American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 131B:33 –37 (2004)
Multiple Marker Analysis at the Promoter Region of the DRD4 Gene and ADHD: Evidence of Linkage and Association With the SNP 616 Naomi Lowe, Aiveen Kirley, Celine Mullins, Michael Fitzgerald, Michael Gill, and Ziarih Hawi* Departments of Genetics and Psychiatry, Trinity College, Dublin, Ireland
Abnormalities of dopamine neurotransmission have been hypothesized to play an important role in the pathophysiology of attention deficit hyperactivity disorder (ADHD). Support for this has come from numerous association studies on candidate genes including the dopamine D4 receptor gene (DRD4). One of the most replicated associations between ADHD and the dopaminergic system is the 7-repeat allele of the VNTR polymorphism of this gene. A lack of association between this marker and ADHD has also been reported in several investigations. In the absence of a firm link between the number of the VNTR repeats and the function of the gene, we sought to investigate several additional markers at the 50 end of the gene with potential influence on the expression of the DRD4. We observed a significant over transmission of single nucleotide polymorphism (SNP) (x2 ¼ 7.45, P ¼ 0.008, OR ¼ 1.63). In addition, an excess transmission of the A allele of the 521 SNP was observed, although it did not attain statistical significance (x2 ¼ 2.14, P ¼ 0.17, OR ¼ 1.25). Linkage disequilibrium (LD) analysis demonstrated a weak level of D0 between any of the tested markers implying that this may be a region of high recombination. It also raises the possibility that the new association with ADHD may be independent of the 7-repeat allele. Further analyses, preferably in samples demonstrating association with the VNTR, or in other ethnic groups, are required to confirm these observations. ß 2004 Wiley-Liss, Inc. KEY WORDS:
DRD4; ADHD; SNP; haplotype; LD; TDT INTRODUCTION
Attention deficit hyperactivity disorder (ADHD) is a relatively common and pervasive childhood disorder affecting between 3 and 6% of school aged children worldwide [Tannock,
Abbreviations used: DRD4, dopamine D4 receptor; ADHD, attention deficit hyperactivity disorder; SNP, single nucleotide polymorphism; LD, linkage disequilibrium; TDT, transmission disequilibrium test. Grant sponsor: Health Research Board, Dublin (to NL); Grant sponsor: The Wellcome Trust (to ZH and AK); Grant sponsor: Hyperactive and Attention Disorder (HAD) Group Ireland. *Correspondence to: Ziarih Hawi, Department of Genetics, Trinity College, Dublin 2, Ireland. E-mail:
[email protected] Received 30 October 2003; Accepted 15 April 2004 DOI 10.1002/ajmg.b.30071
ß 2004 Wiley-Liss, Inc.
1998]. Symptoms of this disorder include a combination of inattentive, hyperactive, and impulsive behavior, which persists into adulthood in at least 30% of cases [Mannuzza et al., 2002]. Individuals with ADHD have significant impairment in family and peer relationships and academic functioning [Mannuzza et al., 1993]. In addition, they are at increased risk from drug abuse and excessive risk taking, such as reckless driving [Nada-Raja et al., 1997]. The exact aetiology of ADHD is unknown but it is widely recognized to have a significant genetic component as demonstrated by family [Biederman et al., 1992], twin [Silberg et al., 1996], and adoption [Cadoret and Stewart, 1991] studies. Several studies have implicated the dopaminergic, sertonergic, and noradrenergic systems in the development of this disorder [Hawi et al., 2003], with the dopaminergic system being the most thoroughly explored to date. The most widely used treatment for ADHD is methylphenidate. The site of action of this drug is the dopamine transporter gene (DAT1), where it blocks the reuptake of dopamine from the synaptic cleft. Several animal models for the disorder have been developed [Davids et al., 2003]. These include the DAT1 knockout mouse [Giros et al., 1996], that produces a phenotype displaying features such as hyperactivity, cognitive impairment, and reduced attention that are typical characteristics of ADHD. Further support for the involvement of the dopaminergic system has come from numerous association studies on candidate genes including the dopamine transporter gene (DAT1), the dopamine D5 receptor gene (DRD5), the dopamine D4 receptor gene (DRD4), dopamine beta