Generation of marinerbased transposon insertion mutant library of ...

RESEARCH LETTER

Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis Yiming Wu1,2, Xiaomin Hu1, Yong Ge1, Dasheng Zheng1 & Zhiming Yuan1 1

Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China; and Graduate School of the Chinese Academy of Sciences, Beijing, China

2

Correspondence: Zhiming Yuan, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China. Tel.: +86 27 87197242; fax: +86 27 87198120; e-mail: [email protected] Received 15 January 2012; revised 1 March 2012; accepted 1 March 2012. Final version published online 2 April 2012. DOI: 10.1111/j.1574-6968.2012.02539.x

MICROBIOLOGY LETTERS

Editor: Ezio Ricca Keywords Bacillus sphaericus; sporulation; transposon insertion; crystal proteins synthesis.

Abstract Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation.

Introduction Bacillus sphaericus is a Gram-positive, spore-forming aerobic bacterium (Charles et al., 1996). A number of highly toxic strains of B. sphaericus can synthesize two crystalline mosquito-larvicidal proteins of 42 kDa (BinA) and 51 kDa (BinB) during sporulation (Baumann et al., 1985). The two proteins act together to function as a binary toxin (Broadwell et al., 1990). Bacillus sphaericus is considered one of the most successful microbial larvicide and has been commercialized over the past decade (Berry, 2011). Besides being an important bio-insecticide for mosquito control, B. sphaericus has several important phenotypic properties, including being incapable of polysaccharide utilization and having exclusive metabolic pathways for a wide variety of organic compounds and amino acids (Russell et al., 1989; Han et al., 2007). FEMS Microbiol Lett 330 (2012) 105–112

Bacillus species undergo dramatic morphological, physiological and biochemical changes during sporulation and these changes have been studied in great detail in Bacillus subtilis (Hilbert & Piggot, 2004). In response to starvation, B. subtilis initiates a developmental process by forming an asymmetric septation that divides the bacterium into two asymmetric compartments, the mother cell and forespore. The smaller, forespore compartment develops into the spore, whereas the larger mother cell nurtures the developing forespore. Initially, the forespore and mother cell lie side by side; subsequently, the mother cell engulfs the forespore in a phagocytosis-like process. The engulfed forespore exists as a free-floating protoplast within the mother cell and is enveloped by two membranes, the peptidoglycan cortex layer and the protein coat layer. Ultimately, the spore is released into the environment by lysis of the mother cell. ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Y. Wu et al.

106

Due to the considerable interest in the use of B. sphaericus as a biological mosquitocidal, numerous studies have been carried out to investigate the mosquitocidal proteins produced by this bacterium. The main mosquitocidal binary toxin is synthesized during sporulation (Broadwell & Baumann, 1986). Although various asporogenous mutants of B. sphaericus have been isolated in the past, little is known about the genes involved in the sporulation pathway of this organism (Charles et al., 1988). Notably, El-Bendary et al. (2005) identified two genes involved in sporulation, spo0A and spoIIAC, which might control expression of the binary toxin genes. Identification and characterization of other genes involved in the sporulation pathway to manipulation of the production of the binary toxin crystal protein will help clarify the sporulation process further. One useful approach to identifying sporulation-associated genes is transposon-mediated insertional mutagenesis. A number of transposon mutagenesis systems have been described for Bacillus species, such as Tn917, Tn10 and mariner (Youngman et al., 1983; Steinmetz & Richter, 1994; Le Breton et al., 2006). With the exception of mariner, the transposons Tn917 and Tn10 have been found either to have a strong target site preference or to yield multiple insertions in individual clones (Youngman et al., 1983; Pribil & Haniford, 2003). The marinertransposable element Himar1 has been shown to insert randomly into the genomes of many bacterial species, including Bacillus (Le Breton et al., 2006; Maier et al., 2006; Cao et al., 2007; Cartman & Minton, 2010). Furthermore, the cognate Himar1 transposase is the only factor required for transposition, which occurs via a cutand-paste mechanism. The transposon itself is defined by inverted terminal repeats at either end and inserts into a TA dinucleotide target site (Lampe et al., 1996; Vos et al., 1996). This is highly appropriate for an organism with low-GC content strains such as B. sphaericus. Based on these findings, we reasoned that a mariner-based transposon mutagenesis system would be an effective tool for generating libraries of random B. sphaericus mutants. In this study, our aim was to isolate sporulationdefective mutants to provide a convenient method to better understand the relationship between sporulation and crystal protein syntheses in B. sphaericus. A random transposition mutant library using a mariner-based transposition delivery system was successfully constructed for the first time. The flanking sequences surrounding the mariner transposon were cloned and sequenced and the candidate genes involved in sporulation were identified. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. The results ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

