Gastrin Gene Expression Is Required for the ... - Cancer Research

[CANCER RESEARCH56. 41 11—41 15, September 15, 19961

Advances in Brief

Gastrin Gene Expression Is Required for the Proliferation and Tumorigenicity of Human Colon Cancer Cells1 Pomila Singh,2 Azar Owlia, Andrea Varro, Bosong Dai, S. Rajaraman, and T. Wood Departments of Anatomy & Neurosciences (P. 5., A. 0., B. D.], Human Biological Chemistry & Genetics [P. S., 7'. W.J, and Pathology [S. R.] and Sealy Center of Molecular Science [T. W.], The University of Texas Medical Branch, Galveston, Texas 77555-1043, and Department of Physiology, The University of Liverpool, liverpool, United Kingdom [A. V.]

Abstract The majority of human colon cancers express the gastrin gene, and a significant percentage bind gastrin-ilke peptides. However, it is not known if gastrin gene products are physiologically relevant to the growth and

proliferation of human colon cancers. To investigate the functional role of gastrin gene expression, we examined the effect of gastrin antisense (AS) RNA expression on the growth and tumorigenicity of colon cancer cells.

The full-length human gastrin cDNA was cloned in the AS direction in a retroviral vector under the transcriptional control of human cytomegnlo virus promoter. Three representative human colon cancer cell lines that expressed negligible (Colo-205A) to significant (Colo-320 and HCT-116)

glygastrins) exert potent proliferative effects on pancreatic cancer cells (20), fibroblasts, intestinal cells, and colon cancer cells (14, 21, 22). Based on our current understanding, it is thus possible that one or more processing intermediates of gastrin may function as autocrine growth factors for human cancers. In the present study, we tested this possibility for the first time by analyzing the effects of reduced gastrin expression on the proliferation and tumorigenicity of representative human colon cancer cell lines. Materials

and Methods

and subjectedto variousgrowthstudiesin viLroand in vivo.The prolif

Construction of the AS3 Gastrin mRNA Expression Vector. A retrovi rus vector, LNCX (obtained from Dr. Miller, Fred Hutchison Cancer Research

erative and tumorigenic potential of the AS clones from the gastrin

Center, Seattle, WA; Ref. 23), contains an internal human CMV promoter and

expressing cell lines was significantly suppressed compared to that of the control clones, whereas the growth of Colo-205A-AS cells (the negative

matically presented in Fig. 1A.Polyadenylic acid mRNA from a human colon

levels ofgastrln mRNA were transfected with either AS or control vectors

control)

was similar

to that

of the Colo-205A-C-cells,

indicating

the rela

tive specificity of the antitumorigenic effects of AS gastrin RNA expres sion. We believe that this is the first evidence that supports a possible critical

role of gastrin

gene expression

in the tumorigenicity

of human

was used in construction of the gastrin AS vector (LNC-G-AS),

as diagram

cancer cell line, HCT-116, was reverse-transcribed to cDNA. The full-length gastrin cDNA fragment that contained the entire gastrin open reading frame

and 44 bp of the nontranslated 5‘ flank sequence was generated by PCR using the 5' primer HG4 (5'AGGCCCAGCCGTGGCACCACA3') and the AS 3' primer HG5 (5'TGCICTAGCICTCTGAAGCTTGGTF3'), by our published

coloncancersthat expressthe gastringene.Because>60-80%of human coloncancersexpressthe gastringene,it can be expectedthatthe growth methods (13, 14). The PCR product was subcloned into pSP72 vector that ofa significantpercentageof thesecancersmaybe criticallydependenton provided unique restriction sites at the proximal ends of the cDNA (5', CIa!; the expression of gastrin gene products. Therapeutic measures, such as the

3', Stan!). The use of the restriction

AS strategyusedin the presentstudy,maythereforeproveto be usefulin

gastrin cDNA in the LNCX vector in an AS orientation and placed the cDNA under the transcription control of the CMV promoter (Fig. 1A). The LNC G-AS DNA was confirmed by restriction and DNA sequence analysis (24). Transfection of Human Colon Cancer Cell Lines. The human colon cancer cell lines Colo—205A (subcloned in our laboratory from Colo-205;

treating human colon cancers in the future.

