Genetic polymorphisms and activity of PON1 in a Mexican population

See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/7819868

Genetic polymorphisms and activity of PON1 in a Mexican population ARTICLE in TOXICOLOGY AND APPLIED PHARMACOLOGY · JULY 2005 Impact Factor: 3.63 · DOI: 10.1016/j.taap.2004.10.015 · Source: PubMed

CITATIONS

DOWNLOADS

VIEWS

42

41

145

6 AUTHORS, INCLUDING: Ana Belem Piña-Guzman

Libia Vega

Instituto Politécnico Nacional

Center for Research and Advanced Studies …

11 PUBLICATIONS 157 CITATIONS

53 PUBLICATIONS 1,597 CITATIONS

SEE PROFILE

SEE PROFILE

Betzabet Quintanilla-Vega Center for Research and Advanced Studies … 57 PUBLICATIONS 801 CITATIONS SEE PROFILE

Available from: Libia Vega Retrieved on: 20 July 2015

Toxicology and Applied Pharmacology 205 (2005) 282 – 289 www.elsevier.com/locate/ytaap

Genetic polymorphisms and activity of PON1 in a Mexican population A.E. Rojas-Garcıáa, M.J. Solı´s-Herediaa, B. Pinã-Guzmańa, L. Vegaa, L. Lo´pez-Carrillob, B. Quintanilla-Vegaa,* b

a Seccioń Externa de Toxicologıá, CINVESTAV-IPN, PO Box 14-740, Mexico City, 07300, Mexico Instituto Nacional de Salud Pu´blica, Ave. Universidad No. 655, Col. Santa Ma. Ahuacatitlań, Cuernavaca, Mor., 62508, Mexico

Received 18 August 2004; accepted 22 October 2004 Available online 8 December 2004

Abstract Human paraoxonase (PON1) plays a role in detoxification of organophosphorus (OP) compounds by hydrolyzing the bioactive oxons, and in reducing oxidative low-density lipoproteins, which may protect against atherosclerosis. Some PON1 polymorphisms have been found to be responsible for variations in catalytic activity and expression and have been associated with susceptibility to OP poisoning and vascular diseases. Both situations are of public health relevance in Mexico. Therefore, the aim of this study was to evaluate PON1 phenotype and the frequencies of polymorphisms PON1 162, 108, 55, and 192 in a Mexican population. The studied population consisted of unrelated individuals (n = 214) of either gender, 18–52 years old. Serum PON1 activity was assayed using phenylacetate and paraoxon as substrates. PON1 variants, 162, 55, and 192, were determined by real-time PCR using the TaqMan System, and PON1 108 genotype by PCR-RFLP. We found a wide interindividual variability of PON1 activity with a unimodal distribution; the range of enzymatic activity toward phenylacetate was 84.72 to 422.0 U/mL, and 88.37 to 1645.6 U/L toward paraoxon. All four PON1 polymorphisms showed strong linkage disequilibrium (D% N90). PON1 polymorphisms 108, 55, and 192 were independently associated with arylesterase activity; whereas the activity toward paraoxon was related only with PON1 192 polymorphism, suggesting that this polymorphism is determinant to infer PON1 activity. A better understanding of the phenotype and genotypes of PON1 in Mexican populations will facilitate further epidemiological studies involving PON1 variability in OP poisoning and in the development of atherosclerosis. D 2004 Elsevier Inc. All rights reserved. Keywords: PON1; Paraoxonase polymorphism; Organophosphorus pesticides; LDL metabolism

Introduction Human paraoxonase/arylesterase (PON1: aryldialkylphosphatase [E.C.3.1.8.1]) is a high-density lipoprotein (HDL)-associated enzyme of 354 amino acids (43 kDa) synthesized in the liver and secreted into the blood (Hassett et al., 1991; Mackness, 1989). PON1 hydrolyzes and, hence, inactivates the oxygen analogs of various commonly used organophosphorus (OP) compounds (e.g., diazoxon, paraoxon) (Geldmacher-von Mallinckrodt and Diepgen, 1988).

* Corresponding author. Fax: +52 55 5747 7111. E-mail address: [email protected] (B. Quintanilla-Vega). 0041-008X/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.taap.2004.10.015

Human PON1 is encoded by a single gene on chromosome 7q21–22 and is a member of a multigene family (PON1, PON2, and PON3 genes) (Primo-Parmo et al., 1996). PON1 presents at least five polymorphisms in the promoter region at positions 108 (T/C), 126 (G/ C), 162 (A/G), 832 (G/A), and 909 (C/G), from which 108, 162, and 909 have been related with differences in PON1 activity and expression (Brophy et al., 2001; Leviev and James, 2000; Suehiro et al., 2000). The most significant effect of these polymorphisms on PON1 activity is that at position 108, which contributes 22.8% of the activity, and that at position 909 contributes the least (b1%) (Brophy et al., 2001). Linkage disequilibrium has been reported among these polymorphisms from the regulatory region (Brophy et al., 2001). Additionally, two common polymorphisms in the coding

A.E. Rojas-Garcıá et al. / Toxicology and Applied Pharmacology 205 (2005) 282–289

region of PON1 at positions 55 and 192 have been reported. The polymorphic site at position 55 (Leu/Met) has been related with differences in PON1 activity, the 55L isoenzyme has higher enzymatic activity than the 55M isoenzyme (Blatter-Garin et al., 1997). It has been suggested that this is due to linkage disequilibrium with the 108C allele (Brophy et al., 2001), or to an increase in the stability of the 55L isoenzyme (Leviev and James, 2000). On the other hand, PON1 polymorphism at position 192 (Glu/Arg) has two isoforms and has been described in vitro as substrate-dependent: the 192R alloenzyme hydrolyzes paraoxon faster than 192Q (Km = 0.52 vs. Km = 0.81 mM), whereas other compounds, such as diazoxon, are hydrolyzed faster by the latter alloenzyme (Davies et al., 1996; Li et al., 2000). Both isoforms hydrolyze phenylacetate at similar rates (La Du et al., 1986). In addition, linkage disequilibrium between PON1 55 and PON1 192 has also been reported (Blatter-Garin et al., 1997; Brophy et al., 2000). Epidemiological studies have revealed a wide variation in serum PON1 activity among individuals (Furlong et al., 1988; La Du et al., 1986), showing a bimodal or trimodal distribution (Eckerson et al., 1983; Geldmachervon Mallinckrodt and Diepgen, 1988). This variability has been attributed to the presence of polymorphisms in the PON1 gene, and people have been classified into homozygous for the low activity allele, heterozygous, or homozygous for the high activity allele (Eckerson et al., 1983; Geldmacher-von Mallinckrodt and Diepgen, 1988), giving rise to the hypothesis that individuals with low PON1 activity might be more susceptible to OP toxicity. Studies published so far have demonstrated the relevance of PON1 in modulating OP toxicity in vitro, in animal models and in epidemiological studies (review in Costa et al., 2003). On the other hand, PON1 has been implicated in lipid metabolism, since as a HDL-associated enzyme it can prevent lipid peroxide accumulation in low-density lipoproteins that are involved in the initiation of atherosclerosis (Mackness and Durrington, 1995; Mackness et al., 1991). To this regard, some epidemiological studies reported a relationship between PON1 polymorphism and the increased risk for coronary artery disease, in which carrying the R192 allele may represent a risk factor (review in Draganov and La Du, 2004).

283

Considering that heart diseases are one of the most frequent (20%) causes of death in adults in Mexico (INEGI., 2003), that OP poisoning is an important public health problem in the country (Epidemiological Surveillance System/SSA, Mexico), and that PON1 may modulate the development of vascular diseases and the susceptibility to environmental pollutants, such as OP, the aim of this work was to evaluate the distribution of PON1 phenotype and genetic polymorphisms PON1 162, PON1 108, PON1 55, and PON1 192 in a Mexican population.

Methods Human subjects. A convenience sample of 214 healthy and unrelated individuals who attend our Institution (Center for Research and Advanced Studies from the National Polytechnic Institute, CINVESTAV-IPN, Mexico City), were invited to participate. The study population consisted of individuals of either sex, aged 18–52 years, with no history of occupational exposure to OP. Great care was taken in selecting individuals whose parents were Mexicans. We collected blood samples through venipuncture in heparin or EDTA coated tubes to analyze PON1 activity and genotypes, respectively. All subjects signed an informed consent. This study was approved by the Ethics Committee on Human Studies from CINVESTAV-IPN. PON1 activity. PON1 enzymatic activity was assayed as previously described, using as substrates paraoxon (paraoxonase activity) or phenylacetate (arylesterase activity) (Eckerson et al., 1983; Furlong et al., 1988). Briefly, arylesterase activity was determined by phenol production from the hydrolysis of phenylacetate (Sigma-Aldrich) using 10 mM Tris–HCl, pH 8.0, 1 mM CaCl2, and 5 AM EDTA. Eserine sulfate (Sigma-Aldrich) was used to inhibit the unspecific hydrolysis due to serum albumin and serum cholinesterase, which account for about 5% of PON1 activity in plasma. The increase in A270 was followed for 5 min. The molar extinction coefficient of phenol is 1.31 103 and the arylesterase activity was expressed as U/mL. Paraoxon (ChemService) hydrolysis was performed in the presence of 1 M NaCl (salt-stimulated paraoxonase activ-

Table 1 Sequence of TaqMan Probes and primers used for real-time PCR amplification of PON1 polymorphisms PON1 polymorphism

TaqMan probe

Forward primer/reverse primer

PON1

VIC FAM VIC FAM VIC FAM

GCTGAAAGTGCTGAGCTCCT/CCGACCAGGTGCACAGAA

162

PON1 55 PON1 192

CCGCAAGCCGCGCC CCGCAAGCCACGCC AGTATCTCCAAGTCTTC CAGTATCTCCATGTCTTC CCTACTTACAATCCTG CCCTACTTACGATCCTG

ACAACCTGTACTTTCTGTTCTCTTTTCTG/CAGAGCTAATGAAAGCCAGTCCAT CTGAGCACTTTTATGGCACAAATGA/ACCACGCTAAACCCAAATACATCTC

Sequence of primers and probes for the TaqMan system are from 5Vto 3V, except for PON 55 probes which are from 3Vto 5V.

284


ity), which allows for a better identification of PON1 phenotypes (Eckerson et al., 1983), and the activity was assayed by monitoring the formation of p-nitrophenol. The increase in A405 was followed for 5 min. The molar extinction coefficient of p-nitrophenol is 18.05 103, and paraoxonase activity was expressed as U/L. PON1 genotype. Genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche) according to manufacturer’s instructions. PON1 genotype for 108 was determined by PCR-RFLP as previously described (Brophy et al., 2001). To prevent contamination, all PCR procedures were performed under an ultraviolet-irradiated hood. The variants of PON1 162, 55, and 192 were determined by real-time PCR ABI Prism 7000 Sequence Detection System using the TaqMan Universal PCR Master Mix (Applied Biosystems). The primers and probes used are shown in Table 1. Reactions were performed using 5 Al of TaqMan Universal PCR Master Mix (containing AmpliTaq Gold DNA Polymerase, AmpErase UNG, dNTPs with dUTP, Passive Reference 1, and optimized buffer components), 0.25 Al of 40 primer-probe mix (containing primers at 36 AM and dye-labeled probes at 8 AM), and approximately 20 ng of genomic DNA; the reaction mixture was completed to 10 Al with water. Thermal cycling conditions were: a step at 50 8C for 2 min, a hot-start at 95 8C for 10 min, and a two step protocol was followed by 40 cycles: 95 8C for 15 s and 60 8C for 1 min. At the end of the real-time PCR, alleles differing in a single mismatch were detected by two differentially labeled TaqMan probes labeled with two different fluorophores, a reporter dye 6-carboxyfluorescein (6FAM) and VIC at the 5Vend. To calculate the linkage disequilibrium among PON1 polymorphisms, the Arlequin program was used (Schneider et al., 2000).

Table 2 Genotype and allele frequencies of PON1 Polymorphic site 162 (G/A) Genotype

Allele

108 (C/T)

AA (0.03) GG (0.62) GA (0.35) A (0.21) G (0.79)

CC (0.18) CT (0.54) TT (0.28) C (0.45) T (0.55)

55 (L/M)

192 (R/Q)

LL (0.71) LM (0.25) MM (0.04) L (0.84) M (0.16)

RR (0.27) RQ (0.44) QQ (0.29) R (0.49) Q (0.51)

Notes. G/A and C/T denote the nucleic acid exchange for 162 or 108 polymorphic sites; L/M and R/Q denote the amino acid exchange for 55 and 192 polymorphic sites.

Statistical analyses. The chi-square test was used to evaluate the concordance of genotype frequencies with Hardy– Weinberg’s equilibrium expectations. Logarithmic transformation of arylesterase activity was performed to improve normality, and differences among genotypes were evaluated by the ANOVA test. Simple and multiple linear regressions were carried out to determine the association between the polymorphic sites and PON1 activity toward phenylacetate substrate. Variables that were statistically significant ( P b 0.05) in simple regression analyses were included in the final model. Age and gender were evaluated as potential confounders, but no significant differences were found; these variables were not included in the final models. To determine the genetic role of PON1 polymorphisms on paraoxonase activity, the non-parametric Kruskal–Wallis test was used. Multiple logistic regression was applied after the categorization of paraoxonase activity into its median distribution (b399.8 vs. N399.8 U/L). All statistical analyses were conducted using the STATA version 8.0 (STATA, Corp.).

Results PON1 activity We evaluated the activity of PON1 using both phenylacetate (arylesterase activity) and paraoxon (paraoxonase activity) as substrates. Geometric mean of arylesterase activity was 178.16 U/mL, ranging from 84.72 to 421.97; only two individuals presented more than 300 U/mL. Geometric mean for stimulated paraoxonase activity was 383.31 U/L with an interval from 88.37 to 1645.64. These results reveal a large interindiTable 3 Linkage disequilibrium among PON1 polymorphisms

Fig. 1. Distribution of paraoxonase/arylesterase activity in a Mexican population. Plot of cumulative number of individuals versus the ratio of PON1 activity toward paraoxon (stimulated with 1 M NaCl)/arylesterase activity (measured by phenylacetate hydrolysis).

PON1 162 PON1 108 PON1 55

PON1

108

PON1 55

D%

P

D%

P

PON1 192 D%

P

98.4

0.0008

99.4 99.0

0.022 0.005

98.9 94.9 92.5

0.008 0.0001 0.0001

Notes. P values from chi-square analysis. D% = percentage of linkage disequilibrium.


285

Table 4 Arylesterase and paraoxonase activities for each PON1 genotype Polymorphic site a 162 AA AG GG 108 CC CT TT 55 LL LM MM 192 RR RQ QQ a b c d e

Arylesterase activity b geometric mean (95% CI)

Pc

Paraoxonase activity d geometric mean (95% CI)

Pe

198.0 (164.8–238.5) 183.0 (169.5–193.6) 176.0 (168.2–184.4)

N0.05

387.0 (384.7–429.3) 387.0 (328.3–456.0) 363.5 (185.8–711.1)

N0.01

218.6 (201.0–237.7) 178.6 (169.7–187.9) 161.8 (150.2–174.4)

b0.0001

512.3 (387.3–677.4) 396.2 (344.5–455.5) 325.6 (274.7–385.9)

b0.05

188.1 (180.3–196.2) 162.8 (152.8–173.5) 121.5 (103.1–143.1)

b0.0001

444.8 (403.1–490.8) 285.4 (244.2–333.6) 170.6 (134.4–216.5)

b0.001

202.0 (188.3–216.7) 179.3 (170.5–188.5) 155.0 (146.0–165.2)

b0.0001

623.5 (544.5–713.8) 393.4 (354.0–437.2) 221.2 (196.0–249.7)

b0.001

Genotypes at each position are from the highest to the lowest activity. U/mL, U = Amol of substrate hydrolyzed/min. Evaluated by ANOVA from trend on log-transformed values. U/L, CI = Confidence Interval. Evaluated by Kruskal–Wallis test.

vidual variation in enzymatic activities among the population; however, when paraoxonase activity was plotted against arylesterase activity, a bimodal or trimodal PON1 frequency distribution was not observed among the studied Mexican population, instead a unimodal distribution was obtained (Fig. 1). PON1 genotype and allele frequencies Genotype and allele frequencies for both the coding and the regulatory region polymorphisms of PON1 gene are summarized in Table 2. A good agreement was found between the observed and expected genotype frequencies according to the Hardy–Weinberg equilibrium (data not shown). Linkage disequilibrium The analysis of linkage disequilibrium among PON1 polymorphisms is presented in Table 3. We observed, as well as have other studies, a strong (D% N90) genetic linkage disequilibrium among PON1 polymorphisms at the promoter and coding regions.

PON1 activity according to genotypes Arylesterase and paraoxonase activities as a function of different PON1 genotypes are presented in Table 4. The analyses revealed statistically significant (P b 0.05) differences in PON1 activity, using both substrates, among genotypes for the coding region polymorphisms, PON1 55 and PON1 192, as well as for the promoter region polymorphism PON1 108. No difference was observed between arylesterase activity and the polymorphism at position 162 (P N 0.1). PON1 genotypes as determinants of arylesterase activity To determine to what extent each polymorphic site contributes to variations in arylesterase activity, we performed a simple linear regression analysis. Our results show that polymorphisms at positions 108, 55, and 192 account for 12%, 12%, and 13%, respectively, of arylesterase activity (Table 5). In the multivariate analysis, considering arylesterase activity as the dependent variable and polymorphisms at positions 108, 55, and 192 as independent variables, the three polymorphic sites remained associated

Table 5 Simple and multiple linear regression analyses modeling arylesterase activity Analysis by Genotype

Crude values Coefficienta (units/mL)

PON1 162 PON1 108 PON1 55 PON1 192 a

0.04 0.14 0.17 0.13

Adjusted values P

r2

0.26 0.001 0.001 0.001

0.006 0.12 0.12 0.13

The regression coefficients are presented without transformation of PON1 activity.

Coefficient (units/mL) 0.08 0.09 0.09

P

Total r 2

0.005 0.02 0.0001

0.25

286


Table 6 Arylesterase activity according to different PON1 genotypes Genotype at position 108 CC CT CC CT CC TT CT TT CT CC TT CT TT TT CT CT TT

55

192

LL LM LL LL LL LL LL LL LM LM LM LL LL LM LM MM MM

RR RR QQ RR QR QR QR RR QR QQ QR QQ QQ QQ QQ QQ QQ

n

Percent of population

Arylesterase activity geometric mean (U/mL)

16 1 5 25 8 9 24 8 12 1 13 15 5 6 11 1 6

9.64 0.60 3.01 15.06 4.82 5.42 14.46 4.82 7.23 0.60 7.83 9.03 3.01 3.61 6.63 0.60 3.61

237.2 219.6 212.1 198.3 194.5 192.6 188.0 177.4 176.7 174.6 161.9 160.0 159.6 154.5 147.4 133.0 93.8

Notes. Only those genotypes that were associated with arylesterase activity are presented. CC, LL, and RR refer to the highest PON1 activity of polymorphic sites at positions 108, 55, and 192, respectively.

with the activity, suggesting that they have an effect on arylesterase activity, independently from the linkage disequilibrium that exits among them. In the final model, r 2 value was 0.25, suggesting that the three PON1 polymorphisms contribute with 25% of the variations in serum arylesterase activity. Similar results were obtained when the association was done between alleles and arylesterase activity (data not shown). The interaction test of PON1 polymorphisms ( 108 and 192; 108 and 55; 192 and 55) with arylesterase activity was not statistically significant ( P N 0.05) (data not shown). The arylesterase activity observed among haplotypes in the Mexican population is shown in Table 6. As expected, the haplotype 108CC/55LL/192RR was related with the highest arylesterase activity, whereas the haplotype 108TT/55MM/192QQ was associated with the lowest activity. Comparison of subjects with these two haplotypes revealed a 2.5-fold increment (93.8 vs. 237.2 U/mL) in arylesterase activity levels. The most frequent heterozygous haplotypes in the Mexican population were 108CT/55 LL/192RR (15%) and 108 CT/55 LL/192QR (14.5%), this is in agreement with values of PON1 activity, since most of the population showed an intermediate activity. PON1 genotypes as determinants of paraoxonase activity Results of logistic regression after dichotomizing paraoxonase activity at the median value (399.8 U/L) are given in Table 7. Simple logistic regression indicated an association between paraoxonase activity and polymorphisms at positions 108, 55, and 192. However, in the multiple regression analysis (taking the three polymorphic

sites as a whole), only the association between PON1 192 and paraoxonase activity remained significant (QR genotype: OR = 0.35, 95% CI 0.13–0.89; QQ genotype: OR = 0.04, 95% CI 0.01–0.13). Thus, individuals with the genotypes 192QR and 192QQ were 65% and 96%, respectively, more likely to have b399.8 U/L of paraoxonase activity than individuals with the genotype 192RR. Similar results were observed when the analysis was performed between alleles and paraoxonase activity (data not shown).

Discussion The present study evaluated PON1 phenotype and the frequency of four PON1 polymorphisms in a Mexican population. The large interindividual variation in PON1 activity observed in this work is consistent with reports in other populations (Brophy et al., 2001; Chen et al., 2003), although a clear-cut distribution among the homozygous of high activity, heterozygous, and homozygous of low activity was not observed as reported by Eckerson et al. (1983), but instead a unimodal distribution was obtained with an excess of individuals with intermediate activity. Our data, however, are consistent with other studies, in which the authors did not observe a trimodal or bimodal distribution in Chinese or African populations (Mueller et al., 1983). In addition, an excess of subjects with high activity has been reported in Nigerian populations (bnegroid distributionQ), with intermediate activity in Japanese and Chinese populations (boriental distributionQ), and with low activity in British, Germans, Italians, Swedes, and Pakistanis (bIndo-German

Table 7 Simple and multiple logistic regression analyses modeling paraoxonase activitya Genotype PON1 162 GG GA AA PON1 108 CC TC TT PON1 55 LL LM MM PON1 192 RR QR QQ a

Crude ORb

P value

1.0 2.57 2.79

– 0.28 0.23

1.0 0.83 0.37

– 0.67 0.04

1.0 0.31 –

– 0.01 –

1.0 0.22 0.02

– 0.001 0.001

Adjusted ORc

P value

1.0 0.35 0.04

– 0.03 0.0001

By dichotomizing enzymatic activity toward paraoxon at 399.8 U/L (median). b Odds Ratio and P value are from logistic regression analysis. c Adjusted by PON1 genotype at positions 108 and 55.

A.E. Rojas-Garcıá et al. / Toxicology and Applied Pharmacology 205 (2005) 282–289 Table 8 Allele frequencies of PON1 in different populations compared with those in the present study. Population

Allele 162A

AfricanAmericans AfroBrazilians CaucasianAmericans Caribbean

Reference 108C

55L

192R

0.42

0.85

0.79

0.63

ND

ND

0.71

0.53

0.20

0.38

0.54

0.27

0.26

0.65

0.71

0.46

Japanese

0.10

0.48

0.94

0.40

Spaniards

ND

0.38

0.59

0.30

Mexicans

0.21

0.45

0.84

0.49

Chen et al., 2003 Allebrandt et al., 2002 Chen et al., 2003 Chen et al., 2003 Suehiro et al., 2000 Hernańdez et al., 2003 This work

Notes. ND, not determined.

distributionQ) (Enders and Geldmancher-von Mallinckrodt, 1980). Furthermore, a recent study performed in Chinese populations proposed that the high frequency of individuals carrying the intermediate PON1 activity makes it difficult to observe the trimodal or bimodal distributions (Lin et al., 2002). Regarding the allele frequencies of PON1 polymorphisms in the Mexican population, we found frequencies of 0.21 for 162A allele and 0.45 for 108C allele from promoter region polymorphisms, which are among the reported values, although closer to Caucasian populations (Chen et al., 2003). Allele frequencies for PON1 162A range from 0.10 in Japanese populations (Suehiro et al., 2000) to 0.42 in African-Americans (Chen et al., 2003), whereas allele frequencies for PON1 108C range from 0.38 in Caucasian and Spanish populations to 0.85 in African-Americans (Chen et al., 2003; Hernańdez et al., 2003). On the other hand, the coding region polymorphisms of PON1 revealed almost the same frequency in both alleles of PON1 192 (0.51R vs. 0.49Q), and a high frequency of PON1 55L allele (0.84) similar to that observed in Caribbean, Afro-Brazilian, and Japanese populations (Allebrandt et al., 2002; Chen et al., 2003; Suehiro et al., 2000) (Table 8). The contribution of PON1 polymorphisms at positions 108, 192, and 55 in arylesterase activity found in our study showed that the three polymorphisms contribute similarly (12–13%) to the enzymatic activity, with a total predictive value for arylesterase activity of 25%, suggesting that they may be independent determinants of PON1 phenotype. These results are close to those observed in the study performed in Caribbean-Hispanics ( 108C/T and 55L/M polymorphisms contributed with 17% and 12%, respectively, to PON1 activity) (Chen et al., 2003), but different from values reported by Brophy et al. (2001) in Caucasians ( 108C/T and 55L/M polymorphisms accounted for 23% and 5%, respectively, to PON1

287

activity). On the other hand, the highest arylesterase activity observed in subjects with PON1 192RR genotype is not consistent with other reports, in which no relationship between PON1 192 polymorphism and arylesterase activity was observed in Caucasian, African-American, or Caribbean populations (Chen et al., 2003), or in which PON1 192QQ was the genotype associated with the highest arylesterase activity in Caucasians (Brophy et al., 2001). Besides, we were unable to find a statistically significant difference between PON1 162 genotypes and arylesterase activity, as previously reported (Brophy et al., 2001; Chen et al., 2003). We cannot discard that differences in genotype frequencies and genotype–phenotype relationships observed in our study might be due to the presence of other unknown polymorphic sites in the PON1 gene, or of environmental pollutants with effects on the enzymatic activity. Furthermore, there is a great variability in the PON1 gene among races, just as in other genes, therefore, the genetic complexity of the Mexican population, which is the result of a mixture of natives and extra-continental immigrants, mainly from Spain, could also explain the results presented here. Regarding the substrate-dependent activity of PON1, the crude results of PON1 activity toward paraoxon suggest that polymorphic sites 108, 55, and 192 were related with this activity; however, the multiple logistic analysis showed that only PON1 192 was associated with paraoxonase activity. Thus, carrying the Q allele was associated with 83% possibility of having b399.8 U/L paraoxonase activity with respect to the homozygous R allele. Determination of haplotypes is gaining attention because multiple linked single nucleotide polymorphisms (SNPs) have the potential to provide significantly more power for genetic analysis than individual SNPs (review in Cambien, 2001). However, we found in this work that PON1 192 polymorphism infers PON1 activity, since it was the only SNP associated with paraoxonase activity in the multivariate analysis. Due to the frequency (0.49) of the 192R allele (high activity) found in this work, we can hypothesize that Mexican populations may be more resistant to some OP toxicity than Spaniards (192R frequency of 0.30; Hernańdez et al., 2003) or Caucasians (192R frequency of 0.31; Allebrandt et al., 2002), but probably more susceptible than the Japanese (192R frequency of 0.62; Suehiro et al., 2000). To this regard, pesticides cause annually almost a million of poisonings and up to 20,000 deaths in developing countries (KleinSchwartz and Smith, 1997). In Mexico, exposure to OP compounds represents a potential risk, since agriculture is an important activity in the country. Some studies have reported toxic effects of OP in Mexican populations exposed to OP, mainly reproductive (LevarioCarrillo et al., 2004; Sańchez-Penã et al., 2004) and genotoxic effects in sperm cells (Recio et al., 2001;

288


Sańchez-Penã et al., 2004). Furthermore, 2802 cases of poisoning by OP and carbamate compounds were reported in the year 2002 (Epidemiological Surveillance System/SSA, Mexico). In addition, as previously mentioned, PON1 has been shown to hydrolyze lipid-peroxides, suggesting that the allele PON1 192Q may be important in preventing oxidative modification of LDL, which is believed to be central in the pathogenesis of atherosclerosis (Mackness et al., 1991). In Mexico, heart diseases have occupied the first place in the general mortality for the last 20 years and at least one fourth of all deaths were caused by atherosclerosis (Chavez-Dominguez et al., 2003). Therefore, the opposite scenery to that mentioned for OP toxicity is to be expected in Mexican populations, that is, those individuals carrying the allele 192Q will be more resistant to the development of cardiovascular diseases than Spanish or Caucasian populations. In summary, results presented in this study, showing PON1 genotype and phenotype, may facilitate further epidemiological studies in Mexican populations involving the influence of PON1 gene variability on the development of pesticides toxicity and vascular diseases.

Acknowledgments The authors thank MS Fernando Rivadeneira for his valuable assistance with the real-time PCR setting, Dr. Freire-Maia (Federal University of Parana´, Curitiba, Brazil) for helping with the Arlequin program, and Yulia Romero for fenotyping. This work was partially supported by CONACYT-Mexico (Grant #44643). AERG was a recipient of a scholarship from CONACYT-Mexico.

References Allebrandt, K.V., Souza, R.L., Chautard-Freire-Maia, E.A., 2002. Variability of the paraoxonase gene (PON1) in Euro- and Afro-Brazilians. Toxicol. Appl. Pharmacol. 3, 151 – 156. Blatter-Garin, MC., James, RW., Dussoix, P., Blanche, H., Passa, P., Froguel, P., Ruiz, J., 1997. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme. A possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. J. Clin. Invest. 99, 62 – 66. Brophy, V.H., Jarvik, G.P., Richter, R.J., Rozek, L.S., Schellenberg, G.D., Furlong, C.E., 2000. Analysis of paraoxonase (PON1) L55M status requires both genotype and phenotype. Pharmacogenetics 10, 453 – 460. Brophy, V.H., Jampsa, R.L., Clendenning, J.B., Mckinstry, L.A., Furlong, C.E., 2001. Effects of 5V regulatory-region polymorphisms on paraoxonase-gene (PON1) expression. Am. J. Hum. Genet. 68, 1428 – 1436. Cambien, F., 2001. Genes in population. In: Malcolm, S., Goodship, J. (Eds.), Genotype to Phenotype. Academic Press, Guildford, UK, pp. 31 – 53. Chavez-Dominguez, R., Ramirez-Hernandez, J.A., Casanova-Garces, J.M., 2003. Coronary heart disease in Mexico and the clinical epidemiological and preventive relevance. Arch. Cardiol. Mex. 73, 105 – 114.

Chen, J., Kumar, M., Chan, W., Berkowitz, G., Wetmur, J.G., 2003. Increased influence of genetic variation on PON1 activity in neonates. Environ. Health Perspect. 111, 1403 – 1409. Costa, L.G., Cole, T.B., Furlong, C.E., 2003. Polymorphisms of paraoxonase (PON1) and their significance in clinical toxicology of organophosphates. J. Toxicol. Clin. Toxicol. 41, 37 – 45. Davies, H.G., Richter, R.J., Keifer, M., Broomfield, C.A., Sowalla, J., Furlong, C.E., 1996. The effect of the human serum paraoxonase polymorphism is reversed with diazoxon, soman and sarin. Nat. Genet. 14, 334 – 336. Draganov, D.I., La Du, B.N., 2004. Pharmacogenetics of paraoxonases: a brief review. Naunyn-Schmiedebergs Arch. Pharmacol. 369, 78 – 88. Eckerson, H.W., White, C.M., La Du, B.N., 1983. The human serum paraoxonase/arylesterase polymorphism. Am. J. Hum. Genet. 35, 1126 – 1138. Enders, P., Geldmancher-von Mallinckrodt, M., 1980. Ethnische Unterschiede in der Verteilung der Aktivit7t der menschlichen Serum Paraoxonase (EC 3.1.1.2). Tag. Dtsch. Ges. Rechtsmedizin 59, 24 – 28. Epidemiological Surveillance System/Direccioń General de Epidemiologıá/ SSA. Mexico. Available at: http://www.salud.gob.mx/apps/htdocs/ estadisticas.htm. Furlong, C.E., Richter, R.J., Seidel, S.L., Motulsky, A.G., 1988. Role of genetic polymorphism of human plasma paraoxonase/arylesterase in hydrolysis of the insecticide metabolites chlorpyrifos oxon and paraoxon. Am. J. Hum. Genet. 43, 230 – 238. Geldmacher-von Mallinckrodt, M., Diepgen, TL., 1988. The human serum paraoxonase-polymorphism and specificity. Toxicol. Environ. Chem. 18, 79 – 196. Hassett, C., Richter, R.J., Humbert, R., Chapline, C., Crabb, J.W., Omiecinski, C.J., Furlong, C.E., 1991. Characterization of DNA clones encoding rabbit and human serum paraoxonase: the mature protein retains its signal sequence. Biochemistry 30, 10141 – 10149. Hernańdez, A.F., Mackness, B., Rodrigo, L., Lo´pez, O., Pla, A., Gil, F., Durrington, P.N., Pena, G., Parroń, T., Serrano, J.L., Mackness, M.I., 2003. Paraoxonase activity and genetic polymorphisms in greenhouse workers with long term pesticide exposure. Hum. Exp. Toxicol. 22, 565 – 574. INEGI., 2003. Instituto Nacional de Estadı´stica Geografıá e Informa´tica. Available at: http://www.inegi.gob.mx/inegi/default.asp. Klein-Schwartz, W., Smith, G.S., 1997. Agricultural and horticultural chemical poisoning. Mortality and morbidity in the United States. Ann. Emerg. Med. 29, 232 – 238. La Du, B.N., Piko, J.I., Eckerson, H.W., Vincent-Viry, M., Siest, G., 1986. An improved method for phenotyping individuals for the human serum paraoxonase arylesterase polymorphism. Ann. Biol. Clin. 44, 369 – 372. Levario-Carrillo, M., Amato, D., Ostrosky-Wegman, P., Gonza´lez-Horta, C., Corona, Y., Sanin, L.E., 2004. Relation between pesticide exposure and intrauterine growth retardation. Chemosphere 55, 1421 – 1427. Leviev, I., James, R.W., 2000. Promoter polymorphisms of human paraoxonase PON1 gene and serum paraoxonase activities and concentrations. Arterioscler. Thromb. Vasc. Biol. 20, 516 – 521. Li, W.F., Costa, L.G., Richter, R.J., Hagen, T., Shih, D.M., Tward, A., Lusis, A.J., Furlong, C.E., 2000. Catalytic efficiency determines the invivo efficacy of PON1 for detoxifying organophosphorus compounds. Pharmacogenetics 10, 767 – 779. Lin, T.J., Jiang, D.D., Hung, D.Z., Yang, D.Y., Hsu, C.L., Tsai, M.S., 2002. Paraoxonase activities in Minnan and Hakka Kaohsiung. J. Med. Sci. 18, 551 – 556. Mackness, M.I., 1989. dAT-esterases. Enzymes looking for a role? Biochem. Pharmacol. 38, 385 – 390. Mackness, M.I., Arrol, S., Durrington, P.N., 1991. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett. 286, 152 – 154. Mackness, M.I., Durrington, P.N., 1995. HDL, its enzymes and its potential to influence lipid peroxidation. Atherosclerosis 115, 243 – 253.

A.E. Rojas-Garcıá et al. / Toxicology and Applied Pharmacology 205 (2005) 282–289 Mueller, R.F., Hornung, S., Furlong, C., Anderson, J., Giblett, E.R., Motulsky, A.G., 1983. Plasma paraoxonase polymorphism: a new enzyme assay, population, family, biochemical and linkage studies. Am. J. Hum. Genet. 35, 393 – 408. Primo-Parmo, S.L., Sorenson, R.E., Teiber, J., La Du, B.N., 1996. The human serum paraoxonase/arylesterase gene (PON1) is a member of a multigene family. Genomics 33, 498 – 509. Recio, R., Robbins, W.A., Borja-Aburto, V., Morań-Martıńez, J., Froines, J.R., Hernańdez, R.M., Cebriań, M.E., 2001. Organophosphorous pesticide exposure increases the frequency of sperm sex null aneuploidy. Environ. Health Perspect. 109, 1237 – 1240.

289

Sańchez-Penã, L.C., Reyes, B.E., Lo´pez-Carrillo, L., Recio, R., Morań-Martıńez, J., Cebriań, M.E., Quintanilla-Vega, B., 2004. Organophosphorous pesticide exposure alters sperm chromatin structure in Mexican agricultural workers. Toxicol. Appl. Pharmacol. 196, 108 – 113. Schneider, S., Roessli, D., Excoffier, L., 2000. Arlequin, version 2000. Laboratory of Biometry and Genetics. University of Geneva, Switzerland. Suehiro, T., Nakamura, T., Inoue, M., Shinoki, T., Ikeda, Y., Kumon, Y., Shindo, M., Tanaka, H., Hashimoto, K., 2000. A polymorphism upstream from the human paraoxonase (PON1) gene and its association with PON1 expression. Atherosclerosis 150, 295 – 298.