Genetic polymorphism of murine tissue plasminogen activator ... - Nature

Genes and Immunity (1999) 1, 130–136  1999 Stockton Press All rights reserved 1466-4879/99 $15.00 http://www.stockton-press.co.uk

Genetic polymorphism of murine tissue plasminogen activator associated with antiphospholipid syndrome J Shirai1, A Ida2, Y Jiang1, R Sanokawa-Akakura1, Y Miura1,3, K Yan3, Y Hamano1, S Hirose1,4 and T Shirai1,4 1

Departments of Pathology, and 3Rheumatology and Internal Medicine, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; 2Department of Obstetrics and Gynecology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan; 4Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, Kawaguchi, Saitama 332-0012, Japan

In a subset of patients with systemic lupus erythematosus (SLE), antiphospholipid syndrome characterized by thrombocytopenia, thrombosis, recurrent abortion and antiphospholipid antibodies develops. Male (NZW × BXSB) F1 mice are widely used as a model for SLE-associated antiphospholipid syndrome. Our earlier genetic studies showed that one susceptibility allele for thrombocytopenia and associated IgG platelet-binding autoantibodies in male (NZW × BXSB) F1 mice was linked to the BXSB-type polymorphic microsatellite D8Mit96, located in proximity to the gene Plat for tissue-type plasminogen activator (t-PA). In the present studies, sequence analyses for structural and promoter regions of Plat revealed a single nucleotide polymorphism encoding a catalytic domain of t-PA, with an amino acid substitution of anionic Glu366 in NZW for a cationic Lys in BXSB. Progeny studies using NZW × (NZW × BXSB) F1 male backcross mice showed that the BXSB Plat allele was significantly associated with high levels of both platelet-binding antibodies and thrombocytopenia. Furthermore, these two traits appeared to be regulated by a complementary effect of two BXSB alleles; one is linked to Plat and the other to the H-2 complex and the gene for plasminogen. Thus, the BXSB-type Plat may be one susceptibility allele for the multigenic antiphospholipid syndrome seen in (NZW × BXSB) F1 mice. Potential mechanisms are discussed. Keywords: antiphospholipid syndrome; anti-platelet antibodies; BXSB mice; plasmin; thrombocytopenia; tissue-type plasminogen activator (t-PA)

Introduction Systemic lupus erythematosus (SLE) is a multigenic autoimmune disease which has a variety of clinical features.1 In a subset of patients with SLE, the antiphospholipid syndrome (APS), characterized by predominant clinical features of systemic thrombosis, thrombocytopenia, and recurrent abortion, accompanied by antiphospholipid antibodies, develops.2 In the male F1 hybrid of non-autoimmune female NZW and autoimmune disease-prone male BXSB mice, carrying Yaa gene, IgG hypergammaglobulinemia, IgG anti-nuclear antibodies and immune complex-type glomerulonephritis, in association with myocardial infarction, thrombocytopenia and autoantibodies to cardiolipin and platelets develop as animals age.3–5 Certain repertoires of anti-platelet antibodies were shown to be antibodies to cardiolipin, including cofactor

Correspondence: Professor Toshikazu Shirai, Department of Pathology, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan. E-mail: [email protected] This work was supported in part by CREST (Core Research for Evolutional Science and Technology) of Japan Science and Technology Corporation (JST) and a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan. Received 8 July 1999; revised 12 August 1999; accepted 22 August 1999

␤2 glycoprotein I (␤2GPI).5 Thus, these mice serve as a model for SLE-associated APS. Studies of families with APS revealed the importance of genetic predisposition and a complex multigenic mode of inheritance is suggested to be involved.6 Genetic basis for susceptibility to this disease has remained undetermined. Earlier progeny studies in our laboratory using male NZW × (NZW × BXSB) F1 backcross mice mapped two susceptibility BXSB alleles, which act in a complementary fashion for both thrombocytopenia and IgG platelet-binding antibodies; one is linked to microsatellite D17Mit16 on chromosome 17 (provisionally designated Pbat-1, platelet binding antibody-associated thrombocytopenia-1), being located in the vicinity of the H-2 complex and the gene for plasminogen (Plg), and the other to D8Mit96 on chromosome 8 (Pbat-2), in close proximity to the gene Plat for t-PA.7 The t-PA converts plasminogen to the active protease plasmin for fibrinolytic activity in the form of heterotrimer complex of t-PA, plasminogen and fibrin.8–10 With this insight, we speculated that the BXSB-type Plat and/or Plg polymorphisms may cause abnormality in fibrinolysis, the result being the aggregation and destruction of platelets. Such disrupted platelets may provide antigen presenting cells with antigens, including ␤2GPI, in the context of unique H-2 haplotype, thus promoting affinity maturation of platelet-binding autoantibodies and the associated thrombocytopenia. We now report

