Genetic Diversity and Population Structure of the Brachiaria ... - Ainfo

Tropical Plant Biol. DOI 10.1007/s12042-011-9078-1

Genetic Diversity and Population Structure of the Brachiaria brizantha Germplasm Bianca Baccili Zanotto Vigna & Letícia Jungmann & Patrícia Mara Francisco & Maria Imaculada Zucchi & Cacilda Borges do Valle & Anete Pereira de Souza

Received: 7 April 2011 / Accepted: 3 June 2011 # Springer Science+Business Media, LLC 2011

Abstract Brachiaria brizantha (Hochst. ex A. Rich.) Stapf. (syn. Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster) is a species used primarily as forage in tropical America and Southeast Asia. B. brizantha has been extensively researched since the 1980s with the initiation of the Tropical Forages Breeding Program conducted by the Brazilian Agricultural Research Corporation (Empresa Brasileira de Pesquisa Agropecuária; EMBRAPA), holding one of the largest germplasm collections in the world. This work has identified 15 new microsatellite markers for this species, which have been used in addition to five previously reported markers, to estimate the genetic similarities among 172 accessions and six cultivars of this species. Similarity

index values ranged from 0.40 to 1.00. Two duplications were found in the germplasm. A Bayesian analysis performed using the STRUCTURE 2.3.3 program revealed the presence of three clusters with different allelic pools. This analysis is valuable for the performance of crosses to explore heterosis; however, the mode of reproduction of the accessions and ploidy barriers must be observed for effective exploration. A grouping analysis using the neighbor-joining method was consistent with the STRUCTURE analysis, and a combination approach suggested that this germplasm collection does not exhibit considerable genetic variability despite the presence of three distinct allelic pools. The lack of correlation between the genetic and geographic distances is also discussed.

Communicated by Desiree M. Hautea Electronic supplementary material The online version of this article (doi:10.1007/s12042-011-9078-1) contains supplementary material, which is available to authorized users. B. B. Z. Vigna : P. M. Francisco : A. P. de Souza Molecular Biology and Genetic Engineering Center, University of Campinas (UNICAMP), CP 6010, CEP 13083-970, Campinas, SP, Brazil

M. I. Zucchi Agronomic Institute of Campinas – Polo Apta Sul, Rod. SP 127 km 30, CP 28, CEP 13400-970, Piracicaba, SP, Brazil e-mail: [email protected]

B. B. Z. Vigna e-mail: [email protected] P. M. Francisco e-mail: [email protected] L. Jungmann : C. B. do Valle Plant Biotechnology Laboratory, Brazilian Agricultural Research Corporation - EMBRAPA Beef Cattle, CP 154, CEP 79002-970, Campo Grande, MS, Brazil L. Jungmann e-mail: [email protected] C. B. do Valle e-mail: [email protected]

A. P. de Souza (*) Biology Institute, Plant Biology Department (DBV), University of Campinas (UNICAMP), CP 6109, CEP 13083-970, Campinas, SP, Brazil e-mail: [email protected]

Present Address: B. B. Z. Vigna Brazilian Agricultural Research Corporation - EMBRAPA Cattle-Southeast, CP 339, CEP 13560-970, São Carlos, SP, Brazil

Tropical Plant Biol.

Keywords Urochloa brizantha . Forage grass . Molecular markers . Polyploid . Simple sequence repeats (SSR) Abbreviations AMOVA analysis of molecular variance CIAT Center for Tropical Agriculture CTAB cetyl trimethyl ammonium bromide cv. cultivar DNA deoxyribonucleic acid EBC EMBRAPA Beef Cattle EMBRAPA Brazilian Agricultural Research Corporation MCMC Markov-Chain Monte Carlo NJ neighbor joining PCR polymerase chain reaction PIC polymorphism information content RAPD random amplification of polymorphic DNA SDS-PAGE sodium dodecyl sulfate–polyacrylamide gel electrophoresis SSR simple sequence repeats UPGMA unweighted pair-group method with arithmetic mean

