified in more than two-thirds of eukaryotic proteins (Apweiler et al., 1999), and have been extensively studied in both mammals (Kornfeld and Kornfeld, 1985) and yeast (Kukuruzinska et al., 1987; Wildt and Gerngross, 2005; Yan and Lennarz, 2005). With the rapid progress in genomics and proteomics of filamentous fungi, several protein glycosylation pathways in filamentous fungi have also been deduced recently (Deshpande et al., 2008; Geysens et al., 2009). Further, several genes involved in N-linked glycosylation have recently been studied in filamentous fungi (Kainz et al., 2008; Kotz et al., 2010; Maddi and Free, 2010; Motteram et al., 2011) and demonstrated their effects on N-linked glycan patterns, cell wall formation, overall protein secretion and phenotypic changes. Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl a-1,3-mannosyltransferase (ALG3) incorporates the first dolichyl-P-manderived mannose in an a-1,3-linkage into the Man(5)GlcNAc(2)PP-Dol inside the endoplasmic reticulum (ER) (Fig. 1). Hence, it is a key enzyme in the early N-linked glycan synthesis for formation of a Glc3Man9GlcNAc2 core oligosaccharide. The alg3 gene has been identified and functionally characterized in several organisms (e.g., yeast [Saccharomyces cerevisiae, Pichia pastoris, and Yarrowia lipolytica], filamentous fungus [A. nidulans and A. niger], parasitic flagellates [Trypanosoma brucei], higher plants [Arabidopsis thaliana], and humans) (Aebi et al., 1996; Davidson et al., 2004; De Pourcq et al., 2012; Kainz et al., 2008; Korner et al., 1999; Kajiura et al., 2010; Manthri et al., 2008). No obvious phenotypes were observed in the alg3D mutants of S. cerevisiae, P. pastoris, A. nidulans, T. brucei, and A. thaliana. Lately, two independent studies showed that the alg3 deletion reduced the growth and sporulation in S. cerevisae (Deutschbauer et al., 2002; Yoshikawa et al., 2011). In humans, the alg3 defect leads to several severe diseases (e.g., profound psychomotor delay, optic atrophy, acquired microcephaly, iris colobomas, and hypsarrhythmia) (Denecke et al., 2005; Schollen et al., 2005; Stibler et al., 1995). Glycan analyses confirmed that the alg3 mutants in these studies produced glycoproteins with various N-glycan profiles (e.g., Man3GlcNAc2, Man4GlcNAc2, Man5GlcNAc2, GlcMan5GlcNAc2, Glc2Man5GlcNAc2 and Glc3Man5GlcNAc2), which

121

Fig. 1. Diagram showing functional role of ALG3 in biosynthesis of the lipid-bound oligosaccharide by the addition of the first dol-P-man derived mannose in an alpha1,-3-linakge to man5GlcNac2-pp-Dol inside endoplasmic reticulum. The alg3 deletion (alg3D) leads to loss of N-linked glycan complexity. Blue square represents GlcNac, while the green circle depicts the mannose. The red hexagon depicts the specific mannose resulted from ALG3function. The a2 is for alpha-1,2-, a3 for alpha-1,3-, a6 for alpha-1,6-, and b4 for beta-1,4-linkage, respectively. RFT1 is an enzyme that catalyzes the translocation of the Man5GlcNAc2-pppDol from cytoplasmic to the luminal side of the endoplasmic reticulum (ER) membrane; and ALG9 is an enzyme of asparagine-linked glycosylation 9. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