hydroxylase (DBH), and synaptosomal associated protein of 25 kDa (SNAP-25) [Kirley et al., 2002]. One of the most replicated associations between ADHD and the dopaminergic system is the 7-repeat allele of the variable nucleotide tandem repeat (VNTR) polymorphism of the DRD4 gene [Hawi et al., 2003]. The DRD4 gene (a member of the D2like dopamine receptor family) is mapped to the short arm of chromosome 11 at 11p15.5. It encodes for a seven transmembrane protein that is expressed on postsynaptic neurons of the dopamine system’s pathways. The third exon of the gene contains a VNTR polymorphism of a 48 bp sequence that is mapped to the third intracellular loop of the protein. The 48 bp sequence can be repeated up to ten times, with the four and 7repeat allele being the most common in the Caucasian population [Muglia et al., 2000]. Asghari et al. [1995] reported that the 7-repeat allele of DRD4 mediated a blunted response to dopamine suggesting possible functionality of the polymorphism. LaHoste et al. [1996], reported the first significant association between the 7-repeat allele and ADHD. Since then this finding has been confirmed by at least 11 studies worldwide, however, several other studies have failed to replicate these results [Hawi et al., 2003]. Two recent meta analyses [Faraone et al., 2001; Maher et al., 2002] on this variant resulted in a small but significant overall association (95% CI for OR ¼ 1.5–2.2, 95% CI for OR ¼ 1.20– 1.64) with ADHD, further implicating the DRD4 gene as a gene
34
Lowe et al.
of minor effect for ADHD. The failure of several studies to replicate the association may imply (other than sample size) that the VNTR is not itself the functional variant that contributes risk for the disorder. However, it may indicate the presence of a true causative variant that is closely mapped to the VNTR, with the two being in linkage disequilibrium (LD), which may vary according to population ethnicity. Recent sequence analysis at the 50 end of the DRD4 gene has identified several new polymorphisms in this region [Wong et al., 2000], many of which are believed to affect transcription of the gene. A 521 variant of this promoter region has been shown to alter the transcription of the gene by up to 40% [Okuyama et al., 1999]. In addition, a 120 bp duplication (located 1.2 kb from the gene) and a 616 single nucleotide polymorphism (SNP) have both been hypothesized to affect the levels of transcription of the DRD4 gene but have not yet been examined at a functional level [Seaman et al., 1999; Barr et al., 2001]. An association between the 120 bp duplication and ADHD was first reported by McCracken et al. [2000] when they observed a significant over transmission of the long (240 bp) allele (w2 ¼ 5.40, P ¼ 0.02) to their ADHD cases. A trend towards association with the short allele (120 bp) was observed by Barr et al. [2001], however, Todd et al. [2001] and Mill et al. [2003] failed to replicate either finding. To date, only two association studies have investigated the 616 and the 521 SNPs in relation to ADHD. Barr et al. [2001] reported an excess transmission of the C allele of 616 and the A allele of 521 but neither were deemed to be statistically significant. Mill et al. [2003] also failed to find significant association between these markers and ADHD. We [Hawi et al., 2000] previously reported a lack of association between the VNTR and ADHD in the Irish population. Since then we have refined our previous sample and extended it by 106 trios and 1 duo. The aim of the present study was to examine the VNTR association with ADHD in this updated sample and to investigate additional markers with potential influence on the expression of the DRD4 gene. These markers include the 120 bp duplication located 1.2 kb 50 of the initiation start site and three SNPs located at positions 616, 521, and 376 of the promoter region of the DRD4 gene (Fig. 1). The LD relationship (measured as D0 ) between these markers and the VNTR were also tested. Furthermore, haplotype analysis was conducted to examine for the presence of haplotypes that may contribute to risk of ADHD. MATERIALS AND METHODS As part of ongoing studies on ADHD, 178 families with clinically diagnosed ADHD children were recruited from child clinics and ADHD support groups around Ireland. Clinical and diagnostic details can be found Kirley et al. [2004].