indicated that crystal protein synthesis is dependent on initiation of sporulation in B. sphaericus.

Materials and methods Bacterial strains, plasmids and growth conditions

The bacterial strains and plasmids used in this study are detailed in Table 1. Bacillus sphaericus strain 2297 was used to construct the library of insertional mutants. Escherichia coli DH5a was used as host for the construction of plasmids and cloning experiments. Bacillus sphaericus was transformed by electroporation as described by Li et al. (2000) and cells were grown in Luria–Bertani (LB) broth or MBS broth (Kalfon et al., 1984), which contains (g L 1): MgSO4·7H2O, 0.3; MnSO4, 0.02; Fe2(SO4)3, 0.02; ZnSO4·7H2O, 0.2; CaCl2, 0.2; tryptose, 10; yeast extract, 2; the pH was adjusted to 7.4 and incubation was usually carried out at 30 °C; E. coli strains were grown in LB medium at 37 °C. Antibiotics used for bacterial selection included (lg mL 1): 100 ampicillin (Amp) or 100 spectinomycin (Spc) for E. coli and 200 spectinomycin, or 25 erythromycin (Erm) or 50 kanamycin (Kan) for B. sphaericus. For solid medium, agar was added to a final concentration of 1.5% (w/v). Transposon insertional mutagenesis

The mariner-based transposon pMarB333 (Li et al., 2009) was transformed into B. sphaericus strain 2297 and the transformants were selected on LB broth agar containing 200 lg mL 1 Spc and 25 lg mL 1 Erm at 30 °C. After verifying the transformants by PCR, isolated transformants containing pMarB333 were cultured in LB for 6–8 h at 30 °C, and then appropriately diluted cultures were spread on LB agar containing 200 lg mL 1 Spc at 42 °C (a nonpermissive temperature for the plasmid replication) for 24 h. Clones displaying SpcR ErmS were selected as mutants. Identification of sites of transposon insertion

The chromosomal DNA of the mutants was digested with HindIII (the restriction site that is absent in mariner transposon) and the digested genomic DNA was religated. As the mariner transposon has an E. coli origin of replication, the ligation mixture was used to transform E. coli DH5a, and spectinomycin-resistant transformants were selected. Plasmid DNA was prepared from the transformants and the restriction map of the plasmid was determined to verify the presence of mariner transposon (a 2.2-kb BamHI fragment is characteristic of mariner FEMS Microbiol Lett 330 (2012) 105–112

107

Transposon mutagenesis for sporulation gene investigation

Table 1. Strains and plasmids Strains or plasmid

Genotypes or properties

Sources or reference

Strains Bacillus sphaericus 2297

Wild-type strain

Wickremesinghe & Mendis (1980) This study This study This study This study This study This study This study Sambrook et al. (1989)

B. sphaericus MC06 B. sphaericus MD20 B. sphaericus MB41 B. sphaericus MN49 B. sphaericus MQ43 B. sphaericus MP64 B. sphaericus MC78 Escherichia coli DH5a Plasmid pMarB333

Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 Sporulation-defective derivative of 2297 SupE44DlacU169 (φ80 lacZDMA15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Thermosensitive Gram-positive origin of replication, mariner transposon containing a ColE1 origin replication and Himar1 transposase gene, ermR and spcR

Li et al. (2009)

spcR, spectinomycin resistance; ermR, erthromycin resistance.