affected the overall N-linked glycosylation and incomplete glycosite occupancy in the glycoproteins. Due to its involvement in the early glycan synthesis, it has been explored for the potential applications in producing humanized complex N-glycans on the therapeutic proteins in P. pastoris, Y. lipolytica, A. nidulans, and A. niger (Gerngross, 2004; Kainz et al., 2008). Additionally, A. niger has been actively explored for heterologous production of industrial enzymes. However, the effects of post-translational modifications such as N-linked glycosylation on their function have not been well defined. Recently, the involvement of alg3 gene in a Glc3Man9GlcNAc2 core oligosaccharide formation and overall N-linked glycosylation has been analyzed in A. niger (Kainz et al., 2008). However, the effects of alg3 gene on growth, development, metabolisms, protein secretion and industrial enzyme production have not been examined. Thus, the objective of this study is to demonstrate the involvement of alg3 in spore germination, hyphal growth, sporulation, pigment production, overall protein secretion, and heterologous expression and function of Trichoderma reesei cellobiohydrolase Cel7A in A. niger. 2. Material and methods 2.1. Strains, chemicals and media The Escherichia coli strain Top10 and S. cerevisiae strain YVH10 were used as hosts for routine cloning and gap repair experiments. A. niger wild-type strain (ATCC 11414 [derived from ATCC 1015/ CBS 113.46/NRRL 328], from the American Type Culture Collection [Rockville, MD, 20852]), was grown on complete medium (CM) or potato dextrose agar (PDA) plates at 30 "C for culture maintenance and spore preparation. The parent strain of 11414kusA was generated by the homologous replacement of kusA in A. niger 11414pyrGD strain with Aspergillus fumigatus orotidine-5-phosphate

122


decarboxylase (pyrG), where the kusA encodes the orthologue of the ku70 protein that involves in the non-homologous end joining pathway of DNA repair for the integration of a DNA fragment into the genome, and confirmed by Southern blotting analysis (Chiang et al., 2011). The 11414kusA strain with a high homologous replacement rate was used as a parent strain in this study. The cultures on PDA or CM agar plates were incubated for 4 days at 30 "C and the spores were harvested afterwards by washing with sterile 0.5% Tween 80 (polyoxyethylenesorbitan monooleate). The spores were enumerated with a hemocytometer. Aliquots of the resulting spore suspension (about 109 spores/mL) were used to inoculate different agar-plates or liquid cultures. The PDA, CM and minimal medium (MM) were prepared following the description of Bennett and Lasure (Bennett and Lasure, 1991). The 100 mM cAMP stock solution was prepared in sterile distilled H2O. Hygromycin B stock solution was purchased from Agro Bio, Inc. (Miami, FL, USA) and Zeocin stock solution from Invitrogen (Grand Island, NY, USA). 2.2. Culture methods Glass baffled-flasks of 250 mL or 1000 mL were silanized by rinsing with a 5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, MO) to minimize spore adherence to the glass surface. A. niger biomasses for genomic DNA isolation were prepared from 2 mL stationary CM liquid cultures in 16 ! 125 mm glass culture-tubes at 30 "C. The biomasses formed on the surfaces of the liquid cultures were collected, frozen immediately in liquid nitrogen and dried in the VirTis benchtop manifold freeze dryer (SP Scientific, Gardiner, NY). For total secretome isolation, 200 mL modified MM (Wang et al., 2012) were used and cultures were grown at 30 "C and 200 rpm for 18 h. For heterologous expression of T. reesei Cel7A (rCel7A), the mutant strains were grown at 30 "C and 200 rpm for 48 h in the CM liquid cultures with maltose as carbon source. 2.3. The alg3 gene deletion and complementation, heterologous expression of T. reesei Cel7A gene, and A. niger transformation The putative Alg3 protein sequence (jgi|Aspni5|42720) was identified by a database search based on the amino acid sequence