Genotyping DNA was extracted from blood using a standard phenol/ chloroform method or from buccal swabs as described in Gill et al. [1997]. Polymerase chain reaction (PCR) cycling was performed on a MJ Research DNA Engine. Amplification and genotyping of the 120 bp duplication and the VNTR polymorphisms can be found in Seaman et al. [1999] and Hawi et al. [2000], respectively. Genotyping of the 616, 521 and 376 SNPs was performed using the SNaPshot Method of single base extension [Norton et al., 2002]. This involves extending unlabelled primers by a single base using fluorescently tagged ddNTPs. Each of the four bases is labeled with a different colored fluorescent dye that can be detected when run on an ABI Genetic Analyzer (ABI PRISM 377 DNA Sequencer). The genotypes can then be assigned according to the product’s size and the color. A region containing all of the SNPs was amplified using the primers and conditions published by Barr et al. [2001]. Five microliters of the product was then incubated at 378C for 30 min with 1 U of shrimp alkaline phosphatase (SAP) (to degrade the unused dNTPs) and 1 U of ExoI (to digest the unused primers). This was followed by a 15 min incubation at 808C to inactivate the enzymes. Two microliters of this product was used in the SNaPshot reaction with 0.4 ml of the corresponding extension primer (Table I), (at a concentration of 5 pmoles), 1 ml of SNaPshot Reaction Mix, and 1.5 ml of Reaction Buffer (160 mM Tris-HCl, pH 9, 4 mM MgCl2) and 5.1 ml of H2O. The resulting product was treated with SAP as described before and run on 10% polyacrylamide gel on an ABI 377. Assignment of genotypes was performed using ABI Genotyper software version 2.5.1. Statistical Analysis The transmission disequilibrium test (TDT) [Spielman and Ewens, 1996] was performed on each individual marker to test for association between each variant and ADHD. Extended TDT (ETDT) [Sham and Curtis, 1995] was used to analyze the multi-allelic VNTR marker. Linkage disequilibrium (expressed as D0 ) between the studied markers was calculated from parental genotypes using the computer program GOLD (www.well.ox.ac.uk/asthma/GOLD). In addition, TRANSMIT, which tests for the association between a genetic marker and disease by examining the transmission of markers from parents to affected offspring [Clayton and Jones, 1999], was used to analyze multi-marker haplotypes for the presence of associated with ADHD. The data presented in this manuscript has not been corrected for multiple testing. RESULTS The results of the TDT analysis for the individual markers are presented in Table II and the approximate position of the markers indicated in Figure 1. Increased transmission of the 7repeat allele to ADHD cases was observed in the extended and refined sample, although it was not statistically significant (w2 ¼ 1.94, P ¼ 0.198). However, a significant association (w2 ¼ 7.45, P ¼ 0.008), was observed between the C allele of the 616 SNP and ADHD. In addition, an insignificant excess of allele A TABLE I. SNaPshot Extension Primers
Fig. 1. Section of dopamine D4 receptor (DRD4) gene showing location of tested markers and linkage disequilibrium (LD) relationships between them. Markers tested depicted by !, þ1, transcription start site; solid rectangles represent exons 1–3 of the DRD4 gene; striped oval represents transcription mediator (located between 591 and 123); checked oval represents negative modulator (located between 770 and 679). Solid arrows indicate distance in kb. Dashed arrows indicate the LD between markers measured as D0 , *, P ¼ 0.00496, **, P ¼ 0.00047.