transposon). DNA flanking the mariner transposon element was sequenced from plasmid DNA with primer MarB333 (5′AAAGCGTCCTCTTGTGAAAT3′). The flanking DNA sequences of mariner transposon insertion were compared with the GenBank database using the BLASTX, BLASTP or PSI-BLAST tools available online at the National Center for Biotechnology Information (NCBI; Ye et al., 2006). Southern blot analysis was performed using a DIG High Prime DNA labeling and detection starter kit (Roche, Indianapolis, IN).

with sterile water and then centrifuged. The pellet was resuspended in protein loading buffer and boiled for 10 min. The soluble proteins were electrophoresed in 12% acrylamide resolving gels prior to visualization by straining with Coomassie blue. Western blot analysis was performed as described by El-Bendary et al. (2005). Bioassays

About 1200 colonies of mutants were toothpicked on MBS plates and incubated at 30 °C for 72 h. The mutant manifested as pale translucent colonies and were selected (Isezaki et al., 2001) and further examined by observation with a phase-contract microscope. The strains that did not exhibit the bright mature spores were defined as sporulation-defective mutants (Holt et al., 1975).

The toxicities of B. sphaericus 2297 and mutants against fourth instar larvae of a susceptible Culex quinquefasciatus colony were assayed by bioassay, performed as described by Yang et al. (2007). At least five concentrations giving a mortality between 2% and 98% were tested, and mortality was recorded after incubation at 26 °C for 48 h. Bioassays were performed in three duplicates, and the tests were replicated on three different days. Lethal concentrations of 50% and 90% were determined by Probit analysis (Finney, 1971) with a program indicating mean and standard error (SE).

Electron microscopy

Results

Sporulation was induced by nutrient exhaustion in MBS broth at 30 °C for 72 h, and cells were fixed and embedded in Epon812 resin and subjected to ultrathin sectioning. Thin-section electron microscopy was performed as described previously (Yousten & Davidson, 1982).

Construction of the mariner-based insertion library

Isolation of sporulation-defective mutants

SDS-PAGE and Western blot

Bacillus sphaericus cultures were grown in MBS medium for 72 h at 30 °C. Cells were harvested and washed twice FEMS Microbiol Lett 330 (2012) 105–112

A library of random mariner-based transposon insertion mutations of B. sphaericus strains 2297 was constructed by the method as described previously. To analyze the randomness of the transposon insertion sites, the transposon flanking DNA of 104 randomly selected mutants were sequenced, and 27 of 104 mutants were further analyzed by Southern blotting. The results showed that ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Y. Wu et al.

108

transposon insertions occurred at a TA dinucleotide target site and were distributed randomly over the entire genome of B. sphaericus 2297, with no target site preference (Fig. 1). Moreover, 87 of the 104 transposon insertions (83.7%) were inserted within protein coding sequences (CDS). Southern blotting revealed that most of the 27 tested mutants had a single transposon insertion, but two mutants were found to have a double insertion (Fig. 2). Collectively, these data provide good evidence that our insertion mutant library is random and representative. Isolation and characterization of sporulationdefective mutants

Seven sporulation-defective mutants were obtained from approximately 1200 colonies. These mutants could be divided into two classes based on the stage of sporulation reached: (1) completely asporogenous mutants exhibiting vegetative cell morphology; and (2) mutants able to form a pre-spore but incapable of developing the phase-brightness associated with mature spores. Transposon flanking DNA sequencing revealed that mariner transposon insertion sites were located within the following genes: MC06 (degU); MD20 (spoIIE); MB41 (ykwC); MN49 (kinA) and MP64 (spoVT), and also located

1 2

3

16 17 18

4

5

6

7

8

9 10 11 12 13 14 15

19 20 21 22 23 24

25 26 27 28

Fig. 2. Southern blot hybridization analysis of mariner-based transposon insertions in mutants of Bacillus sphaericus strain 2297. Lane 1, wild-type strain 2297, lanes 2–28, mariner insertion mutants B. sphaericus strain 2297. Genomic DNA samples were digested with HindIII and hybridized with probe of spectinomycin gene within the mariner transposon.