Introduction A possible role of gastrins in the etiology of colon cancers is derived from carcinogenesis studies. Endogenous gastrins and exog enous gastrins (other than tetragastrin) promote the growth of estab lished colon cancers in mice (1—4)and promote carcinogen-induced colon cancers in rats (5—7).Recent studies by Montag et a!. (8) further support a possible cocarcinogenic role of gastrin in the initiation of tumors. Because colon cancers express and secrete gastrin gene prod ucts (9—14)and bind gastrin-like peptides (1, 2, 15—18),it is possible that gastrin-like peptides serve as autocrine factors for colon cancers. Recent reports indicate that gastrin gene products are, for the most

part, incompletely processed by colon cancers, and processing inter mediates (glygastrins and progastrmns) are the major forms expressed (9, 12, 14, 19). Whereas in the past COOH-terminal amidation of gastrin-like peptides was considered a prerequisite for measuring biological effects, we now know that nonamidated gastrins (especially Received 5/24/96; accepted 7/24/96.

Thecostsof publicationof thisarticleweredefrayedin partby the paymentof page charges. This article must therefore be hereby marked advertisement in accordance with

18U.S.C.Section1734solelyto indicatethisfact. 1 Supported

by grants

from

the NIH

(CA60087)

and John

Scaly

Memorial

Endowment

Funds (440700). 2 To

whom

requests

for reprints

should

be addressed,

at Departments

of Anatomy

sites ensured

the directional

cloning

of the

American Type Culture Collection), Colo-320 (American Type Culture Col lection), and HCT-116 (obtained from Dr. M. Brattain, Medical College of

Ohio, Toledo, OH) were analyzed for relative concentrations of gastrin mRNA by a quantitative competitive RT-PCR method, using gastrin DNA as an internal control

as described

previously

(13,

14). The Colo-205A

cells

cx

pressed 60-80% of human colon cancers express gastrin mRNA (9—14,28), it can be expected that delivery of gastrin AS RNA expression vectors to the site of the tumor may potentially result in significantly suppressing the growth of gastrin-expressing colon cancers. Colon cancers cx pressing a minimal concentration of gastrin mRNA are not likely to respond to the antitumorigenic effects of gastrin AS RNA expres sion and may perhaps represent a subset of tumors that have developed autocrine mechanisms independent of gasthn gene products.

PG

GG

0.1%

1.0%

GG

1.0%

FCS Fig. 3. Two representative HCT-116-AS (AS2 and AS3) and two representative HCT-l 16-C (C2 and C3) clones were selected for analysis of gastrin-like peptides by RIA, as described in “Materialsand Methods.―Each data point represents fmol/107 cells and is the mean ±SD of four separate observations from two separate clones. Amidated gastrins

References

were not measured in any of the samples (data not shown).

gastrins were not measured in the CE and CM samples of either HCT-l 16-AS or -C clones. The concentrations of progastrins and glygastrins were significantly reduced in the CE samples of AS versus control clones. These results support the conclusion that the antipro liferative effects measured as a result of AS gastrin RNA expression were specific and due to a significant reduction in the concentration of gastrin-like peptides. The proliferation and tumorigenic potential of the Cobo-205A-AS and -C clones was similar (Figs. 2A and B), suggesting that the antiproliferative and antitumorigenic effects of AS expression of gastrin RNA were specific to colon cancer cells expressing significant concentrations ofendogenous gastrin mRNA (Colo-320 and HCT-l16 cells). No nonspecific effects were measured on either the morphol ogy, tumorigenicity (data not shown), or proliferation (Figs. 2A and B) of Colo-205A cells expressing negligible concentrations of endoge nous gastrin mRNA, further confirming the specificity of the effects of AS gastrin RNA expression on only the gastrin-expressing colon cancer cell lines. Summary. Previous studies with anti-gastrin antibodies suggested that gastrins may function as autocrine growth factors for colon cancers (30). Our results confirm that gastrin gene expression may indeed play a physiologically relevant role in the growth of human colon cancer cells that express significant concentrations of gastrin mRNA. In preliminary studies with gastrin AS oligonucleotides (20—23mer), we observed a significant inhibition in the growth of Cobo-320 cells in an MTT assay4. This result led to the present study, confirming the specificity of effects with AS gastrin RNA expression. Because AS gastrin RNA expression was effective in suppressing the tumongenicity of HCT-l16 cells (that were primarily expressing progastrin and glygastrin), an important role of processing interme diates of gastrin in the growth and tumorigenicity of colon cancers is suggested. Potent mitogenic effects of glygastrin on several cell types (20—22)supports the novel concept that the processing intermediates of gastrin may play an important autocrine role in the proliferation of colon cancers that needs to be further examined. An interesting observation was that although the growth suppres sion was almost complete with Cobo-320-AS cells, the proliferative potential of HCT-l16-AS cells was reduced but not arrested, suggest ing that the expression of gastrin AS RNA was perhaps less effective 4 P.