SNP 616 521 376
Extension primer sequence TGGTCGCGGGGGCTGAG CTCGCCTCGACCTCGTGCGC CCCGAGGGCCGGGACGCACG
SNP, single nucleotide polymorphism
Base pair change C/G G/A C/T
Multiple Marker Analysis at the Promoter Region of the DRD4 Gene
35
TABLE II. TDT Results of Individual Marker Analysis Marker
T
NT
w2
p value
OR
95% CI
120 bp (long) 616 (C allele) 521 (A allele) 376 (C allele) VNTR (7-repeat)
48 80 94 16 50
46 49 75 12 37
0.04 7.45 2.14 0.14 1.94
0.918 0.008 0.166 0.572 0.198
1.04 1.63 1.25 1.33 1.35
0.70–1.56 1.16–2.38 0.96–1.77 0.63–2.82 0.88–2.07
TDT, transmission disequilibrium test; T, transmitted; NT, not transmitted; OR, odds ratio; CI, confidence interval.
of 521 (w2 ¼ 2.14, P ¼ 0.166) was transmitted to affected offspring. No distortion in the transmission of the alleles at the marker 376 was observed. However, the frequency of the C allele was found to be only 5% in the Irish population. LD analysis between the examined markers (measured as a D0 value) is presented in Table III. Significant evidence (P values) for LD was observed between the markers, 616 and 376, 521 and 376 and 376 and the VNTR. However, little or no evidence of LD was present between any of the other tested markers. These results appeared unusual, as the physical distance between the markers is small. This LD relationship between the 376 and the other markers can be attributed to the low allele frequency of this polymorphism coupled with the high frequency of the other markers. D0 analysis excluding the 376 SNP (Fig. 1) showed significant but very weak LD between the markers 120 bp repeat and the VNTR (D0 ¼ 0.15) and between 616 and 521 (D0 ¼ 0.22). Haplotype analysis between markers revealed a marginal significance between a haplotype constructed of the long allele of the 120 bp duplication and allele C of the 616 SNP and ADHD (w2 ¼ 4.26, P ¼ 0.04). Non-significant increase in the transmission of the 616 and the 521 haplotype (w2 ¼ 2.9, P ¼ 0.089) and the 521 and VNTR haplotype (w2 ¼ 1.9, P ¼ 0.16) to the ADHD individuals was observed. DISCUSSION Genotype distribution in parents showed no significant difference from that expected according to Hardy–Weinberg equilibrium. We observed no association between ADHD and the 7-repeat allele of the VNTR in our newly refined and extended sample (w2 ¼ 1.94, P ¼ 0.198). However, a TDT analysis revealed significant evidence of linkage and association with allele C of the 616 SNP (w2 ¼ 7.45, P ¼ 0.008). In addition, an excess transmission of the A allele of the 521 SNP was observed, although it did not attain statistical significance (w2 ¼ 2.14, P ¼ 0.17). The D4 receptor is known to mediate the postsynaptic action of dopamine. Recent DNA sequence analysis has identified several polymorphisms some of which may affect both the TABLE III. LD Analysis Between Markers Marker 1 120 bp 120 bp 120 bp 120 bp 616 616 616 521 521 376
Marker 2
w2
p value
D0
616 521 376 VNTR 521 376 VNTR 376 VNTR VNTR
0.49 0.00 0.01 12.86 12.22 7.20 5.23 11.57 3.23 31.63
0.48371 0.99956 0.91568 0.00496 0.00047 0.00730 0.15592 0.00067 0.35785 0.00000
0.105 0.000 0.058 0.151 0.215 0.547 0.080 0.714 0.077 0.526
LD, linkage disequilibrium.
