The swabs were inoculated on Mannitol Salt agar an incubated aerobically for 24 hours. Any suspected Staphylococcus aureus colonies were systematically.
Egyptian Journal of Medical Microbiology, October 2014
Vol. 23, No. 4
Genotypic Detection of Enterotoxin Producing Staphylococcus aureus in Food Ayman A. Allam, Maher A. Al Shafei, Ahmad A Shaheen, and Faiza M Fathi Microbiology and Immunology, Faculty of medicine, Zagazig University ABSTRACT Background and objectives: Staphylococcus aureus is one of the most commonly identified bacteria that cause food poisoning by virtue of its variety of enterotoxins, Nasal and hand carriage of enterotoxigenic Staphylococcus aureus is an important source of staphylococcal food contamination in restaurants, therefore it is important to detect Staphylococcus aureus carriage among foodhandlers to prevent possible food contamination .The objective of the study was to detect prevalence of enterotoxigenic strains of staphylococcus aureus among food handlers in Zagazig City and to evaluate phenotypic (SETRPLA) versus genotypic (multiplex PCR) methods for detection of the staphylococcal enterotoxins. Methods: Two hundred and seventy swabs of (nose, hand and axilla) were collected randomly from 90 food workers; 3 swabs from each food worker. The swabs were inoculated on Mannitol Salt agar an incubated aerobically for 24 hours. Any suspected Staphylococcus aureus colonies were systematically identified according to standard methods. Staphylococcus aureus isolates were subjected to SET-RPLA test using SET-RPLA Toxin Detection Kit for phenotypic detection of enterotoxin production and Multiplex-PCR to genetically detect enterotoxigenic strains. Results: Carriage rate among the food handlers was 55.5% representing 50 Staphylococcal aureus isolates from 90 food handler, the proportion of contaminated samples among 270 swabs was 18.5% (50\270). 38(76%) out of 50 isolates were found to be enterotoxigenic by SET-RPLA and 42 (84%) out of 50 staphylococcal isolates were found to be enterotoxigenic genotypically by multiplex PCR. The number of isolates was significantly higher in nasal swabs than in hand or axillary swabs (χ2 =36.87 & p=0.0000). Using REPLA, the number of enterotoxin producing organisms was significantly higher in nasal swabs (91.2%) than in hand (38.5%) or axillary swabs (66.6%) {χ2 = = 14.48 &p = 0.0007}. Type A enterotoxin was the most common type (48%) followed by type D (18%), then type C (6%) while the least type was type A+B (4%). It also shows that type A+B was isolated only from nasal swabs (2.9%) and type D was not found in axillary swabs. Using Multiplex PCR, gene type a was the most common type (48%) followed by gene type d (22%), then gene type c (6%) while the least type was genes type a+ b (4%). It also shows that gene types a+b and b+d were isolated only from nasal swabs (5.9% each). Compared with multiplex PCR, specificity and positive predictive value of RPLA were 100%, while sensitivity was 90.48% and negative predictive value was 66.67%. Conclusion and recommendations: This study concluded that nasal and hand carriage of enterotoxigenic S.aureus by food handlers is an important source of staphylococcal food contamination in restaurants and fast food outlets so it is important to detect S.aureus carriage among food handlers to prevent possible food contamination by them resulting in food poisoning.It also concluded that multiplex PCR is reliable and valuable method in detection of enterotoxigenic S.aureus strains and it is more sensitive and specific than SET-RPLA. This study recommended health education of food handlers to decrease contamination of their hands, settings training courses for food handlers to learn them the proper hand washing technique and frequent examination of food handler to find and treat. It also recommends screening food workers to identify staphylococcus aureas carriers and referring them to the appropriate health authorities for decolonization. These enterotoxins are small peptides (26 to 29 KDa) and have a great deal of similarity at the amino acid level (3). The enterotoxins belong to a family of superantigens(4). Food handlers include those individuals employed directly in the production and preparation of food stuffs, including the manufacturing, processing, catering, and hospitality and retail industries. However, the definition can also encompass workers undertaking maintenance work or repairing
INTRODUCTION Staphylococcus aureus (S.aureus) is one of the most commonly identified bacteria that cause food poisoning by virtue of its variety of enterotoxins (1). S.aureus may produce a large variety of enterotoxins (A,B,C,D,E,G,H,I,J,K,L,M,N,O,P,Q,R and U) but 95% of poisoning outbreaks are caused by classical enterotoxins: A,B,C,D and E (2).
37
Egyptian Journal of Medical Microbiology, October 2014
Vol. 23, No. 4
Two hundred and seventy swabs of (nose, hand and axilla) were collected randomly from 90 food workers; 3 swabs from each food worker. The swabs were inoculated on Mannitol Salt agar an incubated aerobically for 24 hours. Any suspected Staphylococcus aureus colonies were systematically identified according to standard methods by coagulase test and DNase test (7). Staphylococcus aureus isolates were subjected to SET-RPLA test using SET-RPLA Toxin Detection Kit (Oxoid, UK), for phenotypic detection of enterotoxin production and Multiplex-PCR to detect enterotoxigenic strains. Reversed Passive Latex Agglutination Assay: Six to eight colonies of each isolated Staphylococcus aureus strain were inoculated into 10 ml tryptone soya broth and incubated at 37° C for 18 to 24 hours. After incubation, the sample was centrifuged at 900g for 20 minutes at 4°C and the supernatant was used for the REPLA assay. Srial dilution of the supernatant is done in microtiter plate. Latex sensitised with antienterotoxins are added and mixed. Agglutination occurred in case of presence of Staphylococcus aureus enterotoxin which resulted in the formation of a lattice structure that formed a diffuse layer on the base of the well upon settling (Fig. 1). Results were classified as (+), (++), and (+++) were considered positive. If the enterotoxin was absent or at a concentration below the assay detection level, no such lattice structure can be formed and, therefore, a tight button was observed. Multiplex PCR: Bacterial DNA extraction: DNA was extracted from the colonies using -genomic BYF DNA Extraction Mini Kit, (Cat. No. 17361) (iNtRON Biotechnology, Korea). All strains were freshly subcultured on nutrient agar before DNA extraction. DNA extraction was performed according to manufacturer instructions.
equipment in food-handling areas, and visitors to food-handling areas(5). Nasal and hand carriage of enterotoxigenic Staphaureus by food handlers is an important source of Staphylococcal food contamination in restaurants and fast food outlets. Therefore it is important to detect Staphaureus carriage among food handlers to prevent possible food contamination by them (6). Food handling involves all aspects of treatment and storage of food from receipt of raw materials to the delivery of the prepared product. Infected food handlers are those individuals who carry infection either with or without symptoms. Food handlers have transmitted both enteric and non-enteric infections via the food that they handled (5). Many food handlers who go off sick with a food-borne disease appear to make their own decision about returning to work and do not consult their general practitioner (GP) or an occupational health professional. This is suggested by a number of reports of food handlers continuing to work while suffering with diarrhoea, vomiting or pyrexia (5). Most food handlers do not have access to occupational health advice and because relevant illness is generally short lived, they will usually self-certify as fit or unfit for work. The aim of this work is to detect the prevalence of entertoxigenic strains of staphylococcus aureus among food handlers in Zagazig city and to detect toxin genes by multiplex PCR.