Antiphospholipid syndrome and t-PA polymorphism J Shirai et al

that the gene segment encoding the catalytic domain (serine protease domain) of t-PA is polymorphic between the BXSB and the NZW strains, and that the BXSB allele is significantly associated with thrombocytopenia and IgG platelet-binding autoantibodies in the progeny.

Results One susceptibility allele for thrombocytopenia and IgG platelet-binding antibodies observed in male (NZW × BXSB) F1 mice was mapped to the region closely linked to the locus Plat on chromosome 8 of the BXSB strain in studies using NZW × (NZW × BXSB) F1 male backcross mice.7 If the BXSB Plat is indeed the susceptibility allele per se, it must be polymorphic between the BXSB and the NZW strains. Thus, we compared DNA sequences of promoter and structural regions of Plat between the two mouse strains. As shown in Figure 1, sequences in the structural regions encoding fibronectin finger-like, epidermal growth factor-like, and kringle 1 domains of tPA are entirely identical between the two mouse strains. However, compared to findings in NZW, there are six nucleotide changes in other regions in BXSB: one in the promoter region at position −699, one in the structural region encoding the kringle 2 domain, and another four in the region encoding the catalytic domain. Among these, a T→C transversion in the promoter region is unrelated to potential binding sites for CRE-binding protein, CTF/NF-1, and transcription factors AP-2 and Sp1, reported by Rickles et al.11 As for coding regions, while nucleotide changes at positions 801, 1095, 1509 and 1629 are not associated with amino acid substitutions, a G→A transversion at position 1237 results in the substitution of Lys366 for Glu. This substitution deserves attention, because cationic Lys is substituted for anionic Glu particularly in the catalytic domain. We then examined the association of the BXSB-type Plat allele, as determined by the G→A transversion at position 1237, with thrombocytopenia and platelet-binding antibodies in male NZW × (NZW × BXSB) F1 backcross mice 4–6 months of age. According to the Plat genotype, 73 mice were separated into two groups; one with homozygous NZW/NZW type and the other with heterozygous NZW/BXSB type carrying the BXSB Plat allele. As shown in Figure 2, the backcross progeny bearing the BXSB Plat allele showed a significantly higher titer of IgG platelet-binding antibodies than did the progeny lacking this allele. Although the difference was not statistically significant, platelet counts in the former progeny did tend to be lower than those in the latter. In earlier studies,7 we found that the second BXSB locus in the vicinity of microsatellite D17Mit16 on chromosome 17, linked to the H-2 complex and the gene Plg,13,14 is also involved in thrombocytopenia and IgG platelet-binding antibodies in (NZW × BXSB) F1 mice. To confirm this finding, we selected genotypes of Plat and the polymorphic microsatellite D17Mit16 and examined the relationship between the genotype and the extent of disease traits. The backcross mice were separated into four groups, classified according to combinations of genotypes at Plat and D17Mit16, ie, group a, NZW/NZW genotype at both loci; group b, NZW/BXSB Plat and NZW/NZW D17Mit16 genotypes; group c, NZW/NZW Plat and NZW/BXSB D17Mit16 genotypes; and group d, NZW/BXSB genotype at both loci. As shown in Figure 3,

levels of both thrombocytopenia and platelet-binding antibodies in groups of progeny with either one of the two BXSB alleles (groups b and c) were similar to those seen in the progeny carrying neither BXSB allele (group a), and the differences were not statistically significant by analysis of variance (ANOVA). In contrast, the progeny carrying the BXSB allele at both loci (group d) showed significantly higher levels, compared to those seen in others. Thus, these two disease traits in (NZW × BXSB) F1 mice appear to occur as a result of complementary interaction of the two BXSB disease susceptibility alleles (Pbat-1 and -2), each linked to Plat and D17Mit16. To determine the possible polymorphism of plasminogen, we then sequenced and compared coding regions of Plg between BXSB and NZW. As shown in Figure 4, there are no amino acid substitutions between the two mouse strains, however, the reported amino acids His216 and Asp506 in C57BL/6 mice14 are replaced by Arg and Gly in both BXSB and NZW, respectively.