transcription of the gene and/or it is affinity to bind dopamine. Asghari et al. [1995] reported an almost twofold blunted response to dopamine of D4 receptors expressing the 7-repeat allele compared to the 2- or 4-repeat alleles. However, Jovanovic et al. [1999] failed to observe a direct relationship between the number of repeats and changes in pharmacological or functional activity. The significant associations between the 7-repeat allele and ADHD [Hawi et al., 2003] may be attributed to the reduction in dopamine response observed by Asghari et al. [1995]. However, the lack of replication of this study [Jovanovic et al., 1999], coupled with the non-significant association studies [Hawi et al., 2003], questions the likelihood that the VNTR is a true functional variant. All this may indicate the presence of a true causative variant that is closely mapped to the VNTR, with the two being in LD. The four additional markers examined in the current investigation have possible functional significance. The 120 bp duplication located 1.2 kb upstream of the transcription start site has been hypothesized to affect the level of transcription of the gene [Seaman et al., 1999] as the repeat is known to contain several transcription factor (TF) binding sites. It is postulated that the long allele (240 bp) may have a different effect on the transcription of the gene than it is short counterpart due to it possessing twice as many TF binding sites. McCracken et al. [2000] reported a significant association between the long allele of the duplication and ADHD. In contrast, Barr et al. [2001] found a trend towards association with the short allele of the repeat. However, the results of this study, in conjunction with, Todd et al. [2001] and Mill et al. [2003], failed to show any distortion in the transmission of either allele of this locus to ADHD cases. The C to G substitution at the 616 SNP results in the introduction of an AP-2 binding site in the promoter region of the DRD4 gene. AP-2 is a sequence specific mammalian TF expressed in neural crest lineages and is regulated by retinoic acid. Structural and functional analysis of DNA binding and transcription activity of the AP-2 protein has shown that these TFs can affect activation and suppression of gene transcription [Williams and Tjian, 1991]. In this study, we observed a highly significant increase in the transmission of the C allele of this variant (w2 ¼ 7.45, P ¼ 0.008). In support of this Barr et al. [2001], also observed a trend towards increased transmission of the same allele (referred to in their paper as the C allele of Ava II) to ADHD cases in a Canadian sample. One possible explanation for the failure of the Barr et al. study to attain significance may be the lack of sufficient power to detect a gene of small or moderate effect especially since their sample consisted of only 82 trios. Mill et al. [2003] also examined this marker in a UK sample and found no significant association with ADHD, however, the transmission and non-transmission data were not provided so it is unknown whether they too observed a non-significant increase in the transmission of one of the alleles. The 521 SNP is located in a region of the promoter mediating the transcription of the DRD4 gene [Wong et al., 2000]. Functional analysis of this marker showed that the A-
36
Lowe et al.
allele reduces transcription levels of the DRD4 gene by up to 40% compared to the G allele [Okuyama et al., 1999] (alleles referred to as T and C [Okuyama et al., 1999]. In addition, the A allele of this variant was reported to be associated with Schizophrenia [Okuyama et al., 1999]. A non-significant excess in the transmission of the A allele of this polymorphism to ADHD cases was reported by Barr et al. [2001] (w2 ¼ 0.818, P ¼ 0.366) (referred to in their paper as allele T of FspI). Similar increase in the transmission of the same allele was also observed in this study (w2 ¼ 2.14, P ¼ 0.166). TDT analysis on our sample combined with the Canadian sample [Barr et al., 2001] enhanced this trend although it did not attain statistical significance (w2 ¼ 2.9, P ¼ 0.098, OR ¼ 1.2). As with the 616 SNP, Mill et al. [2003] reported no association between ADHD and this marker, with no transmission data being provided. The 376 SNP is also located in the transcription mediating region of the DRD4 gene [Wong et al., 2000]. TDT analysis did not