MATERIAL & METHODS This work was carried out in the Microbiology and Immunology Department of the Faculty of Medicine, Zagazig University during the period from January, 2012 to Augast, 2014. Table (1): shows the primers used in the study (8) Gene
Primar
Oligonucleotide sequence (5/- 3/)
Sea
Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer
GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG GTATGGTGGTGTAACTGAGC CCAAATAGTGCGAGTTAGG AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG CCAATAATAGGAGAAAATAAAAG ATTGGTATTTTTTTTCGTTC AAAAAAGCACATAACAAGCG GATAAAGAAGAAACCAGCAG
Seb Sec Sed Fem A
38
Size of amplified product (bp) 102 164 451 278 132
Egyptian Journal of Medical Microbiology, October 2014
1- DNA amplification: the extracted DNA was used for amplification of enterotoxin genes A, B, C, D using five pairs of primers shown in table (1). These primers were previously described (8) and obtained from the (Biolegio, Netherlands) oligonucleotide synthesis facility. 2- 2x PCR Master Mix Solution (i-TaqTM) tubes (iNtRON Biotechnology, Korea) was used for DNA amplification. 4 µl of the extracted DNA was processed in a 50 µl reaction volume. This reaction volume contain, 25 µl of PCR premix, 4 µl of the template DNA, 1 µl of each forward and reverse primer (20 picomoles/µl) for each of Sea, Seb, Sec, fem A genes, and 2 µl of each primer for Sed(40 picomoles/µl). 3- Amplification conditions: Reaction mixture was amplified with a heated lid thermal cycler using the following amplification conditions(8): initial denaturation at 94°C for 5 minutes, followed by 35 cycles at 94°C for 2 minutes, 57°C for 2 minutes, 72°C for 1 minutes, and a final extension at 72°C for 7 minutes. For the negative control reaction, all the components of PCR reaction were added to the tube except for template DNA. The products of amplification were detected by electrophoresis in 1.5% agarose gel with ethidium bromide 0.5 µg /ml at 120 mV for 30 minutes. A molecular weight marker (1 kb DNA ladder; Fermentans) was run concurrently. Positive reactions give a band of the corresponding size (Fig 2). STATISTICAL ANALYSIS Data were entered checked and analyzed using Epi-Info version 6 and SPP for windows version 8. X2 (chi-squared) (test of significance) is used for difference between two or more qualitative variable. p < 0.05 was considered statistically significant.
Vol. 23, No. 4
(92.2%) males and 7 (7.8%) females and the mean age was 40.12±9.11. The carriage rate among the food handlers included in the study was 55.5% (50 S. aureus carrier out of 90 food handlers). 34 strain isolated from workers in restaurants and 16 from workers in diaries. Although the number and percentage of Staphylococcus aureus isolates obtained from workers in restaurants is numerically higher than those reported from dairies, no statistically significant difference was observed after statistical analysis of the raw data. As shown in table (2), the majority of the studied food workers were males (92.2%) and they were aged 30-50 years. The mean age was 40.12±9.11. As shown in table (3), the prevalence of isolates does not differ significantly between workers in restaurants and those in dairies in the three types of swabs. As shown in table (4), the number of isolates was significantly higher in nasal swabs than in hand or axillary swabs (χ2 = 36.87 & p = 0.0000). As shown in table (5), using REPLA, the number of enterotoxin producing organisms was significantly higher in nasal swabs (91.2%) than in hand (38.5%) or axillary swabs (66.6%) {χ2 = = 14.48 &p = 0.0007}. As shown in table (6), type A enterotoxin was the most common type (48%) followed by type D (18%), then type C (6%) while the least type was type A+B (4%). It also shows that type A+B was isolated only from nasal swabs (2.9%) and type D was not found in axillary swabs. As shown in table (7), using Multiplex PCR, gene type a was the most common type (48%) followed by gene type d (22%), then gene type c (6%) while the least type was genes type a+ b (4%). It also shows that gene types a+b and b+d were isolated only from nasal swabs (5.9% each). As shown in table (8), compared with multiplex PCR, specificity and predictive value positive of RPLA were 100%, while sensitivity was 90.48% and predictive negative was 66.67%.