of S. cerevisiae ALG3p (access number YBL082C) in A. niger genome database of the U.S. Department of Energy (DOE) Joint Genome Institute (JGI). The constructs for alg3 gene deletion and complementation and heterologous expression of T. reesei Cel7A were prepared by yeast gap repairing method as described by Colot et al. (2006). Briefly, oligo No: 1–6 (Table 1) were used for PCR isolation of about 1 kb DNA fragments of 50 - (oligo 1&2) and 30 - (oligo 5&6) franking regions of alg3 gene from A. niger genomic DNA and the 1.5 kb hygromycin B phosphotransferase (hph) marker gene (oligo 3&4) from vector pCSN44 (Staben et al., 1989). The final alg3D construct with three PCR fragments was fused together into pRS426 by yeast gap repairing. Due to the high homologous replacement efficiency of 1141kusA strain, the alg3D complementation (alg3D + alg3) construct was targeted to trpC locus, where the trpC coding region was interrupted by DNA fragment insertion previously (Chiang et al., 2011). About 1 kb DNA fragments of 50 - (oligo 7&8) and 30 - (oligo 13&14) franking regions of trpC gene from A. niger genomic DNA, 1.6 kb DNA fragment of bleomycin selectable marker gene (oligo 9&10) from pAN8-1 (Punt et al., 1988), and a 2.3 kb genomic DNA fragment of alg3 gene (oligo 11&12), were isolated by PCR. Yeast gap repairing was carried out to fuse them together for alg3D complementation construct. Similarly, the heterologous expression cassette for T. reesei Cel7A gene expression in A. niger was also constructed by yeast gap repairing with 1 kb PCR fragment of A. niger glucoamylase (glaA) promoter (oligo 15&16), 2.9 kb ClaI/StuI plasmid DNA fragment containing the T. reesei Cel7A coding region under the control of A. niger glaA promoter and A. nidulans trpC transcriptional terminator from pFE2-Cel7A (Adney et al., 2009), 1.35 kb PCR fragment of the phleomycin resistant marker gene (ble) (oligo 17&18) from pAN8-1 (Punt et al., 1988), and 0.4 kb PCR fragment of S. cerevisiae cyc1 transcriptional terminator (oligo 19&20), and 1 kb PCR fragment of 30 -franking region of A. niger glucoamylase gene (oligo 21&22). The DNA sequences of the alg3 gene for complementation and T. reesei Cel7A gene for heterologous expression in the pRS426 plasmid DNA vectors were confirmed by DNA sequencing. The homologous replacement of the above three constructs in A. niger genome was carried out by standard polyethylene glycol (PEG)-mediated protoplast transformation.

Table 1 Ligonucleotides used in this study. Oligo no:

Oligonucleotide name

Sequence

1 2 3 4 5 6

5alg3-5F 5alg3-3R hph-5F hph-3R 3alg3-5F 3alg3-3R

Alg3 gene deletion GTAACGCCAGGGTTTTCCCAGTCACGACGTCATAACTTCTCTCCCCTCC ATCCACTTAACGTTACTGAAATCTCCAACTTCATGGACACACACAGACC GGTCTGTGTGTGTCCATGAAGTTGGAGATTTCAGTAACGTTAAGTGGAT GCTACTACTGATCCCTCTGCGTCGGAGACAGAAGATGATATTGAAGGAG CTCCTTCAATATCATCTTCTGTCTCCGACGCAGAGGGATCAGTAGTAGC GCGGATAACAATTTCACACAGGAAACAGCCGTGAGAGGTTTGTAGTACG

7 8 9 10 11 12 13 14

5pyrG5F 5pyrG3R ble5F Ble3R alg3-5F alg3-3R 3pyrG5F 3pyrG3R

Alg3 gene complementation at pryG locus GTAACGCCAGGGTTTTCCCAGTCACGACGTTTAAACATGCATCATTCTCCCGCTTTGT AGAAAGAGTCACCGGTCACGACATCGCCAATCACCTCAATCAC GTGATTGAGGTGATTGGCGATGTCGTGACCGGTGACTCTTTCT ACGTAGACACCTCTTCATCGGCTTCGAGCGTCCCAAAACCT AGGTTTTGGGACGCTCGAAGCCGATGAAGAGGTGTCTACGT TTGATCCTTGTGCCACACCATCGCTAAGCAAGCTGCTGTTGT ACAACAGCAGCTTGCTTAGCGATGGTGTGGCACAAGGATCAA GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACTGTGCCAGTCAATTGTCCGAAGT

15 16 17 18 19 20 21 22

1138CBHI1F 1139CBHI2R 1140CBHI3F 1141CBHI4R 1142CBHI5F 1143CBHI6R 1144CBHI7F 1145CBHI8R

Heterologous expression cel7A at the glaA locus GTAACGCCAGGGTTTTCCCAGTCACGACGTTTAAACGAATTATCGCGTGGGAGGTT TCGTTCGCTCCGAAATTCATC CCAGAATGCACAGGTACACTGCAGGGATCGTGACCGGTGACTCTTTCT TCGGTCAGTCCTGCTCCTGGATCTCAAGCTCCTGGGA TCCCAGGAGCTTGAGATCCAGGAGCAGGACTGACCGA TCCACCATGCATCTCGGCTATTACCATGATTACGCCAAGCTTGCA TGCAAGCTTGGCGTAATCATGGTAATAGCCGAGATGCATGGTGGA GCGGATAACAATTTCACACAGGAAACAGCGTTTAAACGGTTTCGCTGGTATGTCGCA