reveal any distortion in the transmission of this marker’s alleles to ADHD cases. In addition, the SNP has been shown to be less polymorphic than the others examined, and as a result less informative, with a T allele frequency of only 5% in the Irish population. There was significant but weak LD between the 120 bp duplication and the VNTR (D0 ¼ 0.151), but no evidence of LD between either the 616 or 521 promoter SNPs and the VNTR (Table III). In addition, another weak but significant LD relationship was observed between the 616 and 521 SNPs (D0 ¼ 0.22). As observed, the large differences in the allele frequency between the 376 SNP and the rest of the examined markers, may have resulted in distorted measurement of D0 . However, when the 376 SNP was excluded from the analysis there was no LD between the remainder of the analyzed markers (Fig. 1). Until recently, a linear correlation between physical distance and LD had been postulated. Marker to marker LD analysis conducted by Kendler et al. [1999] on chromosome 5q, 6p, and 8p in the Irish High Density Schizophrenia Pedigrees showed significant LD for 96% of all marker-marker pairing within 0.5 cM. However, this has not been the case in many recently published investigations [Daly et al., 2001]. Instead, a highly variable pattern of LD in which extensive regions of nearly complete LD (up to 840 kb) interspaced with regions where little or no detectable LD can be found [Dawson et al., 2002]. In addition a strong correlation between high LD and low recombination frequency has been observed [Dawson et al., 2002]. The absence of LD between the markers of the promoter region of DRD4 and the VNTR may indicate that this is a region of high recombination. In this context, the association of the VNTR with ADHD observed in several studies may be independent of the association of the C allele of the 616 marker since no LD was detected between the two loci. Using the program TRANSMIT, we performed haplotype analyses (data not presented) between the examined markers. A weak but significant association (w2 ¼ 4.26, P ¼ 0.039) was observed between ADHD and a haplotype composed of the long allele of the 120 bp duplication and the C allele of the 616 SNP. Mill et al. [2003] reported a significant but weak association with a haplotype consisting of these two alleles and allele C of the 521. Barr et al. [2001] reported no significant distortion in the transmission of any haplotype consisting of alleles from the markers 50 to the DRD4 gene. However, the addition of the VNTR into their analysis resulted in a significant association with ADHD of a haplotype composed of the long allele of the 120 bp duplication, the C allele of the 616 marker, the A allele of the 521 and the 7repeat of the VNTR. This association was not detected in our sample. The lack of DRD4 haplotype association with ADHD is not surprising given the low LD relationships between the studied markers.
It remains a possibility, that the discrepancy of our VNTR results with others may be due to a mismatching of diagnostic methods, a lack of sample power to detect association or linkage or the presence or absence of a positive family history. It has been reported that ADHD co-morbid with conduct disorder results in a clinically more severe condition with worse outcome than ADHD alone [Barkley et al., 1990]. Furthermore, TDT analysis on ADHD trios that yielded no association with the 7-repeat allele of the VNTR has shown evidence of association with ADHD co-morbid with conduct problems [Holmes et al., 2002]. These clinical and diagnostic issues are addressed directly in relation to our sample in Kirley et al. [2004]. In addition, the complexity of the DRD4 VNTR itself should be noted. All of the association studies to date have deduced genotype using only the PCR length of the amplicon. However, sequencing studies have revealed heterogeneity within the 7-repeat itself and it has been proposed that this allelic heterogeneity may also be contributing to the association of this locus [Grady et al., 2003]. In conclusion, the results of the current investigation shows that the association between the 616 SNP and ADHD is independent of those reported with the VNTR. However, this finding needs to be further examined, preferably in samples that already show significant association with the VNTR. ACKNOWLEDGMENTS We thank the families that participated in the study and recognize the support of the HRB and The Wellcome Trust. REFERENCES Asghari V, Sanyal S, Buchwaldt S, Paterson A, Jovanovic V, Van Tol HH. 1995. Modulation of intracellular cyclic AMP levels by different human dopamine D4 receptor variants. J Neurochem 65:1157–1165. Barkley RA, Fischer M, Edelbrock CS, Smallish L. 1990. The adolescent outcome of hyperactive children diagnosed by research criteria: I. An 8year prospective follow-up study. J Am Acad Child Adolesc Psychiatry 29:546–557. Barr CL, Feng Y, Wigg KG, Schachar R, Tannock R, Roberts W, Malone M, Kennedy JL. 2001. 