RESULTS In the current study, 270 swabs from the nose, hands and axilla of 90 food handlers, 60 were working in restaurants & 30 were working in dairies, in Zagazig city were collected. The food handlers included in the study comprised 83
39
Egyptian Journal of Medical Microbiology, October 2014
Vol. 23, No. 4
Table (2): Gender and age of the studied food workers (n = 90). Number Gender: Male 83 Female 7 Age: < 30 13 30 - 50 66 > 50 11 Mean age = 40.12±9.11
% 92.2 7.8 14.4 73.3 12.3
Table (3): Prevalence of isolates among workers in restaurants and dairies in the three types of swabs. Total Restaurants Dairy Type of z p (n=90) (n=60) (n=30) swab No % No % No % Nasal 34 37.8 22 36.7 12 40.0 0.303 > 0.05 Hand 13 14.4 10 16.7 3 10.0 0.919 > 0.05 Axillary 3 2.2 2 3.3 1 3.3 0.0 > 0.05 Table (4): Comparison between nasal, hand and axillary swabs as regard number of isolates. Positive isolate Negative isolate Type of swab (source of isolates) No % No % Nasal 34 37.8 56 62.2 Hand 13 14.4 77 85.6 axillary 3 3.3 87 96.7 χ2 = 36.87 p = 0.0000 Table (5): Comparison between nasal, hand and axillary swabs as regard enterotoxin production by RPLA. Type of swab Positive swabs Positive enterotoxin Negative enterotoxin (source of isolates) (No) No % No % Nasal 34 31 91.2 3 8.8 Hand 13 5 38.5 8 61.5 Axillary 3 2 66.6 1 33.3 χ2 = = 14.48 p = 0.0007 Table (6): Number and percentage of the SET- RPLA. Type of A D swab No % No % Nasal 21 61.8 7 20.6 Hand 2 15.4 2 15.4 Axillary 1 33.3 0 0.0 Total 24 48.0 9 18.0
different types of enterotoxin in the three types of swabs by AB No 2 0 0 2
C % 5.9 0.0 0.0 4.0
No 1 1 1 3
% 2.9 7.7 33.3 6.0
Negative No % 3 8.8 8 61.5 1 33.3 12 24.0
Total No 34 13 3 50
% 100.0 100.0 100.0 100.0
Table (7): Number and percentage of the different types of enterotoxin genes in the three types of swabs by Multiplex PCR. Type of swab a d a,b c b,d Negative Total (source of isolates) No % No % No % No % No % No % No % Nasal 21 61.8 7 20.6 2 5.9 1 2.9 2 5.9 1 2.9 34 100.0 Hand 2 15.4 3 23.1 0 0.0 1 7.7 0 0.0 7 53.8 13 100.0 Axillary 1 33.3 1 33.3 0 0.0 1 33.3 0 0.0 0 0.0 3 100.0 Total 24 48.0 11 22.0 2 4.0 3 6.0 2 4.0 8 16.0 50 100.0
40
Egyptian Journal of Medical Microbiology, October 2014
Vol. 23, No. 4
Table (8): Sensitivity, specificity, predictive value positive and predictive value negative of RPLA as indicator of presence of genes. Sensitivity (%) Specificity (%) PV+ PV− (%) (%) PRLA total positive 38 PRLA total negative 12 PCR total positive 42 PCR total negative 8 90.48 100 100 66.67 True positive 38 True negative 8 False positive 0 False negative 4
Fig. (1): V-well microtitre plate are showing agglutination with formation of a lattice structure in presence of corresponding enterotoxin (type D).
Fig. (2): Agarose gel electrophoresis patterns showing multi-PCR amplification products for S. aureus enterotoxin genes. Lanes M, DNA molecular size marker (100-bp ladder); lane 1, sea plus femA; 2, sec plus femA; 3, sed plus femA; 4, sea, seb plus femA; 5, negative plus femA; 6, seb,sed plus femA; 7, negative control of sterile water.
41
Egyptian Journal of Medical Microbiology, October 2014
Vol. 23, No. 4
These results agree with those of Al-Bustan and his colleagues (1996) who stated 86.6% prevalence rate of enterotoxins determinants(19). However, they disagree with other studies done in Taiwn {prevalence 74.1} (20), in Chile (21) and in Malaysia (22) {prevalence of 19% and 20.8%, respectively}. In the current study, it has been found that the prevalence of enterotoxin A, enterotoxin D and enterotoxin C genes among the 50 Staphylococcus aureus isolates is 48%, 22% and 6%, respectively. Moreover, the prevalence of Staphylococcus aureus isolates with A+B and B+D genes was 4% for each. This means that bacterial isolates harbouring enterotoxin A were the most prevalent. Studies done in other countries showed that staphylococcal isolates carrying enterotoxin C were the most prevalent(23&24). In the current study, it has been observed that the majority of the 34 Staphylococcus aureus isolates obtained from nasal swabs and 13 Staphylococcus aureus isolates obtained from hand swabs were types A (61.8%) and D (23.1%), respectively, while, enterotoxin genes A, C and D types were equally detected (33.3%) in the 3 Staphylococcus aureus isolates obtained from axillary swabs. By analyzing these results, it has been found that there is a statistical relation between the source of isolation of Staphylococcus aureus and the type of enterotoxin gene. In Kuwait, the majority of Staphylococcus aureus isolates obtained from hands of food workers was type B, whereas those isolated from the nose were predominantly of types A and B (28 and 28.5%) of Staphylococcus aureus isolated, respectively followed by types C and D (16.4% and 3.5% of the total Staphylococcus aureus isolates, respectively)(23). Enterotoxigenic Staphylococcus aureus isolates from the nose, throat, hands and nails of food handlers in cafeterías of a Chilean restaurant were predominantly SEB and SED producers (25). In the current study, it has been found that the sensitivity and specificity of SET-RPLA compared to multiplex PCR were 90.48% and 100%, respectively. These results mean that SET-RPLA is less sensitive than but as specific as multiplex PCR. These results agree with other studies (26&27). In the current study, 42 (84%) out of 50 staphylococcal isolates were found to be enterotoxigenic genotypically by multiplex PCR. However, 38 (76%) out of 50 isolates were found to be enterotoxigenic phenotypically by SETRPLA. This difference between the results
DISCUSSION This study was done to detect the prevalence of enterotoxigenic strains of Staphylococcus aureus among food handlers in Zagazig city and to evaluate phenotypic (SET-RPLA) versus genotypic (multiplex PCR) methods for detection of the staphylococcal enterotoxins. Staphylococcus aureus is one of the most important pathogens in food poisoning, due to its wide spread and ability of many strains to synthesize one or more enterotoxin. It causes gastroenteritis symptoms like nausea, vomiting, abdominal cramps and diarrhea (9&10). Among food stuffs implicated in food poisoning; milk, dairy products, meat, poultry and eggs, specially handled food, play an important role since enterotoxigenic strains have been frequently isolated from food handelars(11&12). Milk products can cause severe health hazards to people as they are highly susceptible to variety of microorganisms because of their high nutritive value(13). They are responsible of many outbreaks of food poisoning (14). The importance of the enterotoxins comes from their heat stability and their resistance to inactivation by gastrointestinal proteases like pepsin. Although Staphylococcus can be killed at normal cooking temperature, the toxins remain active (15). Also they are potent even in very small amount ranging from 20 ng to < 1 µg can produce symptoms to human beings (16). Staphylococcus aureus can gain access to milk either by direct excretion from udders with clinical or subclinical Staphylococcal mastitis. The organism also has an access to milk during handling, processing, transmission or storage (17). In the current study, the carriage rate among the food handlers included in the study was 55.5% (50 S. aureus carrier out of 90 food handlers). 34 strain isolated from workers in restaurants and 16 from workers in diaries. Although the number and percentage of Staphylococcus aureus isolates obtained from workers in restaurants is numerically higher than those reported from dairies, no statistically significant difference was observed after statistical analysis of the raw data. These results comply with the carriage rate (53.2%) of a study conducted in Kuwait City restaurants(18). With regards to staphylococcal enterotoxins determinants, it has been found that out of 50 Staphylococcus aureus isolates, 42 (84%) revealed to be enterotoxigenic by multiplex PCR which is considered the gold standard method in this study.