Discussion We found that the mouse Plat is polymorphic and that the BXSB Plat allele is significantly associated with thrombocytopenia and associated IgG platelet-binding antibodies in a (NZW × BXSB) F1 mouse model of APS, a finding that supports the assumption that BXSB Plat may be one susceptibility allele (Pbat-2) for APS. There are two potentially significant nucleotide polymorphisms in promoter and structural regions of BXSB Plat. One polymorphism locates at position −699 in the promoter region. However, as this position is apart from potential binding sites for CRE-binding protein, CTF/NF-1, and transcription factors AP-2 and Sp1,11 the observed change may not influence the t-PA expression. In contrast, the G→A transversion at position 1237 in the coding region deserves attention, because this transversion results in the substitution of cationic Lys366 for anionic Glu. Also, this position encodes the catalytic domain of t-PA. Thus, the change in catalytic capacity of t-PA to plasminogen may result in deficits in plasmin, leading to abnormal fibrinolysis associated with an increased thrombotic potential. This is in keeping with the finding of Carmeliet et al15 that t-PA-deficient mice show a reduced fibrinolytic potential and an increased incidence of endotoxin-induced thrombosis. Proteolysis mediated by plasmin has been associated with a variety of biological processes,16–19 including activation of immunosuppressive cytokine TGF␤18 and cleavage of the major antigenic epitope of ␤2GPI.19 Thus, abnormality in the conversion of plasminogen to plasmin leads to an increase in immune responses and provides antigen presenting cells with more ␤2GPI epitopes derived from disrupted platelets as effective immunogens. Such a process aids to promote generation of high affinity IgG platelet-binding autoantibodies, including anti-␤2GPI antibodies. In this respect, an autosomal recessive mouse mutation scat (severe combined anemia and thrombocytopenia) is of interest,20 because scat is tightly linked to Plat and the disease phenotype of scat includes severe intermittent bleeding, depletion of platelets, and circulating anti-platelet autoantibodies. Thrombocytopenia and IgG platelet-binding antibodies in (NZW × BXSB) F1 mice are regulated by a complementary effect of two BXSB alleles; one (Pbat-2) is linked to

131


132

Figure 1 Nucleotide sequences of promoter and coding regions of Plat in BXSB and NZW mice. Upper panel shows the promoter region. At position −699, T in NZW is replaced with C in BXSB. This position is unrelated to potential binding sites for CRE-binding protein, CTF/NF-1, and transcription factors AP-2 and Sp1.11 TATA motifs are underlined. CRE, CTF/NF-1 and AP-2 homologies are underlined and overlined. Dashes overlapping with the last two boxes indicate positions of inverted Sp1 motifs. Lower panel shows the coding region. The G → A transversion in the catalytic domain of BXSB mice changes the codon 366 GAA in NZW to AAA and replaces glutamic acid with lysine. Other nucleotide transversions observed at codons 801, 1095, 1509 and 1629 are not apparently associated with amino acid substitution. The domains are designated F (fibronectin finger-like, residue 9-46), GF (growth factor-like, residues 54-87), K1 (kringle 1, residues 95-176), K2 (kringle 2, residues 184-265) and C (catalytic, residues 280-530), according to Degen et al.12


Figure 2 Associations of the Plat polymorphism with IgG plateletbinding antibodies and thrombocytopenia in male NZW × (NZW × BXSB) F1 backcross mice. The backcross mice were separated into two groups, according to Plat genotypes: one homozygous NZW/NZW (W/W) type and the other heterozygous NZW/BXSB (W/B) type. Number of mice examined is shown in parentheses. Levels of platelet-binding antibodies and platelet counts are expressed by mean and standard error. Significant difference by Student’s t-test is shown. For details, see text.

Figure 3 Complementary interaction between the loci Plat and D17Mit 16 in the production of IgG platelet-binding antibodies and thrombocytopenia in NZW × (NZW × BXSB) F1 backcross male mice. The backcross mice were separated into four groups; according to genotypes at two loci: Plat and D17Mit16. W/W indicates the homozygous NZW/NZW type and W/B, the heterozygous NZW/BXSB type at a given locus. Only the progeny carrying BXSB alleles at both loci shows significantly high levels of IgG plateletbinding autoantibodies and severe thrombocytopenia, compared to those seen in others. Number of mice examined is shown in parentheses. Levels of platelet-binding antibodies and platelet counts are expressed by mean and standard error. Significant difference by analysis of variance (ANOVA) is shown.