50 -Untranslated region of the dopamine D4 receptor gene and attention-deficit hyperactivity disorder. Am J Med Genet 105: 84–90. Biederman J, Farone SV, Keenam K, Benjamin J, Krifcher B, Moore C. 1992. Further evidence for family-genetic risk factors in attention deficit hyperactivity disorder. Patterns of comorbidity in probands and relatives psychiatrically and pediatrically referred samples. Arch Gen Psychiatry 49:728–738. Cadoret RJ, Stewart MA. 1991. An adoption study of ADHD and aggression and their relationship to adult antisocial personality. Compr Psychiatry 32:73–82. Clayton D, Jones H. 1999. Transmission/disequilibrium tests for extended marker haplotypes. Am J Hum Genet 65:1161–1169. Daly MJ, Rioux JD, Schaffner SF, Hudson TJ, Lander ES. 2001. Highresolution haplotype structure in the human genome. Nat Genet 29: 229–232. Davids E, Zhang K, Tarazi FI, Baldessarini RJ. 2003. Animal models of attention-deficit hyperactivity disorder. Brain Res Brain Res Rev 42:1–21. Dawson E, Abecasis GR, Bumpstead S, Chen Y, Hunt S, Beare DM, Pabial J, Dibling T, Tinsley E, Kirby S, Carter D, Papaspyridonos M, Livingstone S, Ganske R, Lohmussaar E, Zernant J, Tonisson N, Remm M, Magi R, Puurand T, Vilo J, Kurg A, Rice K, Deloukas P, Mott R, Metspalu A, Bentley DR, Cardon LR, Dunham I. 2002. A first-generation linkage disequilibrium map of human chromosome 22. Nature 418:544–548. Faraone SV, Doyle AE, Mick E, Biederman J. 2001. Meta-analysis of the association between the 7-repeat allele of the dopamine D(4) receptor gene and attention deficit hyperactivity disorder. Am J Psychiatry 158: 1052–1057. Gill M, Daly G, Heron S, Hawi Z, Fitzgerald M. 1997. Confirmation of association between attention deficit hyperactivity disorder and a dopamine transporter polymorphism. Mol Psychiatry 2:311–313.
Multiple Marker Analysis at the Promoter Region of the DRD4 Gene Giros B, Jaber M, Jones SR, Wightman RM, Caron MG. 1996. Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature 379:606–612. Grady DL, Chi HC, Ding YC, Smith M, Wang E, Schuck S, Flodman P, Spence MA, Swanson JM, Moyzis RK. 2003. High prevalence of rare dopamine receptor D4 alleles in children diagnosed with attentiondeficit hyperactivity disorder. Mol Psychiatry 8:536–545. Hawi Z, McCarron M, Kirley A, Daly G, Fitzgerald M, Gill M, Genet XX. 2000. No association of the dopamine DRD4 receptor (DRD4) gene polymorphism with attention deficit hyperactivity disorder (ADHD) in the Irish population. Am J Med 96:268–272.
37
McCracken JT, Smalley SL, McGough JJ, Crawford L, Del’Homme M, Cantor RM, Liu A, Nelson SF. 2000. Evidence for linkage of a tandem duplication polymorphism upstream of the dopamine D4 receptor gene (DRD4) with attention deficit hyperactivity disorder (ADHD). Mol Psychiatry 5:531–536. Mill J, Fisher N, Curran S, Richards S, Taylor E, Asherson P. 2003. Polymorphisms in the dopamine D4 receptor gene and attention-deficit hyperactivity disorder. Neuroreport 14:1463–1466. Muglia P, Jain U, Macciardi F, Kennedy JL. 2000. Adult attention deficit hyperactivity disorder and the dopamine D4 receptor gene. Am J Med Genet 96:273–277.
Hawi Z, Kirley A, Lowe N, Fitzgerald M, Gill M. 2003. Recent genetic advances in ADHD and diagnostic and therapeutic prospects. Expert Rev Neurotherapeutics 3:453–464.
Nada-Raja S, Langley JD, McGee R, Williams SM, Begg DJ, Reeder AI. 1997. Inattentive and hyperactive behaviors and driving offenses in adolescence. J Am Acad Child Adolesc Psychiatry 36:515–522.
Holmes J, Payton A, Barrett J, Harrington R, McGuffin P, Owen M, Ollier W, Worthington J, Gill M, Kirley A, Hawi Z, Fitzgerald M, Asherson P, Curran S, Mill J, Gould A, Taylor E, Kent L, Craddock N, Thapar A. 2002. Association of DRD4 in children with ADHD and comorbid conduct problems. Am J Med Genet 114:150–153.