upstream of the gene in MC78 (yabP) and MQ43 (gene encoding spermidine acetyltransferase, here named speA) (Fig. 3). Morphology of sporulation-defective mutants

The effect of transposon insertion on spore morphology of sporulation-defective mutants was examined by thinsection microscopic analysis after 48 h of sporulation. Mutants MC06, MD20, MB41 and MN49 were completely asporogenous and crystal inclusion was absent, indicating that they were blocked at the early stages of sporulation and failed to form binary toxin crystal proteins (Fig. 4a–d). However, some cells of MD20 could form asymmetric septum at one pole (Fig. 4b), indicating initiation of sporulation. In contrast, mutants MC78, MQ43 and MP64 were blocked at the later stages of sporulation. They could form spore-like structures and produced crystal inclusion. Electron microscopy showed that the cortices and coats of the wild-type spores were well arranged, and the dark-staining spore core could be observed (Fig. 4e). Whereas the MQ43 and MC78 spores exhibited fuzzy cortexes, no spore coat could be formed and the spore core could not be well compacted (Fig. 4f and g). Mutant MP64 completed the engulfment and formed normal forespores but exhibited a deformed ovoidal sporangium with a narrow cortical layer external to the inner forespore membrane (Fig. 4h). Crystal protein synthesis and larvicidal activity

Fig. 1. Genetic map of mariner-based transposon insertions of Bacillus sphaericus strain 2297 related mutants. The flanking sequences of 104 independent transposon insertion mutants were sequenced. Insertions in the plus and minus orientation are marked on the exterior and interior of the circles, respectively. Lines indicate the locations of transposon insertions.

ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

SDS-PAGE analysis showed that the mutants that were blocked at later stages of sporulation synthesized two crystalline mosquito-larvicidal proteins of 51 kDa (BinB) and 42 kDa (BinA) during sporulation, similar to the wild-type strain, whereas no binary toxin could be detected in asporogenous mutants blocked at early stages FEMS Microbiol Lett 330 (2012) 105–112

109


(a)

1232402

1227814 yvyE

(b)

degS

degU

1386707

orf_1299 orf_1300

88277

93313

orf_0083 orf_0084

(d)

spoIIE

orf_1289

84028

kinA

orf_1291 orf_1292

87142 orf_0079 yabP orf_0081 orf_0082

77952

82245 orf_0102

(g)

orf_0087 1385055

orf_0078

(f)

orf_0086

1377934 orf_1288

(e)

orf_1145

1389262

orf_1296 orf_1297 ykwC

(c)

orf_1144

676687

spoVT 679400

orf_0658

speA

orf_0660 orf_0661

Fig. 3. Physical maps of transposon insertion sites in mutants of Bacillus sphaericus strain 2297. (a) MC06; (b) MB41; (c) MD20; (d) MN49; (e) MC78; (f) MP64; (g) MQ43. Coding regions are represented as horizontal arrows, corresponding to the exact region in genome and name of genes. The mariner transposon insertion sites in mutants are represented by an inverted triangle.

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Fig. 4. Thin-section electron micrographs of spores in Bacillus sphaericus strain 2297 and related mutants. (a) MC06; (b) MB41; (c) MD20; (d) MN49; (e) 2297 (wild type); (f) MC78; (g) MP64; (h) MQ43. Bars: 1 lm.

(Fig. 5a). Although no binary toxin could be detected in the mutants MD20, MB41 or MN49 by SDS-PAGE, immunoblotting showed that Bin proteins might be expressed in very low quantities (Fig. 5b). Bioassay results against fourth instar larvae showed that mutants blocked at early stages of sporulation (MC06, MD20, MB41 and MN49), in which no visible crystal could be detected, retained limited toxicity at a much lower level than the wild type (Table 2). This toxicity presumably results from the mosquitocidal toxins (Mtxs) produced during the vegetative growth stage (El-Bendary et al., 2005). However, mutant MD20, which could form septum, had much higher toxicity than MC06, MB41 and MN49, and was only 50-fold less toxic than wild type. FEMS Microbiol Lett 330 (2012) 105–112

Therefore, it is likely that MD20 produces a small quantity of Bin crystal protein (Table 2). Mutants blocked at the later stages of sporulation (MQ43, MP64 and MC78) were able to form crystals and had a high toxicity comparable to that of the wild type (Table 2).