Plat on chromosome 8 and the other (Pbat-1) linked to Plg and the H-2 complex on chromosome 17. There are at least two plausible interpretations for this association. First, as the conversion of plasminogen to active plasmin mediated by t-PA is suggested to proceed in the form of a heterotrimer complex of t-PA, plasminogen and fibrin,8–10 the observed thrombocytopenia and the associated generation of platelet-binding antibodies may be due to deficits in the interaction between the polymorphic t-PA and potentially polymorphic plasminogen. If this is indeed the case, BXSB and NZW Plg alleles should be polymor-

phic. However, this was not evident, although Arg216 and Gly506 in both BXSB and NZW were substituted for His and Asp in C57BL/6 mice,14 respectively. Alternatively, one susceptibility allele (Pbat-1), mapped in close proximity to D17Mit16,7 would be the polymorphic class II gene in the H-2 complex, and the observed thrombocytopenia may be the consequence as a result of an increase in production of high affinity, pathogenic IgG autoantibodies to platelets, including those to cardiolipin and/or ␤2GPI. In this context, we previously compared the severity of thrombocytopenia between two H-2-congenic (NZW × BXSB) F1 mouse strains; one is original H-2z/b and the other is congenic H-2d/b. The results showed that, compared to the findings in the parental BXSB, the H2z/b, but not H-2d/b, heterozygotes developed a more severe thrombocytopenia.21 Thus, we suggested that unique mixed haplotype class II molecules formed in the H-2z/b heterozygous background serve as a unique restriction element for autoreactive T cell recognition of platelet selfpeptides. Abnormality in fibrinolysis may result in aggregation and destruction of platelets, thus providing antigens, probably including ␤2GPI, for antigen presenting cells in the context of the unique H-2z/d heterozygosity in (NZW × BXSB) F1 mice. This mechanism allows autoreactive, anti-platelet B cells to undergo affinity maturation, thus leading to severe thrombocytopenia. Because precise determination of the amount and functional capacity of murine t-PA is currently difficult, we have so far been unable to correlate the potential dysfunction of BXSB-type t-PA with thrombocytopenia and the associated generation of platelet-binding antibodies. SLE is a syndrome in which each autoimmune disease feature is controlled separately by a rather limited number of major genes.22 Thus, the diversity of SLE features in individual patients can be attributed to different combinations of susceptibility genes contributing to each disease feature. Our present findings may imply that the tPA associated polymorphism is one such susceptibility allele and is responsible for a subset of SLE patients with APS. Further studies on this subject are expected to shed light on the pathogenesis of APS and to provide new prophylactic and therapeutic approaches.

Materials and methods Mice NZW and BXSB mice originally obtained from Japan SLC, Inc (Shizuoka, Japan) were maintained in our laboratory. Backcross mice were obtained by crossing female NZW mice with male (NZW × BXSB) F1 mice and only male mice were used for these studies. All groups of mice were housed in the same room and were fed an identical diet. Mice from 3 months of age onward were examined daily for disease and were bled monthly to obtain plasma. Platelet counts Fifty microliters of blood, obtained from the retro-orbital sinus of the mice using heparinized microhematocrit tubes, were diluted with 200 ␮l of 1.25 mg/ml EDTA in isotonic phosphate buffered solution (PBS, pH 7.5). Of the diluted blood, 20 ␮l were mixed with 980 ␮l Cell Kit CD solution (CK-35, Toa Medical Electronics Co, Kobe, Japan) and centrifuged at 110 g for 20 min to remove sedi-

133


134

Figure 4 Nucleotide sequences of coding regions of Plg in BXSB and NZW mice with reference to the reported sequences in C57BL/6 mice.4 The amino acids His216 and Asp506 in C57BL/6 mice are replaced by Arg and Gly in both BXSB and NZW, respectively.