Norton N, Williams NM, Williams HJ, Spurlock G, Kirov G, Morris DW, Hoogendoorn B, Owen MJ, O’Donovan MC. 2002. Universal, robust, highly quantitative SNP allele frequency measurement in DNA pools. Hum Genet 110:471–478.
Jovanovic V, Guan HC, Van Tol HH. 1999. Comparative pharmacological and functional analysis of the human dopamine D4.2 and D4.10 receptor variants. Pharmacogenetics 9:561–568. Kendler KS, MacLean CJ, Ma Y, O’Neill FA, Walsh D, Straub RE. 1999. Marker-to-marker linkage disequilibrium on chromosomes 5q, 6p, and 8p in Irish high-density schizophrenia pedigrees. Am J Med Genet 88: 29–33. Kirley A, Hawi Z, Daly G, McCarron M, Mullins C, Millar N, Waldman I, Fitzgerald M, Gill M. 2002. Dopaminergic system genes in ADHD: Toward a biological hypothesis. Neuropsychopharmacology 27:607– 619. Kirley A, Lowe N, Mullins C, McCarron M, Daly G, Waldman I, Fitzgerald M, Gill M, Hawi Z. 2004. Phenotype Studies of the DRD4 gene polymorphisms in ADHD: Association with Oppositional Defiant Disorder and Positive Family History. Am J Med Genet (this volume).
Okuyama Y, Ishiguro H, Toru M, Arinami T. 1999. A genetic polymorphism in the promoter region of DRD4 associated with expression and schizophrenia. Biochem Biophys Res Commun 258:292–295. Seaman MI, Fisher JB, Chang F, Kidd KK. 1999. Tandem duplication polymorphism upstream of the dopamine D4 receptor gene (DRD4). Am J Med Genet 88:705–709. Sham PC, Curtis D. 1995. An extended transmission/disequilibrium test (TDT) for multi-allele marker loci. Ann Hum Genet 59:323–336. Silberg J, Rutter M, Meyer J, Maes H, Hewitt J, Simonoff E, Pickles A, Loeber R, Eaves L. 1996. Genetic and environmental influence on the covariation between hyperactivity and conduct disturbance in juvenile twins. J Child Psychol Psychiatry 37:803–816. Spielman RS, Ewens WJ. 1996. The TDT and other family-based tests for linkage disequilibrium and association. Am J Hum Genet 59: 983–989.
LaHoste GJ, Swanson JM, Wigal SB, Glabe C, Wigal T, King N, Kennedy JL. 1996. Dopamine D4 receptor gene polymorphism is associated with attention deficit hyperactivity disorder. Mol Psychiatry 1:121–124.
Tannock R. 1998. Attention deficit hyperactivity disorder: Advances in cognitive, neurobiological, and genetic research. J Child Psychol Psychiatry 39(1):65–99.
Maher BS, Marazita ML, Ferrell RE, Vanyukov MM. 2002. Dopamine system genes and attention deficit hyperactivity disorder: A metaanalysis. Psychiatr Genet 12:207–215.
Todd RD, Neuman RJ, Lobos EA, Jong YJ, Reich W, Heath AC. 2001. Lack of association of dopamine D4 receptor gene polymorphisms with ADHD subtypes in a population sample of twins. Am J Med Genet 105:432–438.
Mannuzza S, Klein RG, Bessler A, Malloy P, LaPadula M. 1993. Adult outcome of hyperactive boys. Educational achievement, occupational rank, and psychiatric status. Arch Gen Psychiatry 50:565–576. Mannuzza S, Klein RG, Klein DF, Bessler A, Shrout P. 2002. Accuracy of adult recall of childhood attention deficit hyperactivity disorder. Am J Psychiatry 159:1882–1888.
Williams T, Tjian R. 1991. Analysis of the DNA-binding and activation properties of the human transcription factor AP-2. Genes Dev 5: 670–682. Wong AH, Buckle CE, Van Tol HH. 2000. Polymorphisms in dopamine receptors: What do they tell us? Eur J Pharmacol 410:183–203.