Singh

and

A.

Owlia,

unpublished

1. Singh, P., Walker, J. P., Townsend, C. M., Jr., and Thompson, J. C. Role of gastrin and gastrin receptors on the growth of a transplantable mouse colon carcinoma (MC-26) in BALB/c mice. Cancer Res., 46: 1612—1616,1986. 2. Singh, P., 12, 5., Beauchamp, R. D., Townsend, C. M., Jr., and Thompson J. C. Inhibition ofpentagastrin-stimulated up-regulations of gastrin receptors and growth of

mouse colon tumor (MC-26) in vivo by proglumide, a gastrin receptor antagonist. Cancer Res., 47: 5000—5004,1987.

3. Sumiyoshi,H., Yasui,W., Ochial,A., and Tahara,E. Effectsof gastrinon tumor growth and cyclic nucleotide metabolism in xenotransplantable human gastric and colomc carcinomas in nude mice. Cancer Res., 44: 4276—4280, 1984. 4. Singh, P., Townsend, C. M., Jr., Thompson, J. C., Narayan, S., and Guo, Y. S.

Hormonesincoloncancer:pastandprospectivestudies.CancerJ. (France),3: 28—33, 1990. 5. Williamson, R. C. N., Bauer, F. L. R., Oscarson, J. E. A., Ross, J. S., and Malt, R. A. Promotion of azoxymethane-induced colonic neoplasia by resection of the proximal small bowel. Cancer Rca., 38: 3212—3217, 1978. 6. Karlin, D. A., McBath, M., Jones, R. D., Elwyn, K. D., and Romsdahl, M. M. Hypergastrinemia and colorectal carcinogenesis in the rat. Cancer Left., 29: 73—78,

1985. 7. Lamote, J., and Willems, G. Stimulatory effect of pentagastrin on cancer cell prolif

eration kinetics in chemically induced colon cancers in rats. Regul. Pept., 20: 1—9, 1988.

8. Montag,A. G., Oka,T., Jay, G., and Agarwal,K. Tumorsin hepatobiliarytract and pancreatic islet tissues of transgenic mice harboring gastrin simian virus 40

large tumor antigen fusion gene. Proc. NatI. Acad. Sci. USA, 90: 6696—6700, 1993. 9. Kochman, M. L., DelValle, J., Dickinson, C. J., and Boland, C. R. Post-translation

processing of gastrin in neoplastic human colonic tissues. Biochem. Biophys. Res. Commun., 189: 1165—1169, 1992. 10. Baldwin G. S., and Zhang, Q. X. Measurement of gastrin and transforming growth factor a messenger RNA levels in colonic carcinoma cell lines by quantitative PCR.

Cancer Res., 52: 2261—2267,1992. 11. Finley, G. G., Koski, R. A., Melhem, M. F., Pipas, J. M., and Meisler, A. I. Expression of the gastrin gene in the normal human colon and colorectal adenocar cinoma. Cancer Res., 53: 2919—2926,1993. 12. van Solinge, W. W, Nielsen, F. C., Fills-Hansen, L., Falkmer, U. G., and Rehfeld, J. F. Expression but incomplete maturation of progastrin in colorectal carcinomas.