2.4. Total genomic DNA isolation for PCR and Southern blotting analysis Total genomic DNA was isolated from A. niger according to the SDS extraction method described by Dellaporta et al. with some modifications (Dellaporta et al., 1983). Briefly, 0.1 g dried biomass and two 3.5 mm diameter glass beads were transferred into a 2 mL polypropylene micro-vial, where biomass was pulverized into fine powders with a Mini-Beadbeater-8 (Bio Spec Products Inc., Bartlesville, OK, USA) for one min. Then, further procedures were followed in the detailed description by Dellaporta et al. (1983) with proper amounts of buffers and chemical solutions. Finally, the genomic DNA was re-suspended in 80–100 lL 10 mM Tris–HCl (pH8.0) buffer and quantified with Qubit fluorometer (Invitrogen, Carlsbad, CA, USA). The genomic DNAs were used for genomic DNA PCR and Southern blotting analysis. For Southern blotting analyses of alg3 gene deletion and heterologous expression of T. reesei Cel7A gene, one microgram of total genomics DNA was digested with the restriction endonuclease BamHI and SacII for alg3 gene and HindIII for Cel7A gene. The genomic DNA fragments were separated in 1% agarose gel electrophoretically and transferred onto the zeta-probe membrane (BioRad, Hercules, CA, USA) with alkaline capillary transfer method. The 3.8 kb genomic DNA fragment of A. niger containing the Alg3 or the 1.6 kb ble marker gene fragment was used for preparation of the biotin-labeled probe. The genomic DNA in Zeta-probe membrane was hybridized with the biotin-labeled probe overnight at 60 "C in the Problot Hybridization Oven (Labnet International, Edison, NJ, USA). The genomic DNA on the hybridized membrane was visualized with North2South chemiluminescent detection kit (Pierce Protein Research Products, Rockford, IL) in Koda Imaging Station 2000R (Eastman Kodak Company, Rochester, NY, USA).

123

prepared for each strain and four agar slices per plate were excised. The spores were released by scrapped with plastic loops and vortexed with vortex mixer at top speed for 3 min. The spores were diluted and enumerated with a hemocytometer. The spore production in a unit area (cm2) was determined. The data was the average of 12 spore count events from 12 agar slides. For the spore germination study, 0.5 mL cultures of 1 ! 105 spores with 5 replicates were prepared and added into each well of a 24-well Schwarz sensoplate (Greiner Bio-One, Inc. Monroe, NC, USA) and incubated in the microscopic incubator at 30 "C. After the first 2 h incubation, the specific view areas with about 100–150 spores at a specific location were selected for multipoint capture and the spore germination was automatically imaged hourly for 12 h by the Olympus inverted system microscope (Olympus, Miami, FL, USA). The spore germination was visualized with Adobe Photoshop CSS (Adobe, San Jose, CA, USA) and counted manually. 2.7. Colony diameter measurement The freshly prepared spores of 11414kusA, alg3D, and alg3D + alg3 strains were diluted to the final concentration of 1000 spores per microliter. Five microliters of diluted spores were spotted onto agar plates of CM, CM + 10 mM cAMP, PDA, and MM with six colony replicates in two replicate agar plates. After 15 h initial growth at 30 "C, the colony diameter on the culture plates was measured with a thin transparent plastic millimeter ruler underneath the plate under the stereomicroscope-Leica MZ16 (Leica Microsystem Ltd, Bannockburn, IL, USA) at different intervals from 15 to 35 h of incubation. The percentage of parent strain colony diameter was calculated by dividing the mutant colony diameter with the parental colony diameter and timing 100 at a given time point to determine the effects of alg3 deletion on hyphal growth and the restorative levels of its complementation.