Introduction Brachiaria grasses play an important role in cultivated pastures in tropical America and Southeast Asia (de Valle et al. 2008), regions that are rich in beef and milk production. Over the last decades, Brazil has become a world leader in beef cattle production and exportation, primarily due to an improvement in animal disease control and an increase in agronomically productive land due to the release of forage cultivars adapted to the adverse edaphoclimatic conditions of central Brazil and improvements in pasture management. The cultivated pastures in Brazil span 120 million hectares, 85% of which are occupied by Brachiaria spp. grasses (Macedo 2006). Palisade grass (Brachiaria brizantha (Hochst. ex A. Rich.) Stapf. (syn. Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster)) is a perennial C4 grass native to Africa (Renvoize et al. 1996) that has been used extensively as a fodder plant for the last 30 years in tropical and subtropical areas, particularly in tropical America. Several cultivars have been released by the Brazilian Agricultural Research Corporation (Empresa Brasileira de Pesquisa Agropecuária; EMBRAPA) and are extensively cultivated in tropical areas. In 1984, EMBRAPA released the B. brizantha cultivar Marandu, which was introduced into Brazil via the Zimbabwe Grasslands Research Station (Nunes et al. 1984). Due to its resistance to spittlebugs (Ferrufino and Lapointe 1989), its use rapidly spread throughout the American tropics. Currently, it constitutes

approximately 70% of the commercialized forage seeds in Brazil and is exclusively exported to Latin America (Macedo 2005). More recently, cattle producers have been adopting the Xaraés and Piatã cultivars, released in 2003 and 2006, respectively, at an unprecedented rate. Despite this recent trend, the 40 million ha of central Brazilian lands that are estimated to be occupied by cv. Marandu corresponds to a large monoculture that threatens the entire livestock production system. One of the largest Brachiaria spp. germplasm collections in the world, consisting of 14 African species of Brachiaria including B. brizantha, was imported from the International Center for Tropical Agriculture (CIAT) in Cali, Colombia to Brazil by EMBRAPA (Keller-Grein et al. 1996). This germplasm collection was established and maintained in the fields at EMBRAPA Beef Cattle (EBC) in Campo Grande, Mato Grosso do Sul. Since the inception of EMBRAPA’s Tropical Forages Breeding Program, in addition to breeding, the collection’s agronomic, morphological, cytogenetic and reproductive properties have been evaluated. Several studies have characterized palisade grass genotypes and provided basic information for breeding. Evaluations of this collection by flow cytometry for DNA content determination (Penteado et al. 2000), chromosome counting (Mendes-Bonato et al. 2002) and embryo sac analysis by interference contrast microscopy (do Valle et al. 2008) revealed that accessions of B. brizantha are predominantly polyploid and reproduce primarily by facultative pseudogamous aposporous apomixis. Only one sexual diploid accession was identified. Assis (2001) and de Assis et al. (2003) evaluated the genetic diversity of 301 accessions of six different species of Brachiaria spp., including B. brizantha, based on 26 vegetative, reproductive and pubescence traits. These studies revealed three different groups among all the Brachiaria spp. analyzed and established discrimination functions to allow classification of genotypes into a species. Despite the extensive previous evaluations of this B. brizantha collection, assessments of the molecular genetic diversity began only recently, and a small number of samples have been evaluated to date. Machado Neto et al. (2002) performed a protein profiling of five accessions using uni-dimensional sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). Chiari et al. (2008) analyzed two wild accessions, including one plant that resulted from a colchicine-mediated duplication of the sexual genotype, and two cultivars (cv. Marandu and cv. Piatã) using random amplification of polymorphic DNA (RAPD). This type of marker was also used by Ambiel et al. (2008) to analyze the same materials studied by Machado Neto et al. (2002). The most recent study used microsatellites to evaluate 23 accessions of this species together with one genotype of each of the following

Tropical Plant Biol.