42
Egyptian Journal of Medical Microbiology, October 2014
3.
Marrack P and Kappler J (1999): The staphylococcal enterotoxins and their relatives. Science; 248:705-711. 4. Schlievert, P. M.; Jablonski, L.M.;Roggiani, M.;Sadler, I.;Callantine, S.;Mitchell, D. T.;Ohlendorf, D. H. and Bohach, G. A. (2000): Pyrogenic toxin superantigen site specificity in toxic shock syndrome and food poisoning in animals. Infect. Immun.68:3630-3634. 5. Green L, Selman C and Banerjee A (2005): Food service workers, self reported food preparation practices. An EHS Net study. Int J Hygiene Environmental Health; 208(1-2): 27-35. 6. Colombari V, Mayer MD, Laicinizm ZM, Mamizyka E, Franco BD, Destro MJ and Landgrave M (2007): Foodborne outbreak caused by Staphylococcus aureus phenotypic and genotypic characterization of strains of food and human sources. Food Prot; 70: 489-493. 7. Collee JG, Barrie MP, Andrw FG and Anthony S (1996): Mackie and McCartney practical medical microbiology 14th edition. New York, Churchill Livingstone. 8. Mehrotra M, Wang G and Jonson WM (1999): Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin1 and Methicillin resistance. J Clinical Microbiol; 48: 1032-1035. 9. Scherrer D, Corti S, Muehlherr JE, Zweifel C and Stephan R (2004): Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet Microbiol; 101:101-107. 10. Normanno G, La Salandra G, Dambrosio A, Quaglia NC, Corrente M, Parisi A, Santagada G, Firinu A, Crisetti E and Celano GV (2007): Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int J Food Microbiol; 115: 290296. 11. De Buyser ML, Dufour B, Maire M and Lafarge V (2001): Implication of milk and milk products in food-borne diseases in France and in different industrialized countries. Int J Food Microbiol; 67:1-17. 12. Normanno G, Firinu A, Virgilio S, Mula G, Dambrosio A, Poggiu A, Decastelli L, Mioni R, Scuota S, Bolzoni G, Di Giannatale E, Salinetti AP, La Salandra G, Batoli M, Zuccon F, Pirino T, Sias S, Parisi A, Quaglia NC and Celano GV
between the phenotyic and genotypic test results was revealed by other studies (28, 29,30). Such discrepnacies were explained by the fact that SET-RPLA detects the enterotoxin itself, whereas PCR method detects its gene. Under certain circumstances, staphylococcal enterotoxins may not be produced or only produced to a certain level below detection limit(28). This work has provided updated data on the carriage of Staphylococcus aureus and its enterotoxins among food handlers wroking in restaurants and dairies in Zagazig city. This will conribute to better management of Staphylococcus aureus carriers among the food handlers and enhance the safety of the restaurants customers. It could be taken as a base for investigating antibacterial resistance among food handlers in the upcoming studies. This study concluded that nasal and hand carriage of enterotoxigenic S.aureus by food handlers is an important source of staphylococcal food contamination in restaurants and fast food outlets so it is important to detect S.aureus carriage among food handlers to prevent possible food contamination by them resulting in food poisoning. It also concluded that multiplex PCR is reliable and valuable method in detection of enterotoxigenic S.aureus strains and it is more sensitive and specific than SET-RPLA. This study recommended health education of food handlers to decrease contamination of their hands, settings training courses for food handlers to learn them the proper hand washing technique and frequent examination of food handler to find and treat. It also recommends screening food workers to identify staphylococcus aureas carriers and referring them to the appropriate health authorities for decolonization. Considerable research effort is still required for better understanding of interactions between staphylococcus aureas and food matrix and of mechanisms of staphylococcal enterotoxin production in food stuffs.
REFERENCES 1.
2.
Vol. 23, No. 4
Giannatale ED, Prencipe V, Tonelli A, Arfoglia C and Migliarati G (2011): Characterisation of Staphylococcus aureus strains isolated from food for human consumption. Veterinaria Italiana; 47 (2): 165-173. Letertre C, Perelle S, Dilasser F and Fach P (2003): Identification of a new putative enterotoxin SEU encoded by the egc cluster of Staphylococcus aureus. J Appl Microbiol; 95: 38-43.
43
Egyptian Journal of Medical Microbiology, October 2014
13.
14.
15. 16.
17.
18.
19.
20.
21.
(2005): Coagulase-positive staphylococci and Staphylococcus aureus in food products marketed in Italy. Int J Food Microbiol; 98: 73-79. Soomro AH, Arain MA, Khaskheli M and Bhutto B (2003): Isolation of Staphylococcus aureus from milk products sold at sweet meat shops of Hyderabad. Online J Biol Sci; 3: 91-94. Thaker, H. C.; Brahmbhatt, M. N. and Nayak, J. B. (2013): Isolation and identification of Staphylococcus aureus from milk and milk products and their drug resistance patterns in Anand, Gujarat. Vet. World, 6:10-13. Presscott LM, Harley JP and Klein DA (2002): Text book of Microbiology. Brown Publishers. 5th ed: 441-442. Berdgoll MS (1989): Staphylococcus aureus. In: Doyle, M.P. (Ed.), Food- Borne Bacterial Pathogens. Marcel Dekker, New York, pp. 464-523. Peles F, Wagner M, Varga L, Hein I, Rieck P, Gutser K, Keresztúri P, Kardos G, Turcsányi I, Béri B and Szabó A (2007): Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int J Food Microbiol; 118: 186193. Udo, E. E; ALMufti, S. and Albert. M. J.(2009):The prevalence of antimicrobial resistance and carriage of virulence genes in Staphylococcus aureus isolated from food handlers in Kuwait City restaurants. BMC Research Notes,2:108. AL-Bustan MA, Udo EE and Chugh TD (1996): Nasal carriage of enterotoxin producing Staphylococcus aureus among restaurants workers in Kuwait City. Epidemiol Infect; 116: 319-322. Chiang YC, Lin CW, Yang CY and Tsen HY (2006): PCR primers for the detection of staphylococcal enterotoxin K,L and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan. J Food Prot; 69: 1072-1079. Figueroa G, Navarreta P, Caro M, Troncoso M and Faundez G (2002): Carriage of enterotoxigenic staphylococcus aureus in food handlers. Rev Med Chil; 130: 859-864.