2.5. Total RNA isolation and real-time PCR (qPCR) 2.8. The red pigment measurements The biomass of parent, Alg3D and alg3D + alg3 strains from 18 h liquid cultures (citric acid production medium, Dai et al., 2004) or 48 h CM agar plate cultures was collected and immediately ground to fine powders in a frozen mortar and pestle with liquid nitrogen. The biomass powders in liquid N2 was transferred into 15 mL pre-chilled centrifuge tubes and stored at "70 "C. The total RNAs were isolated with Trizol RNA reagent (Life Technologies, Grand Island, NY, USA). Briefly, about 100 mg of frozen ground biomasses were transferred into chilled microcentrifuge tube and 1 mL Trizol reagent was added onto the sample. The samples were immediately mixed well with the Trizol reagent and incubated at room temperature for 30 min. The manufacturer’ instructions were followed for further RNA purification. Two-step RT-PCR was performed for realtime PCR (qPCR). The total RNA was first reversely transcribed into cDNA with high capacity RNA to cDNA kit (Applied Biosystems, Foster City, CA, USA). The equal amount of cDNA from parent, alg3D, or alg3D + alg3 strains was mixed with TaqMan universal PCR master mix for RT-PCR, which was performed in the 7900HT fast system (Applied Biosystems, Foster City, CA, USA). The threshold cycle (CT) was determined for both alg3 and reference b-tubulin genes in parent, alg3D, and alg3D + alg3 complementation strains. Three replicates were carried out for each strain. 2.6. Spore production and germination After 4 days growth at 30 "C, a piece of PDA or CM agar slice, containing the parental or mutant strain of spore production described above with the same amount of spore inoculation (5 ! 105 spores/plate), was excised with plastic closures of culture tubes in 27 mm diameter and transferred into the 50 mL centrifuge tubes containing 25 mL 0.8% Tween 80. Three replicate plates were

The absorbance of the red pigments in liquid culture filtrates at the wavelength ranging from 230 to 620 nm was determined with the SpectraMax M5 multi-mode microplate reader (Molecular Devices, Sunnyvale, CA, USA), a UV–Visible spectrophotometry in 1 mL quartz cuvette. In order to reduce the protein interference, the filtrates were filtered through 3000 Daltons Amicon Ultra-0.5 centrifugal filter devices (Millipore, Billerica, MA, USA) to remove most of proteins in filtrates. Ten percent of filtrates were mixed with dH2O for absorbance measurement. The actual pigment absorbance in the mutant strain culture filtrates was estimated by subtracting the corresponding absorbance of parent strain culture filtrates. The corresponding data was the average of three replicates with standard errors. 2.9. Protein extraction and digestion for global proteomics analysis using LC–MS/MS The protein extraction and digestion for global proteomics analysis mainly followed the methods described previously (Wang et al., 2012). LC–MS/MS raw data were converted into ‘‘.dta’’ files using Extract_MSn (version 4.0) from Bioworks Cluster 3.2 (Thermo Scientific), and the SEQUEST algorithm (version 27, revision 12) was used to independently search all the MS/MS spectra against the Department of Energy (DOE)-Joint Genome Institute (JGI) A. niger v3.0 protein database that had 11,200 entries. The SEQUEST output files were imported to Microsoft Office Access 2007 filtering. The false discovery rate (FDR) of the identified peptides was estimated based on the decoy-database searching methodology (Elias and Gygi, 2007). Data were filtered using MS-GF spectral probabilities (Kim et al., 2008), score of 61E"9 and peptide

124


mass tolerance of ±10 ppm to achieve final FDR of 0.15 was obtained after comparing the hydrolysis results between T. reesei Cel7A and each of the rCel7A using one-way analysis of variance (ANOVA). As shown previously (Ju et al., 2013), BKP is susceptible to cellulose hydrolysis. Therefore, the difference in glycan content may have little effect on easily hydrolysable cellulosic substrate. When the digestibility of highly crystallized NCC is compared between T. reesei Cel7A and different rCel7As, it is apparent that all three rCel7A variants have improved activity on hydrolyzing this recalcitrant cellulose. The rCel7A from 11414kusA has shown approximately 40% increase in the conversion rate on NCC after 48 h. It is noted that a high standard deviation up to 12% is obtained due the testing conditions used (small volume and low substrate concentration). Based on one-way analysis of variance (ANOVA), a P value