Brachiaria species: B. ruziziensis, B. humidicola, B. decumbens and B. dictyoneura (Jungmann et al. 2009a). Despite B. brizantha being studied together with other Brachiaria species in these four works, an evaluation of a definitive number of accessions has not been conducted until now. The assessment and characterization of germplasm collections are vital for the maintenance and use of genetic resources of any type. Various descriptors have been used for these studies including morphological, agronomic, environmental, biochemical and molecular techniques; the last is the most advantageous because it is not influenced by environmental factors (Fukuda et al. 1996; Ferreira et al. 2007; Valois et al. 2001) and allows for the correlation of molecular genetics with phenotypic characteristics. Simple sequence repeats (SSRs), or microsatellites, are a type of molecular marker that has been extensively used to estimate genetic diversity in germplasm collections from major crops such as cotton (Rungis et al. 2005), maize (Laborda et al. 2005), rice (Ren et al. 2003; Xu et al. 2004; Jayamani et al. 2007), sugarcane (Cordeiro et al. 2003; Pinto et al. 2006; Brown et al. 2007) and wheat (Dobrovolskaya et al. 2005; Peng et al. 2009). These markers consist of sequences of two to six nucleotides (e.g., AC, AGT or ACCT) that are repeated in tandem n times throughout the genome (e.g., (AC)n, (AGT)n or (ACCT)n) and comprise highly polymorphic genomic regions (Gaitán-Solís et al. 2002). They are useful for estimating genetic diversity and genetic relationships, for predicting the genetic value of selected genotypes derived from intraspecific crosses and the performance of their hybrid progenies (Varshney et al. 2005) and for several breeding applications. To date, a panel of 13 SSR markers has been developed by our research group for B. brizantha (Jungmann et al. 2009b). Here, we present 15 new polymorphic microsatellites for this species and their application, along with five previously published markers, in analyzing the intraspecific genetic diversity and population structure in 172 accessions and six cultivars of this species that are conserved in the germplasm collection held at EBC. The correlation between the genetic distance as assessed by microsatellites and the geographical origin data was examined, as was the relationship between molecular and ploidy data.

Results Microsatellite Characterization in B. brizantha Microsatellite loci were successfully amplified with all 15 primer pairs tested and revealed polymorphisms in B. brizantha, resulting in new SSR resources for this species.

Information about these loci is listed in Table 1. The number of alleles scored per locus varied from two (for BbUNICAMP025) to 18 (for BbUNICAMP022), and the corresponding polymorphism information content (PIC) values were 0.01 (for BhUNICAMP025) and 0.79 (for BbUNICAMP017). The degree of polymorphism detected by these primer pairs did not correlate with the number of microsatellite repeats. The 15 new SSRs presented in this study, along with five previously reported loci (Jungmann et al. 2009b), were used to characterize the genetic diversity of the 172 accessions and six commercial cultivars of B. brizantha preserved in the EBC germplasm collection (Table 2). The degree of polymorphism found in these loci among 178 genotypes was highly correlated with the degree of PIC values obtained from 23 accessions. One hundred and fifty-five alleles were scored for these 20 loci. Genetic Diversity and Population Structure Analysis The similarity index values ranged from 0.26 (B0142 and B123) to 1.00 (B178 and B180) and are presented in Supplementary Table 1. Similarities involving cultivars and their original accessions were cv. Arapoty/B163 (0.79), cv. Marandu/B030 (0.70), cv. Piatã/B068 (0.73) and cv. Xaraés/ B178 (0.81). A dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA; data not shown) and discriminated all accessions tested, with the exception of samples B178/B180 and B084/ B237, which appeared to be replicated in the germplasm. B002 and B247 spanned the extremes of the dendrogram, with all other germplasm and cultivars distributed in between these two. A mean genetic similarity of 0.53 was established as the threshold for the determination of groups in the dendrogram; however, this approach did not reveal any structured groups. This result was corroborated by the bootstrap analysis, where only 13 groups of two accessions, two groups of three accessions and one group of five accessions were revealed by bootstrap values higher than 60%. STRUCTURE software was used to determine the population structure using a model-based Bayesian approach that assumes that there are K populations or clusters (where K may be unknown) and that each is characterized by a set of allele frequencies at each locus. Individuals in the sample are assigned to populations or clusters; moreover, if the genotypes indicate admixture, they can be assigned to two or more populations (Pritchard et al. 2000). Because this study analyzed a germplasm collection, we did not assume that clusters of individuals represented natural populations. In this context, we use the term “cluster” to refer to one (or a group of) individual(s) characterized by a distinguishable allelic set. The best number of clusters, K, was determined using the method described by Evanno et al. (2005).