Vol. 23, No. 4
22. Lim YS, Jegathasan M and Koay AS (1982): Enterotoxin production by staphylococcus aureus strains isolated from humans, food and animals in Malaysia south east Asia. J Trop Med Public Health; 13: 133-137. 23. Udo EE, Al Bustan MA, Jacob LE and Chugh TD (1999): Enterotoxin production by coagulase negative staphylococci in restaurant workers from Kuwait City may be a potential cause of food poisoning. J Med Microbial; 48: 819-823. 24. Firinu A, Virgilio S, Mula G, Poggiu A, Zuccon F and Sias S (2003): Staphylococcus aureus in alimenti di origine. Presenza e caratterizzazione enterotossica. Industrie Alimentari, XLII, 613-623. 25. Soriano JM, Font G, Motlo JC and Males J (2002): Enterotoxigenic staphylococcus and their toxins in restaurant foods. Trends Food Sci Technol; 13: 60-67. 26. Ossiprandi MC and Zerbini L (2014): Multiplex PCR and RPLA detection of enterotoxins in Staphylococcus aureus strains isolated from milk, dairy products and human faecal samples. Journal of Advances in Biology; 4 (1): 312-317. 27. Hunt K, Schelin J, Radstrِom P, et al., (2012): Classical enterotoxins of coagulasepositive Staphylococcus aureus isolates from raw milk and products for raw milk cheese production in Ireland . Dairy Sci & Technol; 92:487–499. 28. Lim SK, Joo YS, Moon JS, et al. (2004): Molecular typing of enterotoxigenic Staphylococcus aureus isolated from bovine mastitis in Korea. J Vet Med Sci; 66(5):581584. 29. Atanassova V, Meindl A and Ring C (2001): Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham—a comparison of classical culturing detection and RFLP-PCR. International Journal of Food Microbiology; 68: 105–113. 30. Morandi S, Brasca M, Lodi R, et al. (2007): Detection of classical enterotoxins and identification of enterotoxin genes in staphylococcus aureus from milk and dairy products. Veterinary Microbiology; 124: 123.