Discussion Bacillus sphaericus can produce the main mosquitocidal protein binary toxin during sporulation. Although various sporulation-defective mutants of B. sphaericus have been isolated by chemical mutagenesis approaches (Charles et al., 1988), the exact genes involved in sporulation have not been identified experimentally. Thus, a random ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Y. Wu et al.

110

(a)

MC06 MD20 MB41 MN49 MQ43 MP64 MC78 W.T

KDa

116.0 66.2 45.0 35.0

BinB BinA

25.0 18.4 14.4 (b)

MC06 MD20 MB41 MN49 MQ43 MP64 MC78 W.T

Fig. 5. SDS-PAGE and Western blot analysis of binary toxin proteins (BinA and BinB) synthesis in Bacillus sphaericus strain 2297 and related mutants. (a) SDS-PAGE analysis. (b) Western blot analysis.

Strain

LC50* (95% CL)†

2297 MC06 MD20 MB41 MN49 MQ43 MP64 MC78

0.379 248.149 20.086 91.780 92.489 0.503 0.396 0.461

(0.2888 > LC < 0.522)† (201.708 < LC < 300.644) (13.009 < LC < 127.631) (72.614 < LC < 116.377) (59.933 < LC < 145.024) (0.388 < LC < 0.672) (0.131 < LC < 0.833) (0.288 < LC < 0.672)

Table 2. Larvicidal activity of Bacillus sphaericus 2297 and related mutants

LC90* (95% CL) 3.334 977.361 260.823 735.392 676.948 5.332 3.437 16.592

(1.928 < LC < 7.791) (714.077 < LC < 1611.365) (165.405 < LC < 534.736) (481.798 < LC < 1362.897) (349.742 < LC < 2566.215) (3.091 < LC < 12.420) (1.333 < LC < 282.946) (7.021 < LC < 85.603)

*LC50 and LC90, volume (in lL) of cultures of B. sphaericus 2297 and related mutants. 95% CL, 95% confidence limit.

†

mutant library was constructed using the mariner-based transposon mutagenesis method and mutants were screened for sporulation-defective phenotypes. The data presented in this paper demonstrate that the marinerbased transposon system works effectively in B. sphaericus. The aim of this study was to identify genes associated with sporulation and Bin protein synthesis. We identified seven sporulation-defective mutants using a genome-wide mutagenesis approach. The insertion sites of mariner transposon were identified and the nucleotide sequences of the flanking DNA regions were determined to identify the genes associated with these mutants. The protein products of spoIIE, kinA and spoVT have already been identified to play a role in the sporulation process of B. subtilis: SpoIIE governs the phosphorylation state of a protein regulating transcription factor sigma F during sporulation (Arigoni et al., 1996); KinA is the primary kinase for initiation of sporulation (Perego et al., 1989); and SpoVT regulates forespore-specific sigma factor ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

G-dependent genes and plays a key role in the final stages of spore formation (Bagyan et al., 1996). In addition, we have now identified degU, ykwC, yabP and speA as genes which are likely to play a role in the sporulation process. Although the locations of transposon insertion sites were upstream of yabP and speA in MQ43 and MC78, it may be that they disrupted the structure of their promoters and thus affected transcription of these genes, resulting in the sporulation-defective phenotypes observed. Ultrastructural studies and protein analysis of mutants confirmed that the synthesis of Bin proteins is dependent on the initiation of sporulation. The crystal proteins become visible in sporulating cells immediately following septum formation at about stage III of sporulation in B. sphaericus (Yousten & Davidson, 1982). Mutants which are blocked early in the sporulation process show deficiencies in crystal proteins synthesis (Charles et al., 1988). Similarly, mutant MC06, which blocked early, failed to produce crystal proteins and had an extremely low FEMS Microbiol Lett 330 (2012) 105–112


larvicidal activity. However, small quantities of Bin proteins in MD20, MB41 and MN49 could be detected by immunoblotting, suggesting that the binAB operon could be transcribed at low levels by RNA polymerase present during the vegetative stage or early stages of sporulation. LacZ fusion assays have shown that transcription of the crystal proteins gene fusion begin immediately before the end of exponential growth (Ahmed et al., 1995). In agreement with this, mutant MD20, which is blocked in sporulation following formation of an asymmetric septum, exhibited greater mosquitocidal activity than did MC06, MB41 and MN49. Furthermore, mutants MQ43, MP64 and MC78, which are blocked much later in the sporulation process, retained the ability to produce crystal proteins and were as toxic to mosquito larvae as the wild-type strain. The transposon insertion mutant library and the methods for screening sporulation-defective mutants reported here could be used to determine more candidate genes involved in sporulation in B. sphaericus. Further studies are required to better elucidate the role of the identified genes involving sporulation and Bin proteins synthesis.

Acknowledgements We are grateful to Dr Simon Rayner for critical reading of the manuscript, and Mr Quanxin Cai for his technical assistance and rearing the mosquito larvae. This project was supported by an NFSC grant (30800002) and a 973 grant (2009CB118902), China.

References Ahmed HK, Mitchell WJ & Priest FG (1995) Regulation of mosquitocidal toxin synthesis in Bacillus sphaericus. Appl Microbiol Biotechnol 43: 310–314. Arigoni F, Duncan L, Alper S, Losick R & Stragier P (1996) SpoIIE governs the phosphorylation state of a protein regulating transcription factor sigma F during sporulation in Bacillus subtilis. P Natl Acad Sci USA 93: 3238–3242. Bagyan I, Hobot J & Cutting S (1996) A compartmentalized regulator of developmental gene expression in Bacillus subtilis. J Bacteriol 178: 4500–4507. Baumann P, Unterman BM, Baumann L, Broadwell AH, Abbene SJ & Bowditch RD (1985) Purification of the larvicidal toxin of Bacillus sphaericus and evidence for highmolecular-weight precursors. J Bacteriol 163: 738–747. Berry C (2011) The bacterium, Lysinibacillus sphaericus, as an insect pathogen. J Invertebr Pathol 109: 1–10. Broadwell AH & Baumann P (1986) Sporulation-associated activation of Bacillus sphaericus larvicide. Appl Environ Microbiol 52: 758–764. Broadwell AH, Baumann L & Baumann P (1990) Larvicidal properties of the 42-Kilodalton and 51-Kilodalton Bacillus