Tropical Plant Biol. Table 1 New microsatellites developed for Brachiaria brizantha SSR locus

Genbank accession Repeat motif number

Taª (°C) Predicted product Nb. of Size range PICb Primer sequences (5′ - 3′) size (bp) alleles (bp)

BbUNICAMP014 HQ906643

(GA)25

60

215

8

194–212

0.71 ACCCCGCTGCATACCCATAAT


(AC)6

60

283

7

269–287

0.77 TGAGATGAGGCAGAACAC


(GCG)4

60

266

5

248–274

0.62 ATGGGATAAAAGGTAACGACAC


(CT)10

60

222

12

188–228

0.79 GCCTCCTGCTTGCCTTCTATTG


(CT)3T(CT)4C(CT)2

60

199

5

190–208

0.48 TTGCAACCACGAAGAAGAAAAG


(GAA)4

60

223

4

220–230

0.43 AATGATGCTCATCATCCAATG


(GCT)2GCA(GCT)2

60

294

9

252–330

0.35 CTGACGAGGGGAGTGGGAATG


55

190

7

185–201

0.32 GAAGAGGCGGATGGGACGAG


(CTT)CGT(CTT)2… (CTT)3(CCT)CG (CCT)3 (AG)17GG(AG)17

55

259

18

190–269

0.72 CTAGCTCCATTAACAGGCACAA


(AC)4AT(AC)3

55

222

5

195–221

0.58 TACGACGCGCAGATTTTGTTTC


(AGA)2AGG(AGA)2

55

267

3

260–278

0.14 TGACAAAACGGTGACAATAG


(TG)4A(GT)3(TG) (GT)3

55

275

2

275–280

0.01 GGAGGTCGTGTGAGGTCTTTT


(GAG)3(GGAG)2

55

214

3

200–214

0.05 TATGTGCGGGCGACTTTTATG


(AACA)3

51

238

6

210–260

0.68 CTACCGGTTAATTGAAGGAAAAAG


(CA)10

55

169

16

140–189

0.76 TTCTCCGTAATTAGCAGTGG

TTTTTGCCCCATCACTCTCTTTG GGAAAACTATAAAGAACAAATAA TCCAAATCACAACTAATAAGCC GTGGCAGGTGCGTCTTGTCTTC CTGCGTATGCCTCCCTGTCC CCATCAAGGTGCAAGTCAAT TCGAGTTGCTGGCAGAAGTTGG CGGCGAGATGGGAGGAGACA

CTCCCAGCTCTCGTTCATCTT ACCGGGTCGTCGTTGTCTCC ATGACTTCCCAAATGACTCC GTTTTCCCTGCAGGTTACATTA TCTTTTGCCACCGCTCTATCTA TTGTTGGTATGTTAGGAGGCAGTA GAAAATTCATAGGGGCAGTAG

ªAmplification temperature b Polymorphism Information Content (PIC) evaluated in 30 accessions of Brachiaria spp

The STRUCTURE analysis, coupled with the computation of the Evanno ΔK statistics, suggested that the Brachiaria brizantha germplasm collection is structured into three clusters (K=3), represented by different colors (red, green and blue) in Fig. 1a. Cluster I (CI), represented by the red allelic pool, is composed of 44 genotypes; Cluster II (CII), represented by the green allelic pool, is composed of 62 genotypes; and Cluster III (CIII), represented by the blue allelic pool, is composed of the remaining 72 genotypes of the studied species. The estimated membership coefficients (Q) of each individual for each allelic pool are shown in Supplementary Table 2. Figure 1b presents another graphic representation of the STRUCTURE results; here, individuals are ordered by annotated numbers (001 to 178, according to Table 1) to provide a better view of the Q-value proportions for each genotype. The analysis of molecular variance (AMOVA) test revealed significant (p