Gastroenterology, 104: 1099—1 107,1993. 13. Xu, Z., Dai, B., Dhruva, B., and Singh, P. Gastrin gene expression in human colon cancer cells measured by a simple competitive PCR method. Life Sci., 54: 671—678,

1994. 14. Singh, P., Xu, Z., Dai, B., Rajaraman, S., and Dhruva, B. Incomplete processing of progastrin expressed by colon cancer cells: role of non-carboxyamidated gastrin in proliferation. Am. J. Physiol., 266: 459—468,1994. 15. Weinstock, J., and Baldwin, G. Binding of gastrin (17) to human gastric carcinoma cell lines. Cancer Res., 48: 932—937,1988. 16. Watson, S., and Steele, R. Gastrin receptors in GI tumors. In: S. Watson and R. Steele (eds.), Gastrin Receptors in GI Tumors, pp. 1—99.Boca Raton, FL: CRC Press, Inc., 1993. 17. Upp, J. R., Jr., Singh, P., Townsend, C. M., Jr., and Thompson, J. C. The clinical

significance of gastrin receptors in human colon cancers. Cancer Rca., 49: 488—492, 1989.

18. Singh, P., Rae-Venter, B., Townsend, C. M., Jr., Khalil, T., and Thompson, J. C. Gastrin receptors in normal and malignant gastrointestinal mucosa: age-associated changes in gastrmnreceptors. Am. J. Physiol., 249: 761—769,1985. 19. Ciccotosto, C. D., McLeish, A., Hardy, K. J., and Shulkes, A. Expression, processing, and secretion of gastrin in patients with colorectal carcinoma. Gastroenterology, 109: 1142—1153, 1995. 20. Seva, C., Dickinson, C., and Yamada, T. Growth-promoting effects of glycine

extendedprogastrin.Science(WashingtonDC),265:410—412, 1994.

observations.

4114

AS GASTRINRNA EXPRESSIONIS ANTITUMORIGENIC

21. Baldwin, G. S. Binding of progastrin fragments to the 78-kDa gastrin-binding proteins. FEBS Left., 359: 97—100,1995. 22. Singh, P., Owlia, A., Espeijo, R., and Dal, B. Characterization

of novel gastrin

receptors that mediate mitogenic effects of gastrin and glycine-extended gastrin on Swiss 3T3 fibroblasts and intestinal cell lines (IEC-6, CA): absence of CCK-A and CCK-B receptors. J. Biol. Chem., 270: 8429—8438,1995. 23. Miller, A. D., Miller, D. G., Garcia, J. V., and Lynch, C. M. Use of retroviral vectors

for genetransferandexpression.MethodsEnzymol.,217:581—591, 1993. 24. Wood, T. G., Prusak, D. J, Dunn, D. J., Navarro, J., and Prado, G. N. Retroviral mediated expression of an interleukin-8 receptor. In: J. Navarro (ed), Molecular Basis of Inflammation, pp. 217—228.Heidelberg, Germany: Raven Press, 1994.

25. Singh, P., Dai, B., Dhruva, B., and Widen, S. Episomal expression of sense and

antisenseIGF-bindingprotein4cDNAaltersthemitogenicresponseofa humancolon cancer cell line (HT-29) to IGF-I. Cancer Rca., 54: 6563—6570,1994.

4115

26. MacPherson, I., and Montagnier, L. Agar suspension culture for the selective assay of cells transformed by polyoma virus. Virology, 23: 291—294,1964.

27. Varro, A., Voronina, S., and Dockray, G. J. Pathways of processing of the gastrin precursor in rat antral mucosa. J. Chin.Invest., 95: 1642—1650, 1995. 28. Nemeth, J., Taylor, B., Pauwels, S., Varro, A., and Dockray, G. J. Identification of progastrin-derived peptides in colorectal carcinoma extracts. Gut, 34: 90—105, 1992. 29. Singh, P., Dai, B., Yallampalli, C., and Xu, Z. Expression of IGF-ll and IGF-binding proteins by colon cancer cells in relation to their growth response to IGFs. Am. J. Physiol., 267: 608—617, 1994. 30. Hoosein, N. M., Kiener, P. A., Curry, R. C., Rovati, L. C., McGilbra, D. K., and

Brattain, M. G. Antiproliferative effects of gastrin receptor antagonists and antibodies to gastrin on human colon carcinoma 7179—7183, 1988.

cell lines. Cancer

Res., 48: