Mammalian Genome 11, 64–68 (2000).
Incorporating Mouse Genome
© Springer-Verlag New York Inc. 2000
Genomic cloning, chromosomal mapping, and expression analysis of Msal-2 Ju¨rgen Kohlhase,* Mariele Altmann,* Leticia Archangelo, Christa Dixkens, Wolfgang Engel Institut fu¨r Humangenetik der Universita¨t Go¨ttingen, Heinrich-Du¨ker-Weg 12, D-37073 Go¨ttingen, Germany Received: 1 June 1999 / Accepted: 26 August 1999
Abstract. Mutations of SALL1 related to spalt of Drosophila have been found to cause Townes-Brocks syndrome, suggesting a function of SALL1 for the development of anus, limbs, ears, and kidneys. No function is yet known for SALL2, another human spalt-like gene. The structure of SALL2 is different from SALL1 and all other vertebrate spalt-like genes described in mouse, Xenopus, and Medaka, suggesting that SALL2-like genes might also exist in other vertebrates. Consistent with this hypothesis, we isolated and characterized a SALL2 homologous mouse gene, Msal2. In contrast to other vertebrate spalt-like genes both SALL2 and Msal-2 encode only three double zinc finger domains, the most carboxyterminal of which only distantly resembles spalt-like zinc fingers. The evolutionary conservation of SALL2/Msal-2 suggests that two lines of sal-like genes with presumably different functions arose from an early evolutionary duplication of a common ancestor gene. Msal-2 is expressed throughout embryonic development but also in adult tissues, predominantly in brain. However, the function of SALL2/Msal-2 still needs to be determined.
zinc finger units of the SAL-type, SALL2 encodes only three. Also, in contrast to Msal, Xsal-1, and SALL1, SALL2 does not contain a 3⬘ intron (Kohlhase et al. 1996). The most carboxyterminal zinc finger domain in SALL2 consists of 51 amino acids instead of 49 in the typical SAL double zinc finger, and it does not contain the “SAL box”, a sequence of eight amino acids (FTTKGNLK) characteristic for SAL zinc fingers (Ku¨hnlein et al. 1994). However, the remaining zinc finger domains, as well as the structure of the predicted protein, are very similar to SAL, indicating that SALL2 is a true member of the sal-like gene family (Kohlhase et al. 1996). In order to investigate whether the characteristic structure of SALL2 was conserved during evolution as suggested by comparison with Msal, Xsal-1, and SALL1, we searched for a SALL2 homologous gene in mouse. Here we report the isolation, characterization, and chromosomal localization of this gene (Msal-2). Materials and methods
Introduction The region-specific homeotic gene spalt (sal) of Drosophila melanogaster is required for the specification of larval posterior head and anterior tail structures during embryogenesis (Ju¨rgens 1988). Furthermore, sal plays an important role in the embryonic development of the larval tracheal system and the adult wing morphogenesis (de Celis et al. 1996; Ju¨rgens 1988; Ku¨hnlein and Schuh 1996; Lecuit et al. 1996; Nellen et al. 1996; Sturtevant et al. 1997). sal belongs to the group of C2H2 zinc finger transcription factors and is characterized by a distinct molecular structure with three double zinc finger domains distributed over the entire protein (Ku¨hnlein et al. 1994). sal-related genes of Xenopus laevis (Xsal1), mouse (Msal), Medaka fish (Medaka sal), and human (SALL1, SALL2) have been described (Hollemann et al. 1996; Kohlhase et al. 1996; Ko¨ster et al. 1997; Ott et al. 1996). Mutations of SALL1 have been found to cause Townes-Brocks syndrome (MIM #104780), an autosomal, dominantly inherited malformation syndrome, thereby suggesting an important developmental regulatory function for SALL1 (Kohlhase et al. 1998). The other human sal-like gene (SALL2) has a different structure compared with SALL1 and the other sal-like vertebrate genes (Kohlhase 1996; Kohlhase et al. 1996), and the degree of similarity between SALL2 and SALL1 is not higher than between SALL2 and Msal or Xsal-1 (Kohlhase 1996). While Msal (Ott et al. 1996), Xsal-1 (Hollemann et al. 1996), and SALL1 encode four double * Both authors contributed equally to this work. Correspondence to: J. Kohlhase, email:
[email protected] Sequence data from this article have been deposited with the EMBL / GenBank Databases under Accession No. AJ007396.
Genomic library screening and DNA analysis. 2 × 106 phage clones of a lambda FIX II mouse genomic library of the mouse strain 129 (Stratagene, La Jolla, Calif., USA) were hybridized with a 32P-labeled SALL2 DNA fragment. Hybridization was carried out overnight at 60°C. Filters were washed 1 × 20 min at room temperature (RT) in 2 × SSPE, 0.1% SDS, followed by 2 × 20 min at 60°C in 2 × SSPE, 0.1% SDS. Hybridizing phage clones were isolated, restriction mapped, partly subcloned into pBluescript KS and sequenced by the dideoxy chain termination method on an ABI 377 automated sequencer according to the Dye terminator protocol (Applied Biosystems, Neu Isenburg). Screening procedures, DNA preparation, Southern blotting, restriction analysis, and subcloning procedures were performed as described (Sambrook et al. 1989). Larger genomic fragments were obtained by high stringency screening (according to standard procedures) of a computer-spotted cosmid library of the mouse strain 129ola with a 32P-labeled Msal-2 fragment. Computer-spotted library filters (library no. 121) as well as cultures of isolated clones were supplied by the Resource Center of the German Human Genome Project (RZPD; Berlin, Germany). For isolation of Msal-2 exon 1, the restriction-digested cosmid DNA was Southern blotted onto Nylonbind A membranes (Serva, Heidelberg, Germany) and hybridized with a SALL2 exon 1 cDNA fragment. Hybridization and washing conditions (reduced stringency) were as described above for phage library screening.
Northern blotting. Total RNA was isolated from different adult mousetissues (brain, heart, liver, lung, spleen, skeletal muscle, kidney, ovary, and testis) with Total RNA Isolation Reagent according to the manufacturer’s instructions (Biomol, Hamburg). Approximately 20 g of total RNA of each tissue was used for Northern blotting. Treatment of the RNA, electrophoresis, and blotting procedures were performed as described (Sambrook et al. 1989). The filter was hybridized with a 2.4-kb BamHI genomic DNA fragment (32P-labeled) of Msal-2, which contains the first and the second double zinc finger domain. For testing of RNA integrity and loading amount, the blot was rehybridized with a 32P-labeled 1.6-kb BamHI/ BgIII fragment of human elongation factor 2 cDNA (Rapp et al. 1989). Both hybridization steps were performed overnight at 42°C in a hybrid-
J. Kohlhase et al.: Msal-2 gene ization solution containing 50% formamide. The filter was washed after each hybridization for 20 min in 2 × SSC at room temperature, 10 min in 2 × SSC, 0.1% SDS at 65°C, and finally 5 min in 0.2 × SSC, 0.1% SDS at 65°C.
5⬘ RACE. 5⬘ RACE was performed on mouse adult brain total RNA prepared as described above with the 5⬘ RACE System (GibcoBRL, Paisley, UK) according to the manufacturer’s instructions. For first-strand cDNA synthesis, primer MS2-5 (5⬘ACCAGGAATTGCCCAGAAGAT3⬘) was used. After first-strand synthesis, cDNA was poly-C tailed with terminal transferase. A first round of PCR was carried out with the abridged anchor primer supplied by the manufacturer and MS2R994 (5⬘ATGAGTTCTGGTGAGCGAG3⬘). A nested amplification was carried out by the same procedure with the following changes: 1 l amplification product of first- round PCR was used as template, primers were anchor primer (supplied by manufacturer) and MS2R933 (5⬘ACTTGGGGGTGGTGTTCC3⬘). Amplification products of first-and second-round PCR were analyzed by agarose gel electrophoresis, subcloned into pGEM-T (Promega), and sequenced on both strands.
RT PCR. Total RNA was isolated from mouse embryos 8.5–17.5 days post coitum (p.c.) with the SV total RNA isolation system (Promega, Madison, WI, USA) according to the manufacturer’s instructions; 2 g of total RNA from each stage was reverse transcribed with Ready-To-Go™ You-Prime First Strand Beads (Amersham Pharmacia, Uppsala, Sweden) and 20 pmol each of primers MS2-5 and mGADPHr (5⬘ATGACCTTGCCCACAGCCTT3⬘). Of each first-strand reaction, 1 l was used as a template in three subsequent PCR reactions with primers (1) HM1 (5⬘AGAGTGTGCGGAAACATTAG3⬘) and MS2R994, (2) E1BF1 (5⬘ACCGGATACCCATTGTGTC3⬘) and MS2R994, and (3) mGADPHf (5⬘CATCACCATCTTCCAGGAGC3⬘) and mGADPHr. Primer sequences for mGADPH were derived from the published mGADPH sequence (Sabath et al. 1990). Amplification products were visualized on agarose gels. DNA sequences of amplification products were verified by direct sequencing.
Chromosomal localization. DNA of the Msal-2 genomic phage clone was labeled with digoxigenin-11-dUTP by nick translation and hybridized in situ to metaphases of the WMP-1 cell line (Zo¨rnig et al. 1995) from newborn WMP mice carrying Robertsonian translocation chromosomes (Said et al. 1986). Signal detection via fluoresceinated avidin (FITCavidin) was performed as described (Lichter et al. 1988). Chromosomes were counterstained with 4,6,-diamine-2-phenylindole dihydrochloride (DAPI). Images of emitted light were captured separately by use of the DAPI and FITC filter set and subsequently merged and aligned.
Database searches and accession numbers. GenBank and GenBank EST division were screened for Msal-2 and SALL2 clones. Msal-2 cDNA sequence has been deposited at the EMBL database under accession number AJ007396.
Results Cloning of a murine SALL2 homolog. In order to clone a murine SALL2 homolog, a mouse genomic phage library (Stratagene) was screened under reduced stringency conditions with an EcoRI 1.9kb SALL2 cDNA fragment containing sequence information for the first and the second double zinc finger domain. One phage clone was isolated, the insert of which, a 14-kb genomic DNA fragment, was characterized in further detail. A contiguous stretch of 5495 bp was sequenced from overlapping subclones hybridizing to the SALL2 cDNA fragment. In its 5⬘ region, the sequence was found to encode a presumed C2HC zinc finger motif, followed by sequences coding for three C2H2 double zinc finger domains towards the 3⬘ end, all of which—including the characteristic most carboxyterminal domain—show high homology to SALL2 (Fig. 1). The length of the sequence between the first zinc finger motif and the in-frame stop codon almost exactly matches the length of the corresponding SALL2 coding region (exon 2), suggesting that
65
the isolated gene, like SALL2, contains no intron separating the zinc finger domains. On the basis of the high similarity to SALL2, we named the gene Msal-2. Within the analyzed part of the gene, no sequence corresponding to exon 1 of SALL2 was found 5⬘ wards of the C2HC zinc finger motif. Furthermore, hybridization with a 336-bp EcoRI SALL2 cDNA fragment containing exon 1 at reduced stringency conditions did not reveal exon 1-containing fragments within the phage clone. Subsequently, a larger fragment of the Msal-2 gene was isolated by screening of a mouse genomic cosmid library (see Materials and methods) with a Msal-2 2.4-kb BamHI fragment containing the first and the second double zinc finger domain (Fig. 5). One positive clone was identified and restriction mapped. In order to identify the first exon of Msal-2, the cosmid clone was digested with different restriction enzymes and hybridized at reduced stringency conditions with a 336-bp EcoRI SALL2 cDNA fragment containing exon 1. A hybridizing 1.6-kb EcoRI/HindIII fragment was identified, subcloned, and sequenced. It was found to encode an amino acid sequence 85% identical to SALL2 exon 1 (Fig. 1). RT PCR and direct sequencing of amplification products were performed to prove that the sequence was indeed part of the transcript, and to identify exon-intron boundaries (Table 1). The position of the presumed start codon is identical to SALL2. Comparison of the amino acid sequences encoded by exons 1 and 2 of SALL2 and Msal-2 revealed an overall identity of 85% (Fig. 1). Based on restriction mapping of the cosmid, the intron separating exons 1 and 2 in Msal-2 was estimated to be 12 kb in size (Fig. 5). In order to determine the 3⬘ end of the Msal-2 transcription unit, electronic databases were searched for the presence of Msal-2 EST sequences. A murine EST (accession number W57057) was identified which overlapped with the 1.1-kb BamHI fragment harboring the stop codon (Fig. 5). The cDNA clone (Lennon et al. 1996) containing the EST sequence (I.M.A.G.E. Consortium clone ID 372050) was obtained from the Resource Center of the German Human Genome Project (RZPD; Berlin, Germany), and the clone sequenced in its entirety to reveal a contiguous sequence of 1134 bp ending with a poly A tail. The transcript, therefore, includes 3012 bp of coding region, 1545 bp of 3⬘UTR, and an unknown stretch of 5⬘UTR. Transcription startpoint analysis and alternative splicing. In order to identify the transcription startpoint, primer extension analysis was performed but revealed no conclusive result. Therefore, 5⬘RACE was conducted. By this method, two cDNA fragments of different sizes were amplified. Sequencing of the longer fragment (fragment 1) revealed sequence information including the predicted start codon and further 390 bp of 5⬘UTR sequence. The shorter cDNA fragment 2 shared the exon 2 sequence with fragment 1, but both fragments differed in their 5⬘ part. The 5⬘ sequence of fragment 2 was found within the Msal-2 genomic sequence upstream of the splice acceptor site (Fig. 5, Table 1). Between the sequence and exon 2, an intron of 380 bp was identified, starting with a consensus splice donor site (Fig. 2a, Table 1). The novel exon (named exon 1a) also encodes a potential start codon (Fig. 2b) preceded by an in-frame stop codon 354 bp upstream of the putative start codon (not shown). No RT PCR or 5⬘RACE product was found to contain sequences from both exon 1 and exon 1a. In order to examine whether the novel exon was also conserved in SALL2, we compared its sequence with the sequence of a human BAC clone from the T-cell receptor alpha delta region (GenBank accession # AE000758), which was found (by database analysis) to contain the whole SALL2 gene. A stretch of homologous sequence was found at a position corresponding to Msal-2 (Fig. 2a). Comparison of the nucleotide and deduced amino acid sequences of both presumed exons 1a also confirmed conservation of the start codon and the splice donor site in human SALL2 (Fig. 2a,b; Table 1).
66
J. Kohlhase et al.: Msal-2 gene
Fig. 1. Sequence alignment of the deduced amino acid sequences of Msal-2 (exons 1 and 3, upper sequence) and SALL2 (lower sequence) shows a high overall homology. Zinc finger motifs are underlined. The DNA sequences have been deposited in the EMBL database under the accession numbers X98834 (SALL2) and AJ007396 (Msal-2).
Expression analysis. Northern blot analysis of Msal-2 with total RNA prepared from various mouse adult tissues showed an Msal-2 transcript of approximately 5 kb with strongest expression in brain (Fig. 3). A lower amount of the transcript was found in lung, kidney, and ovary. No transcripts were detected in heart, liver, spleen, skeletal muscle, and testis. RT PCR was performed to analyze temporal expression of Msal-2 in mouse embryos from day 8.5 to 17.5 post coitum. With primers of exon 1 and exon 2, expression was detected from day
Table 1. Exon-intron boundaries in Msal-2. Exon 1 1a 2
3⬘ splice acceptor
5⬘ splice donor TCTGAAAACGgtgggtgctgggggc GAGCGCGGAGgtgcggtagggccag
ttgtcttctccccagGTGATGCTAG
Sequences of the splice donor and acceptor sites in Msal-2 as determined by comparison of genomic DNA sequence and RT PCR products. Exonic sequence is capitalized; intronic sequence is lower-cased.
J. Kohlhase et al.: Msal-2 gene
67 Fig. 2. (a) Comparison of exon 1a coding sequences of Msal-2 (upper) and SALL2 (lower). (b) Comparison of corresponding amino acid sequences. Note high sequence similarity of exon 1a between Msal-2 and SALL2. Splice donor sites (underlined) are also present in both sequences. Intronic sequences are lower cased. SALL2 sequence of the corresponding region has been found within a contiguously sequenced genomic BAC clone (GenBank accession # AE000658) from the human T-cell receptor alpha delta locus.
Fig. 3. Northern blot containing 20 g total RNA per lane from nine different tissues of adult mice. The blot was hybridized (a) with cDNA probes for Msal-2 (BamHI 2.4 kb) detecting a transcript of approximately 5 kb, and (b) Human Elongation Factor 2 (HEF2) as a control for the loading and the integrity of the RNA preparation detecting a transcript of appr. 3 kb. Tissues (a, b) are: brain (B), heart (H), liver (Li), lung (Lu), spleen (Sp), skeletal muscle (SM), kidney (K), ovary (O), testis (T).
9.5 onwards (Fig. 4a), whereas primers from exons 1a and 2 (Fig. 4b) revealed expression in all stages examined. In both cases, no significant difference in the strength of expression was found between embryos of later developmental stages. Chromosomal localization. In order to examine the chromosomal localization of Msal-2, we performed FISH on the mouse cell line WMP-1 (Zo¨rnig et al. 1995); this revealed localization of Msal-2 on mouse Chr 14 B-C1 (Fig. 5b). Discussion In this paper we describe the combined genomic and partial cDNA cloning of a murine gene named Msal-2. Our results indicate that this gene is the ortholog of SALL2. Both genes encode very similar proteins with high overall sequence similarity, both contain no 3⬘ intron, and both encode three double zinc finger domains including the characteristic carboxyterminal domain consisting of 51 amino acids. A further indication that Msal-2 is orthologous to SALL2 is given by the chromosomal localization of Msal-2 in a region syntenic to human Chr 14, where SALL2 is located (Kohlhase et al. 1996). In our previous study on human SALL2, we reported that the gene consists of only two exons (Kohlhase et al. 1996). Unexpectedly, 5⬘RACE revealed the existence of an additional exon 5⬘ to the zinc finger encoding exon in Msal-2. However, consecutive identification of a homologous sequence in the corresponding SALL2 genomic region confirmed evolutionary conservation also of this feature. Therefore, we assume that both Msal-2 and SALL2
Fig. 4. RT PCR with total RNA from whole mouse embryos of days 8.5 to 17.5 p.c. (a) Amplification of a 461-bp product with primers from exon 1 (forward) and exon 2 (reverse) reveals expression starting from day 9.5. (b) Amplification of a 180-bp product with exon 1a (forward) and exon 2 (reverse) primers detects expression in all examined stages. (c) Control RT PCR amplification of a 450-bp mGADPH fragment from the same RNA samples reveals that comparable amounts of cDNA have been generated by reverse transcription. M: DNA size marker (1-kb ladder, GibcoBRL). C: control PCR reactions in which template cDNA was replaced by water show no amplification.
consist of three instead of two exons. Our results show that both exons 5⬘ of the large coding exon contain a possible start codon, and (in Msal-2) both exons are alternatively spliced in front of the zinc finger encoding exon. Even though an alternative transcript has not been previously identified in SALL2, two different transcripts are likely to be made both from Msal-2 and from SALL2. The fact that only one signal can be detected by Northern analysis (Fig. 3; Kohlhase et al., 1996) might be owing to a small difference in size of both mRNAs. Failure to detect a second transcript in human could be explained by the fact that 5⬘RACE had not been performed. Screening of human cDNA libraries had revealed only a single cDNA clone containing sequence 5⬘ of exon 2 (Kohlhase et al. 1996). So far, no other sal-like gene has been found to contain two alternative 5⬘ coding exons. Therefore, our results further strengthen the particular position of SALL2 and Msal-2 within the family of sal-like vertebrate genes. The Msal-2 transcript, consisting of exons 1a and 2, is expressed from day 8.5 p.c. on, whereas the exon 1—exon 2 mRNA is not yet expressed at day 8.5 p.c. This implies that expression of these products might be under control of different regulatory elements. However, it remains to be shown (1) whether the slight difference in temporary expression reflects different functional properties of both gene products, (2) whether there is also a difference in the spatial expression pattern of both transcripts, and (3) whether indeed two different proteins are made from Msal-2. Our results indicate that Msal-2 and SALL2 are similarly expressed in adult tissues with both genes being predominantly expressed in brain (Kohlhase et al. 1996). The detection of SALL2 (Kohlhase et al. 1996) and Msal-2 transcripts during embryonic development suggests that Msal-2/SALL2, like SALL1, might act as developmental regulators. The cloning of a SALL2 orthologous gene in mouse sheds further light on the evolution of the sal-like gene family. Two lines
68
J. Kohlhase et al.: Msal-2 gene
References
Fig. 5. Genomic organization (a), and chromosomal localization (b) of Msal-2. The upper bar represents the genomic region of Msal-2 covered by two overlapping cosmid and -phage clones. Boxes indicate the exons, stripes within them the position of the sequences coding for zinc finger motifs. The thin box-connecting line represents the intron. Note that exon 1a encodes an alternative start codon and is positioned within the intron between exon 1 and exon 2. 5⬘ and 3⬘ UTRs (hatched white boxes) of the Msal-2 cDNA are indicated. (b) Chromosomal localization as by fluorescence in situ hybridization (FISH) of a metaphase from WMP-1 murine cells with a DNA probe specific for Msal-2. The arrows point to the specific signal on both chromosomes Rb (5.14) at 14B-C1. B: BamHI, E: EcoRI, P: PstI, S: SacI, X: XbaI, cos 5⬘/ cos 3⬘: 5⬘ and 3⬘ sequence of the Msal-2 cosmid.
of sal-like genes have now been shown to exist in mouse and in human, and might also exist in other vertebrates: one line encoding four double zinc finger domains (and containing a 3⬘ intron) to which SALL1, Msal-1, and Xsal-1 belong, and another line of genes encoding three double zinc finger domains represented by Msal-2 and SALL2, which also lack the 3⬘ intron. We assume that duplication of a common spalt-like ancestor gene at some time in vertebrate evolution created two genes that consecutively adopted different functions. Cloning of SALL2-like genes from Xenopus and fish species could further elucidate at which time point in evolution this duplication might have occurred. Acknowledgments. We thank Rene´ Heise for technical assistance. This work was supported the Deutsche Forschungsgemeinschaft (grant Ko1850/ 3-1 to J. Kohlhase).
de Celis JF, Barrio R, Kafatos FC (1996) A gene complex acting downstream of dpp in Drosophila wing morphogenesis. Nature 381, 421–424 Hollemann T, Schuh R, Pieler T, Stick R (1996) Xenopus Xsal-1, a vertebrate homolog of the region specific homeotic gene spalt of Drosophila. Mech Dev 55, 19–32 Ju¨rgens G (1988) Head and tail development of the Drosophila embryo involves spalt, a novel homeotic gene. EMBO J 7, 189–196 Kohlhase J (1996) Isolierung und Charakterisierung einer humanen Genfamilie mit A¨hnlichkeit zu spalt, einem regionsspezifischen homo¨otischen Gen von Drosophila melanogaster. Doctoral dissertation, University of Go¨ttingen, Go¨ttingen. Kohlhase J, Schuh R, Dowe G, Ku¨hnlein RP, Ja¨ckle H et al. (1996) Isolation, characterization, and organ-specific expression of two novel human zinc finger genes related to the Drosophila gene spalt. Genomics 38, 291–298 Kohlhase J, Wischermann A, Reichenbach H, Froster U, Engel W (1998) Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat Genet 18, 81–83 Ko¨ster R, Stick R, Loosli F, Wittbrodt J (1997) Medaka spalt acts as a target gene of hedgehog signalling. Development 124, 3147–3156 Ku¨hnlein RP, Frommer G, Friedrich M, Gonzalez-Gaitan M, Weber A et al. (1994) spalt encodes an evolutionary conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo. EMBO J 13, 168–179 Ku¨hnlein RP, Schuh R (1996) Dual function of the region specific homeotic gene spalt during Drosophila tracheal system development. Development 122, 2215–2223 Lecuit T, Brook WJ, Ng M, Calleja M, Sun H et al. (1996) Two distinct mechanisms for long-range patterning by Decapentaplegic in the Drosophila wing. Nature 381, 387–393 Lennon G, Auffray C, Polymeropoulos M, Soares MB (1996) The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33, 151–152 Lichter P, Cremer T, Borden J, Manuelidis L, Ward DC (1988) Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum Genet 80, 224–234 Nellen D, Burke R, Struhl G, Basler K (1996) Direct and long-range action of a DPP morphogen gradient. Cell 85, 357–368 Ott T, Kaestner KH, Monaghan AP, Schu¨tz G (1996) The mouse homolog of the region specific homeotic gene spalt of Drosophila is expressed in the developing nervous system and in mesoderm-derived structures. Mech Dev 56, 117–128 Rapp G, Klaudlny J, Hagendorff G, Luck MR, Scheit KH (1989) Complete sequence of the coding region of human elongation factor 2 (EF-2) by enzymatic amplification of cDNA from human ovarian granulosa cells. Biol Chem Hoppe Seyler 370, 1071–1075 Sabath DE, Broome HE, Prystowsky MB (1990) Glyceraldehyde-3phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene 91, 185–191 Said K, Jaqart T, Montgelard C, Sonjaya H, Helal AN, Britton-Davidian J (1986) Robertsonian house mouse population in Tunisia: a karyological and biochemical study. Genetica 68, 151–156 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press) Sturtevant MA, Biehs B, Marin E, Bier E (1997) The spalt gene links the A/P compartment boundary to a linear adult structure in the Drosophila wing. Development 124, 21–32 Zo¨rnig M, Klett C, Loav H, Hameister H, Winking H et al. (1995) Establishment of permanent wild-mouse cell lines with readily identifiable marker chromosomes. Cytogenet Cell Genet 71, 37–40