FEMS Microbiol Lett 330 (2012) 105–112

111

sphaericus proteins expressed in different Bacterial hosts – Evidence for a binary toxin. Curr Microbiol 21: 361–366. Cao M, Bitar AP & Marquis H (2007) A mariner-based transposition system for Listeria monocytogenes. Appl Environ Microbiol 73: 2758–2761. Cartman ST & Minton NP (2010) A mariner-based transposon system for in vivo random mutagenesis of Clostridium difficile. Appl Environ Microbiol 76: 1103–1109. Charles JF, Kalfon A, Bourgouin C & de Barjac H (1988) Bacillus sphaericus asporogenous mutants: morphology, protein pattern and larvicidal activity. Ann Inst Pasteur Microbiol 139: 243–259. Charles JF, Nielson-LeRoux C & Delecluse A (1996) Bacillus sphaericus toxins: molecular biology and mode of action. Annu Rev Entomol 41: 451–472. El-Bendary M, Priest FG, Charles JF & Mitchell WJ (2005) Crystal protein synthesis is dependent on early sporulation gene expression in Bacillus sphaericus. FEMS Microbiol Lett 252: 51–56. Finney DJ (1971) Probit Analysis – A Statistical Treatment of the Sigmoid Response Curve, 3rd edn. Cambridge University Press, Cambridge. Han B, Liu H, Hu X, Cai Y, Zheng D & Yuan Z (2007) Molecular characterization of a glucokinase with broad hexose specificity from Bacillus sphaericus strain C3-41. Appl Environ Microbiol 73: 3581–3586. Hilbert DW & Piggot PJ (2004) Compartmentalization of gene expression during Bacillus subtilis spore formation. Microbiol Mol Biol Rev 68: 234–262. Holt SC, Gauther JJ & Tipper DJ (1975) Ultrastructural studies of sporulation in Bacillus sphaericus. J Bacteriol 122: 1322–1338. Isezaki M, Hosoya S, Takeuchi M & Sato T (2001) A putative ATP-binding cassette transporter YbdA involved in sporulation of Bacillus subtilis. FEMS Microbiol Lett 204: 239–245. Kalfon A, Charles JF, Bourgouin C & de Barjac H (1984) Sporulation of Bacillus sphaericus 2297: an electron microscope study of crystal-like inclusion biogenesis and toxicity to mosquito larvae. J Gen Microbiol 130: 893–900. Lampe DJ, Churchill MEA & Robertson HM (1996) Purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J 15: 5470–5479. Le Breton Y, Mohapatra NP & Haldenwang WG (2006) In vivo random mutagenesis of Bacillus subtilis by use of TnYLB-1, a mariner-based transposon. Appl Environ Microbiol 72: 327–333. Li L, Yang C, Liu Z, Li F & Yu Z (2000) Screening of acrystalliferous mutants from Bacillus thuringiensis and their transformation properties. Acta Microbiol Sin 5: 395–399. Li M, Yin W, He J & Yu Z (2009) Two novel transposon delivery vectors based on mariner transposon for random mutagenesis of Bacillus thuringiensis. J Microbiol Methods 78: 242–244. Maier TM, Pechous R, Casey M, Zahrt TC & Frank DW (2006) In vivo Himar1-based transposon mutagenesis of


112

Francisella tularensis. Appl Environ Microbiol 72: 1878– 1885. Perego M, Cole SP, Burbulys D, Trach K & Hoch JA (1989) Characterization of the gene for a protein kinase which phosphorylates the sporulation-regulatory proteins Spo0A and Spo0F of Bacillus subtilis. J Bacteriol 171: 6187–6196. Pribil PA & Haniford DB (2003) Target DNA bending is an important specificity determinant in target site selection in Tn10 transposition. J Mol Biol 330: 247–259. Russell BL, Jelley SA & Yousten AA (1989) Carbohydrate metabolism in the mosquito pathogen Bacillus sphaericus 2362. Appl Environ Microbiol 55: 294–297. Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Steinmetz M & Richter R (1994) Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome. J Bacteriol 176: 1761–1763.


Y. Wu et al.

Vos JC, De Baere I & Plasterk RH (1996) Transposase is the only nematode protein required for in vitro transposition of Tc1. Genes Dev 10: 755–761. Wickremesinghe RSB & Mendis CL (1980) Bacillus sphaericus spore from Sri Lanka demonstrating rapid larvicidal activity on Culex quinquefasciatus. Mosq News 40: 387–389. Yang Y, Wang L, Gaviria A, Yuan Z & Berry C (2007) Proteolytic stability of insecticidal toxins expressed in recombinant bacilli. Appl Environ Microbiol 73: 218–225. Ye J, McGinnis S & Madden TL (2006) BLAST: improvements for better sequence analysis. Nucleic Acids Res 34: W6–W9. Youngman PJ, Perkins JB & Losick R (1983) Genetic transposition and insertional mutagenesis in Bacillus subtilis with Streptococcus faecalis transposon Tn917. P Natl Acad Sci USA 80: 2305–2309. Yousten AA & Davidson EW (1982) Ultrastructural analysis of spores and parasporal crystals formed by Bacillus sphaericus 2297. Appl Environ Microbiol 44: 1449–1455.

FEMS Microbiol Lett 330 (2012) 105–112