ments of red blood cells and leukocytes. After centrifugation, the supernatant was examined for platelet count, using an automatic counter (Sysmex platelet counter, PL100, Toa Medical Electronics Co, Japan). Platelet-binding autoantibodies Of the heparinized, diluted blood mentioned above, 50 ␮l were mixed with 1 ml Cell Kit CD solution and centrifuged to obtain the platelet-rich suspension. The plateletrich suspension was re-centrifuged and the platelet pellet was incubated with 20 ␮l fluorescene isothiocyanate (FITC)-conjugated goat anti-mouse ␥ chain antibodies

diluted 1:100 with 0.2% bovine serum albumin (BSA) in PBS for 30 min at 4°C. After washing with 0.2% BSA in PBS, the platelets were suspended in 1% paraformaldehyde in PBS, and platelet-binding IgG antibodies were analyzed using a FACStar (Becton Dickinson, Mountain View, CA, USA). The platelet population was gated by forward vs side scatter and titers of platelet-binding antibodies were expressed as percentages of IgG-binding platelets in total platelet counts. Sequence analysis and genotyping Total RNA, isolated from the mouse ovary (for Plat) and liver (for Plg) using ISOGEN (Nippon Gene Co Ltd,


135

Table 1 Amplification and sequencing primers used in the present study Gene

Region

Sequence (5′–3′)

Plat

Promoter

CTGCAGATGAAGACTAAACT TGTAAGGATCTGCTGCTCTA

(F) (R)

GGGTAGTTGCTTCAAATTCC CTCTTGCAGGGGCCTCTCCT

(F) (R)

Coding

GAATTCCCTCAAGAGCTCAGCG GATGAGCCAACGCAGACAAC AGTCTCGGTCTGGGTTTCTG CAATGCAAGGAGGCCAAATG ACCCACAGCCTCACCACATC

(F) (F) (R) (F) (F)

GACCACCCTGTATGTTCTGC GTTCCTGCTGGGTGCTGTCA CTGAGGTCACAGTCCAAGCA GGTCCTCCTCTGGATTGAAG

(R) (F) (F) (R)

Coding

TGGCCAGTCCCAACATGGAC CAGCAAGACTTCCTCCATCA TGGTGCTACACTACAGATCC GGTCCCTCGGTAATTTTCACC TCACAACAGACCCCACCAAA AGAAACTGCTCCCTGGTGCT

(F) (F) (F) (R) (F) (F)

TGTGGGGTGAAGATGCTGTG GAGCGACTCTGAGACAGACT GTGTGCATCAGCATCATCCT GATCTTGGAGCCCAACAACC CCTCATCTCCCTTTCAATCC TTTCCAAACACCCTAAGCCC

(R) (F) (F) (F) (R) (R)

Plg

F, forward primer; R, reverse primer.

Tokyo, Japan), was reverse transcribed into cDNA. DNA sequencing of entire Plat and Plg cDNA was obtained using an Applied Biosystems 373A sequencer with Taq DNA polymerase and dye terminator. Sequence analysis of the Plat promoter region was done using genomic DNA obtained from mouse tails.11,23 Genotyping of NZW × (NZW × BXSB) F1 backcross mice for a flanking microsatellite D17Mit16 was carried out using PCR primers purchased from Research Genetics (Huntsville, AL, USA), according to Dietrich et al.24 PCR reactions were performed using radioactively labeled primers and products were visualized on acrylamide gels. Primers used are shown in Table 1 and were end-labeled with [␥32 P]ATP, using T4 kinase (Takara Shuzo, Kyoto, Japan), according to standard protocols. A 20 ng aliquot of genomic DNA was amplified in a 10 ␮l PCR reaction using Taq polymerase (Takara Shuzo), according to the manufacturer’s specifications. The primer concentrations were: 100 nm of each of the two primers unlabeled and 20 nm of one end-labeled primer. PCR amplifications were done using a DNA thermal cycler (Gene Amp. PCR System 9600, Perkin–Elmer Cetus, Norwalk, CT, USA). The reactions consisted of an initial denaturation at 94°C for 3 min, followed by 25 cycles of 94°C for 30 s, 55°C for 45 s and 72°C for 1 min, then followed by a single cycle of 72°C for 3 min. PCR products were diluted two-fold with loading buffer consisting of xylene cyanol and bromophenol blue dyes in 100% formamide, denatured for 3 min at 94°C, and electrophoresed on 7% denaturing polyacrylamide gels for 2 to 3 hours at 1200V. Gels were dried and examined using a Bioimaging analyzer BAS 2000 (Fuji Film, Tokyo, Japan). Statistical analysis Student’s t-test and ANOVA were used to determine differences in extent of disease characters between each group of backcross progeny.

Acknowledgements We thank M Ohara for critical comments.

References 1 Arnett FC Jr. The genetics of human lupus. In: Wallace DJ, Hahn BH (eds). Dubois’ Lupus Erythematosus. Williams & Wilkins: Baltimore, MD, 1997, pp 77–117.

2 Hughes GRV, Harris EN, Gharavi AE. The anticardiolipin syndrome. J Rheumatol 1986; 13: 486–489. 3 Hang LM, Izui S, Dixon FJ. (NZW × BXSB)F1 hybrid: a model of acute lupus and coronary vascular disease with myocardial infarction. J Exp Med 1981; 154: 216–221. 4 Oyaizu N, Yasumizu R, Miyama-Inaba M et al. (NZW × BXSB) F1 mouse: a new animal model of idiopathic thrombocytopenic purpura. J Exp Med 1988; 167: 2017–2022. 5 Hashimoto Y, Kawamura M, Ichikawa K et al. Anticardiolipin antibodies in NZW × BXSB F1 mice: a model of antiphospholipid syndrome. J Immunol 1992; 149: 1063–1068. 6 Goel N, Ortel TL, Bali D et al. Familial antiphospholipid antibody syndrome. Criteria for disease and evidence for autosomal dominant inheritance. Arthritis Rheum 1999; 42: 318–327. 7 Ida A, Hirose S, Hamano Y et al. Multigenic control of lupusassociated antiphospholipid syndrome in a model of (NZW × BXSB) F1 mice. Eur J Immunol 1998; 28: 2694–2703. 8 Bachmann F, Kruithof EKO. Tissue plasminogen activator: chemical and physiological aspects. Semin Thrombo Haemost 1984; 10: 6–17. 9 Collen D. On the regulation and control of fibrinolysis. Thromb Haemost 1980; 43: 77–89. 10 Camiolo SM, Thorsen S, Atrup T. Fibrinogenolysis and fibrinolysis with tissue plasminogen activator, urokinase, streptokinase-activated human globulin, and plasmin. Proc Soc Exp Biol Med 1971; 138: 277–280. 11 Rickles RJ, Darrow AL, Strickland S. Differentiation-responsive elements in the 5′ region of the mouse tissue plasminogen activator gene confer two-stage regulation by retinoic acid and cyclic AMP in teratocarcinoma cells. Mol Cell Biol 1989; 9: 1691– 1704. 12 Degen SJF, Rajput B, Reich E. The human tissue plasminogen activator gene. J Biol Chem 1986; 261: 6972–6985. 13 Forejt J, Artzt K, Barlow DP et al. Mouse chromosome 17. Mamm Genome 1994; 5: S238–S258. 14 Degen SJF, Bell SM, Schaefer LA, Elliott RW. Characterization of the cDNA coding for mouse plasminogen and localization of the gene to mouse chromosome 17. Genomics 1990; 8: 49–61. 15 Carmeliet P, Schoonjans L, Kieckens L et al. Physiological consequences of loss plasminogen activator gene function in mice. Nature 1994; 368: 419–424. 16 Saksela O, Rifkin DB. Cell-associated plasminogen activation: regulation and physiological functions. Annu Rev Cell Biol 1988; 4: 93–126. 17 Vassalli JD, Sappino AP, Belin D. The plasminogen activator/plasmin system. J Clin Invest 1991; 88: 1067–1072. 18 Khalil N, Corne S, Whitman C, Yacyshyn II. Plasmin regulates the activation of cell-associated latent TGF-␤1 secreted by rat alveolar macrophages after in vivo bleomycin injury. Am J Respir Cell Mol Biol 1996; 15: 252–259.


136

19 Matsuura E, Inagaki J, Kasahara H et al. A role of proteolytic cleavage of ␤2-glycoprotein I: reduction of antigenicity in antiphospholipid syndrome. (Submitted for publication). 20 Peters LL, Barker JE. Novel inheritance of the murine severe combined anemia and thrombocytopenia (scat) phenotype. Cell 1993; 74: 135–142. 21 Kawano H, Abe M, Zhang D et al. Heterozygosity of the major histocompatibility complex controls the autoimmune disease in (NZW × BXSB) F1 mice. Clin Immunol Immunopathol 1992; 65: 308–314.

22 Shirai T. The genetic basis of autoimmunity in murine lupus. Immunol today 1982; 3: 187–194. 23 Rickles RJ, Darrow AL, Strickland S. Molecular cloning of complementary DNA to mouse tissue plasminogen activator mRNA and its expression during F9 teratocarcinoma cell differentiation. J Biol Chem 1988; 263: 1563–1569. 24 Dietrich W, Katz H, Lincoln SE et al. A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 1992; 131: 423–447.