44
Vol. 23, No. 4
Egyptian Journal of Medical Microbiology, October 2014
اﻟﻜﺸﻒ اﻟﺠﻴﻨﻲ ﻋﻦ اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ اﻟﻤﻔﺮزة ﻟﻠﺴﻢ اﻟﻤﻌﻮي ﻓﻲ ﻣﻌﺪي اﻷﻃﻌﻤﺔ أﻳﻤﻦ ﻋﺒﺪ اﻟﺮﺣﻤﻦ ﻋﻼم،ﻣﺎهﺮ اﻟﺸﺎﻓﻌﻲ ،أﺣﻤﺪ أﻧﻮر ﺷﺎهﻴﻦ ،ﻓﺎﻳﺰة ﻓﺘﺤﻲ ﻗﺴﻢ اﻟﻤﻴﻜﺮوﺑﻴﻮﺟﻴﺎ واﻟﻤﻨﺎﻋﺔ -آﻠﻴﺔ اﻟﻄﺐ اﻟﺒﺸﺮي -ﺟﺎﻣﻌﺔ اﻟﺰﻗﺎزﻳﻖ ﺗﻌﺘﺒﺮ ﺑﻜﺘﺮﻳﺎ اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ واﺣﺪة ﻣﻦ أهﻢ اﻟﻤﻴﻜﺮوﺑﺎت اﻟﻤﺴﺒﺒﺔ ﻟﻠﺘﺴﻤﻢ اﻟﻌﺬاﺋﻰ و ﻳﺮﺟﻊ ذﻟﻚ اﻟﻰ أن اﻟﻜﺜﻴﺮ ﻣ ﻦ ﺳ ﻼﻻت ﺗﻠﻚ اﻟﺒﻜﺘﺮﻳﺎ ﻗﺎدرة ﻋﻠﻰ ﺗﻜﻮﻳﻦ واﺣ ﺪ أو أآﺜ ﺮ ﻣ ﻦ اﻟ ﺴﻤﻮم اﻟﻤﻌﻮﻳ ﺔ .ﻳﻌﺘﺒ ﺮ ﻣﻌ ﺪى اﻷﻃﻌﻤ ﺔ ﻣ ﻦ ﺣ ﺎﻣﻠﻰ اﻟﻤﻴﻜ ﺮوب اﻟﻌﻨﻘ ﻮدى اﻟ ﺬهﺒﻰ اﻟﻤﻔ ﺮز ﻟﻠﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ ﻣﺼﺪر ه ﺎم ﻟﺘﻠ ﻮث اﻟﻐ ﺬاء ﻓ ﻰ اﻟﻤﻄ ﺎﻋﻢ وﻣﻨﺎﻓ ﺬ اﻟﻄﻌ ﺎم اﻟ ﺴﺮﻳﻌﺔ ﻟ ﺬﻟﻚ ﻳﻜ ﻮن ﻣ ﻦ اﻟﻤﻬ ﻢ ﺗﺤﺪﻳ ﺪ ﺣ ﺎﻣﻠﻰ اﻟﻤﻴﻜ ﺮوب ﻓ ﻰ ﻣﻌ ﺪى اﻷﻃﻌﻤﺔ ﻟﻤﻨﻊ ﺗﻠﻮث ﻏﺬاﺋﻰ ﻣﺤﺘﻤﻞ. ﻳﺸﻤﻞ ﻣﻌﺪي اﻷﻃﻌﻤﺔ اﻷﺷﺨﺎص اﻟﻤﺴﺘﺨﺪﻣُﻴﻦ ﻣﺒﺎﺷ ﺮة ﻓ ﻲ إﻧﺘ ﺎج و إﻋ ﺪاد أﺻ ﻨﺎف اﻟﻄﻌ ﺎم ﺷ ﺎﻣﻠﺔ اﻟﺘ ﺼﻨﻴﻊ و اﻟﺘﻌﺎﻣ ﻞ و ﺗﻘ ﺪﻳﻢ اﻟﻄﻌ ﺎم وﺣﺴﻦ اﻟﻀﻴﺎﻓﺔ وﺻﻨﺎﻋﺎت اﻟﺘﺠﺰﺋﺔ ﻋﻠﻲ أﻳﻪ ﺣﺎل رﺑﻤﺎ ﻳﺸﻤﻞ اﻟﺘﻌﺮﻳ ﻒ اﻟﻌ ﺎﻣﻠﻴﻦ ﺑﺄﻋﻤ ﺎل اﻟ ﺼﻴﺎﻧﺔ أو ﺗ ﺮﻣﻴﻢ اﻟﻤﻌ ﺪات ﻓ ﻲ أﻣ ﺎآﻦ اﻟﺘﻌﺎﻣ ﻞ ﻣ ﻊ اﻟﻄﻌﺎم واﻟﺰاﺋﺮﻳﻦ. ﻳﻨﻘﻞ ﻣﻌﺪي اﻷﻃﻌﻤﺔ اﻟﻌﺪوي اﻟﻤﻌﻮﻳﺔ ﻋﻦ ﻃﺮﻳﻖ ﻣﻼﻣﺴﺘﻬﻢ ﻟﻠﻄﻌﺎم .ﻳﻤﺜﻞ ﻣﻌﺪى اﻻﻃﻌﻤﺔ ﺟﺰء ﻣﻦ اﻟﺴﻜﺎن اﻷﺻﺤﺎء ﺑﺠﺎﻧﺐ ﻋﻤﻠﻬﻢ ﻓﻰ اﻟﻤﻄﺎﻋﻢ و ﻣﺼﺎﻧﻊ ﻣﻨﺘﺠﺎت اﻷﻟﺒﺎن ﻣﻤﺎ ﻳﺴﺘﻠﺰم ﺗﺤﺪﻳﺪ ﺳﻤﻴﺔ ﻣﻌﺰوﻻت اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ اﻟﻤﻌﺰوﻟﺔ ﻣﻨﻬﻢ ﺑﺎﻟﺘﺮآﻴﺰ ﻋﻠﻰ اﺧﺘﺒﺎر ﺳﻤﻴﺔ اﻟﻤﻌﺰوﻻت. أﺟﺮﻳﺖ هﺬﻩ اﻟﺪراﺳﺔ ﻟﺘﺤﺪﻳﺪ ﻣﻌﺪل اﻧﺘﺸﺎر اﻟﻤﻴﻜﺮوب اﻟﻌﻨﻘﻮدى اﻟﺬهﺒﻰ اﻟﻤﻔﺮز ﻟﻠﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ ﺑﻴﻦ ﻣﻌﺪى اﻷﻃﻤﻌﺔ ﻓﻰ ﻣﺪﻳﻨﺔ اﻟﺰﻗﺎزﻳﻖ و ﺗﺤﺪﻳﺪ اﻟﺠﻴﻨﺎت اﻟﻤﺴﺒﺒﺔ ﻟﻠﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ .ﺗﻢ ﺗﺠﻤﻴﻊ ٢٧٠ﻣﺴﺤﺔ رﻃﺒﺔ ﻣﻦ ) (٩٠ﻣﻌﺪ ﻟﻠﻄﻌﺎم ﺑﻤﻌﺪل ٣ﻣﺴﺤﺎت ﻣﻦ آﻞ ﻋﺎﻣﻞ )ﻣﺴﺤﺔ أﻧ ﻒ- اﺑﻂ -ﻳﺪ( ﻣﻦ ﻣﻄﺎﻋﻢ و ﻣﺼﺎﻧﻊ ﻣﻨﺘﺠﺎت أﻟﺒﺎن ﻣﺨﺘﻠﻔﺔ ﻓﻰ ﻣﺪﻳﻨﺔ اﻟﺰﻗﺎزﻳﻖ. ﺗﻢ اﻟﺰرع ﻋﻠﻰ ﻣﺴﺘﻨﺒﺖ أﺟﺎر اﻟﻤﺎﻧﻴﺘﻮل اﻟﻤﻠﺤﻰ و ﺗﺤﻀﻦ ﻋﻨﺪ درﺟﺔ ﺣﺮارة ٣٧ﻟﻤﺪة ٤٨-٢٤ﺳﺎﻋﺔ ﻓﻰ وﺟﻮد اﻷآﺴﺠﻴﻦ. ﺛﻢ ﺗﻢ أﺧﺬ ﻣﺴﺘﻌﻤﺮة ﻣﻦ آﻞ ﻣﺰرﻋﺔ و ﺻﺒﻐﺖ ﺑﺼﺒﻐﺔ اﻟﺠﺮام و أﻳﻀﺎ ﺗﻢ اﻟﻜﺸﻒ ﻋﻦ وﺟ ﻮد اﻻﻧ ﺰﻳﻢ اﻟﻤﺨﺜ ﺮ ﻟﻠﺒﻼزﻣ ﺎ و آ ﺬﻟﻚ اﻻﻧ ﺰﻳﻢ اﻟﻤﺴﺌﻮل ﻋﻦ ﺗﻜﺴﻴﺮ DNAﻟﻠﺘﺄآﻴﺪ ﻋﻠﻰ أن هﺬﻩ اﻟﻤﺴﺘﻌﻤﺮات ﻟﺒﻜﺘﺮﻳﺎ اﻟﻤﻜﻮرات اﻟﻌﻨﻘﻮدﻳﺔ اﻟﺬهﺒﻴﺔ. ﺛﻢ ﺗﻢ اﻟﻜﺸﻒ ﻋﻦ اﻟﻘﺪرة ﻋﻠﻰ اﻓﺮاز اﻟﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ ﺑﻄﺮﻳﻘﺔ ﺗﻔﺎﻋﻞ ﺗﻼزن ﻻﺗﻜ ﺲ اﻟ ﺴﻠﺒﻰ اﻟﻌﻜ ﺴﻰ ﺛ ﻢ اﺳ ﺘﺨﺪﻣﺖ ﺗﻘﻨﻴ ﺔ ﺗﻔﺎﻋ ﻞ ﺳﻠ ﺴﻠﺔ اﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة اﻟﺘﻌﺪدى ﻟﻠﻜﺸﻒ ﻋﻦ اﻟﺠﻴﻨﺎت اﻟﻤﻔﺮزة ﻟﻠﺴﻤﻮم . وآﺎﻧﺖ اﻟﻨﺘﺎﺋﺞ آﺎﻻﺗﻰ: ﺗﻢ ﻋﺰل ٥٠ﻣﻜﻮر ﻋﻨﻘﻮدى ذهﺒﻰ ﻣﻦ ٩٠ﻣﻌﺪ ﻟﻠﻄﻌﺎم و آﺎن ﺣﺎﻣﻠﻰ اﻟﻤﻴﻜﺮوب ﻣﻨﻬﻢ ﺑﻤﻌﺪل ، %٥٥.٥و آﺎن ﻋﺪد اﻟﻤﻌﺰوﻻت ﻣ ﻦ ﻣﺴﺤﺎت اﻷﻧﻒ هﻮ اﻷﻋﻠﻰ ) ٣٤ﻣﻌﺰول( و ذات دﻻﻟﺔ اﺣﺼﺎﺋﻴﺔ ﻋﻨﻪ ﻓﻰ ﻣﺴﺤﺎت اﻟﻴﺪ ) ١٣ﻣﻌﺰول( و اﻻﺑﻂ ) ٣ﻣﻌﺰول(. وﺑﺎﺧﺘﺒﺎر ﺗﻔﺎﻋ ﻞ ﺗ ﻼزن ﻻﺗﻜ ﺲ اﻟ ﺴﻠﺒﻰ اﻟﻌﻜ ﺴﻰ آﺎﻧ ﺖ ﻧ ﺴﺒﺔ اﻟﻤﻴﻜﺮوﺑ ﺎت اﻟﻤﻔ ﺮزة ﻟﻠ ﺴﻤﻮم ٥٠/٤٢) %٧٦ﻣﻌ ﺰول( ،و آ ﺎن اﻟ ﺴﻢ اﻟﻤﻌ ﻮى ﻧ ﻮع أ ه ﻮ اﻷآﺜ ﺮ ﺷ ﻴﻮﻋﺎ %٦١.٨ﻣﺘﺒﻮﻋ ﺎ ﺑﺎﻟ ﺴﻢ اﻟﻤﻌ ﻮى ﻧ ﻮع د %٢٠.٦ﺛ ﻢ اﻟ ﺴﻢ اﻟﻤﻌ ﻮى )أ+ب( ﺑﻨ ﺴﺒﺔ %٥.٩ﺛ ﻢ أﻗﻠﻬ ﻢ اﻟ ﺴﻢ اﻟﻤﻌﻮى ج .%٢.٩ وﺑﺎﺳﺘﺨﺪام ﺗﻘﻨﻴﺔ ﺗﻔﺎﻋﻞ ﺳﻠﺴﻠﺔ اﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة اﻟﺘﻌﺪدى ،ﺗﻢ ﻓﺼﻞ اﻟﺠﻴﻨﺎت اﻟﻤﺴﺒﺒﺔ ﻟﻠﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ ﻓﻰ %٨٤ﻣﻦ اﻟﻌﻴﻨﺎت اﻻﻳﺠﺎﺑﻴﺔ ،وﺟﺪ أن اﻟﺠﻴﻦ اﻟﻤﺸﻔﺮ ﻟﻠﺴﻢ اﻟﻤﻌﻮى أ هﻮ اﻷآﺜﺮ ﺷﻴﻮﻋﺎ ﺑﻨﺴﺒﺔ %٤٨ﺑﻴﻨﻤﺎ آﺎﻧﺖ ﻧﺴﺒﺔ اﻟﺠﻴﻦ اﻟﻤﺸﻔﺮ ﻟﻠﺴﻢ اﻟﻤﻌ ﻮى د %٢٢و اﻟﺠ ﻴﻦ اﻟﻤ ﺸﻔﺮ ﻟﻠ ﺴﻢ اﻟﻤﻌﻮى ج ، %٦ﺑﻴﻨﻤﺎ اﻟﻤﻌﺰوﻻت اﻟﺘﻰ ﺗﺤﺘﻮى ﻋﻠﻰ ﻧﻮﻋﻴﻦ ﻣﻦ اﻟﺠﻴﻨﺎت )أ+ب( %٤و )ب+د( %٤آﺎﻧﺖ اﻷﻗﻞ. ﺗﻌﺘﺒﺮﺗﻘﻨﻴﺔ ﺗﻔﺎﻋﻞ ﺳﻠﺴﻠﺔ أﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة اﻟﺘﻌﺪدي ذو ﺛﻘﺔ وﻗﻴﻤﺔ ﻓﻲ ﺗﺤﺪﻳﺪ ﺳﻤﻴﺔ ﺳﻠﻼت اﻟﻤﻜﻮر اﻟﻌﻨﻘﻮدي اﻟﺬهﺒﻲ. وﺗﻢ اﺳﺘﻨﺒﺎط اﻻﺗﻲ ﻣﻦ هﺬﻩ اﻟﺪراﺳﺔ: ﻳﻌﺘﺒﺮ وﺟﻮد ﻣﻴﻜﺮوب اﻟﻤﻜﻮر اﻟﻌﻨﻘﻮدي اﻟﺬهﺒﻲ اﻟﻤﻔﺮزة ﻟﻠﺴﻤﻮم اﻟﻤﻌﻮﻳﺔ ﻓﻲ أﻧﻒ وأﻳﺪي ﻣﻌﺪي اﻷﻃﻌﻤﺔ ﻣﺼﺪر هﺎم ﻟﺘﻠﻮث اﻟﻐﺬاء ﻓ ﻲ اﻟﻤﻄﺎﻋﻢ و ﻣﻨﺎﻓﺬ اﻟﻮﺟﺒﺎت اﻟﺴﺮﻳﻌﺔ. ﻣﻦ اﻟﻤﻬﻢ اﻟﻜﺸﻒ ﻋﻦ وﺟﻮد اﻟﻤﻜﻮر اﻟﻌﻨﻘﻮدي اﻟﺬهﺒﻲ ﺑﻴﻦ ﻣﻌﺪي اﻷﻃﻌﻤﺔ وﻣﻨﻊ ﺣ ﺪوث ﺗﻠ ﻮث ﻏ ﺬاﺋﻲ ﻣﺤﺘﻤ ﻞ ﻓ ﻴﻬﻢ ﻳﻨ ﺘﺞ ﻋﻨ ﻪ اﻟﺘ ﺴﻤﻢ اﻟﻐﺬاﺋﻲ. ﻳﻨﺘﺞ ﻋﻦ ﺟﺎﺋﺤﺎت اﻟﺘﺴﻤﻢ اﻟﻐﺬاﺋﻲ ﺧﺴﺎرة ﻣﺎدﻳﺔ ﻟﻠﻤﻄﺎﻋﻢ ﺑﺎﻹﺿﺎﻓﺔ إﻟﻲ ﻓﻘﺪان اﻟﺴﻤﻌﺔ و اﻟﺜﻘﺔ ﺑﻴﻦ اﻟﻌﺎﻣﺔ. ﻳﻌﺘﺒﺮ ﺗﻔﺎﻋﻞ ﺳﻠﺴﺔ اﻧﺰﻳﻢ اﻟﺒﻠﻤﺮة اﻟﺘﻌﺪدي أآﺜﺮ ﺣﺴﺎﺳﻴﺔ و ﺧﺼﻮﺻﻴﺔ ﻋﻦ ﺗﻔﺎﻋﻞ ﺗﻼزم ﻻﺗﻴﻜﺲ اﻟﺴﻠﺒﻲ اﻟﻌﻜﺴﻲ. ﺑﺎﻟﺒﻨﺴﺒﺔ ﻟﻠﺴﻠﻼت اﻟﺤﺎﻣﻠﺔ ﻟﺠﻴﻦ اﻟﺴﻢ اﻟﻤﻌﻮي أ وﺟﺪت اآﺜﺮ ﻣﻦ اﻟﺴﻠﻼت اﻟﺤﺎﻣﻠﺔ ﻟﻠﺠﻴﻨﺎت د ،ج ﺑﻴﻦ ﻣﻌﺪي اﻷﻃﻌﻤﺔ ﻓﻲ ﻣﺪﻳﻨﺔ اﻟﺰﻗﺎزﻳﻖ ووﺟﺪ أن ﺑﻌﺾ اﻟﺴﻠﻼت ﺗﺤﻤﻞ أآﺜﺮ ﻣﻦ ﺟﻴﻦ ﻟﻠﺴﻢ اﻟﻤﻌﻮي )ﺟﻴﻦ أ +ﺟﻴﻦ ب() ،ﺟﻴﻦ ب +ﺟﻴﻦ د( وآﺎﻧﺖ ﺗﻮﺻﻴﺎت هﺬﻩ اﻟﺪراﺳﺔ: • اﻟﺘﻌﻠﻴﻢ اﻟﺼﺤﻲ ﻟﻤﻌﺪي اﻟﻄﻌﻤﺔ ﻟﺘﻘﻠﻴﻞ ﺗﻠﻮث اﻷﻳﺪي. • ﻏﺴﻴﻞ اﻟﻴﺪﻳﻦ اﻟﻤﺘﻜﺮر. • دورات ﺗﺪرﻳﺐ ﻣﻌﺪي اﻟﻄﻌﻤﺔ ﻋﻠﻲ ﺗﻘﻨﻴﺔ ﻏﺴﻞ اﻟﻴﺪﻳﻦ اﻟﺼﺤﻴﺢ. • اﻟﻔﺤﺺ اﻟﺪﻗﻴﻖ ﻟﻤﻌﺪي اﻷﻃﻌﻤﺔ ﻹآﺘﺸﺎف وﻋﻼج ﺣﺎﻣﻠﻲ اﻟﻤﻴﻜﺮوب. • ﻣﻌﺎﻟﺠﺔ اﻟﺒﺎﻟﻮﻋﺎت و اﻷﺳﻄﻊ اﻟﻌﻠﻮﻳﺔ ﺑﻮﺟﻮب اﻟﻨﻈﺎﻓﺔ ﺑﻌﺪ اﻹﺳﺘﺨﺪام • اﻟﻤﺤﺎﻓﻈﺔ ﻋﻠﻲ ﻧﻈﺎﻓﺔ اﻟﺠﺮوح و اﻟﺨﺪوش و ﺗﻐﻄﻴﺘﻬﺎ ﺑﺈﺣﻜﺎم ﺣﺘﻲ ﺗﻠﺘﺌﻢ. • اﻟﻔﺤﺺ اﻟﺪوري ﻟﻤﻄﺎﺑﺦ اﻟﻤﺴﺘﺸﻔﻴﺎت ﺑﺨﺼﻮص اﻟﻤﻜﻮر اﻟﻌﻨﻘﻮدي اﻟﺬهﺒﻲ. • ﺗﻔﻌﻴﻞ ﻣﻤﺎرﺳ ﺔ اﻟﻤ ﺴﺢ اﻟﻄﺒ ﻲ ﺑ ﻴﻦ ﻣﻌ ﺪي اﻟﻄﻌﻤ ﺔ ﻟﻠﺘﻌ ﺮف ﻋﻠ ﻲ ﺣ ﺎﻣﻠﻲ ﻣﻴﻜ ﺮوب اﻟﻤﻜ ﻮر اﻟﻌﻨﻘ ﻮدي اﻟ ﺬهﺒﻲ وﺗ ﻮﺟﻴﻬﻢ إﻟ ﻲ اﻟ ﺴﻠﻄﺎت اﻟﺼﺤﻴﺔ ﻟﻤﻨﻊ ﺗﻜﻮﻳﻦ ﻣﺴﺘﻌﻤﺮات ﺑﻜﺘﻴﺮﻳﺔ. ﻣﺎزاﻟﺖ اﻟﺤﺎﺟﺔ ﻟﻠﺠﻬﺪ اﻟﺒﺤﺜﻲ اﻟﻤﻌﺘﺒﺮ ﻻزﻣﺔ ﻟﻔﻬﻢ أﺣﺴﻦ ﻟﺘﻔﺎﻋﻞ اﻟﻤﻴﻜﺮوب اﻟﻤﻜﻮر اﻟﻌﻨﻘﻮدي اﻟﺬهﺒﻲ ﺑﺎﻷﻃﻌﻤﺔ و ﻣﻴﻜﺎﻧﻴﺰﻣﺎت إﻓ ﺮاز اﻟ ﺴﻢ اﻟﻤﻌﻮي ﻓﻲ أﺻﻨﺎف اﻟﻄﻌﺎم.
45
