Glucocorticoids Induce Osteocyte Apoptosis by ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 33, pp. 24120 –24130, August 17, 2007 Printed in the U.S.A.

Glucocorticoids Induce Osteocyte Apoptosis by Blocking Focal Adhesion Kinase-mediated Survival EVIDENCE FOR INSIDE-OUT SIGNALING LEADING TO ANOIKIS * Received for publication, December 13, 2006, and in revised form, May 14, 2007 Published, JBC Papers in Press, June 20, 2007, DOI 10.1074/jbc.M611435200

Lillian I. Plotkin, Stavros C. Manolagas, and Teresita Bellido1 From the Division of Endocrinology and Metabolism, the Center for Osteoporosis and Metabolic Bone Diseases, the Central Arkansas Veterans Healthcare System, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7199

Glucocorticoids, produced and released by the adrenal glands in response to stress, regulate numerous physiological processes in a wide range of tissues (1, 2). Among many other effects, these hormones exert profound immunosuppressive

* This work was supported by the National Institutes of Health KO2-AR02127 and P01-AG13918 and the Department of Veterans Affairs. Confocal images were taken at facilities in the University of Arkansas for Medical Sciences Digital and Confocal Microscopy Laboratory supported by National Institutes of Health Grant 2 P20 RR 16460, and PI:Larry Cornett, INBRE, Partnerships for Biomedical Research in Arkansas. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom correspondence should be addressed: 4301 West Markham St., Slot 587, Little Rock, AR 72205. Tel.: 501-686-8971; Fax: 501-686-8148; E-mail: [email protected].

24120 JOURNAL OF BIOLOGICAL CHEMISTRY

and anti-inflammatory actions and induce apoptosis of many cell types, including T lymphocytes and monocytes. Because of these properties, glucocorticoids are extensively used for the treatment of immune and inflammatory conditions, the management of organ transplantation, and as components of chemotherapy regimens for hematological cancers. However, longterm use of glucocorticoids is associated with severe adverse side effects manifested in several organs. In particular, prolonged use of these drugs leads to a dramatic loss of bone mineral and strength, similar to endogenous elevation of glucocorticoids (3– 6). Evidence accumulated during the past few years has indicated that increased prevalence of apoptosis of osteocytes (and osteoblasts) is associated with the glucocorticoidinduced bone fragility syndrome (7–9). This pro-apoptotic effect results from direct actions of the steroids on cells of the osteoblastic lineage. Indeed, the pro-apoptotic effect of glucocorticoids is readily demonstrable in cultured osteocytes and osteoblasts (10, 11). Furthermore, transgenic mice overexpressing 11␤-hydroxysteroid dehydrogenase type 2, an enzyme that inactivates glucocorticoids, in osteocytes and osteoblasts are protected from glucocorticoid-induced bone fragility (8). The mechanism of glucocorticoid action involves binding to the glucocorticoid receptor (GR),2 conformational changes, and nuclear translocation of the ligand-bound receptor, followed by cis or trans interactions with DNA and thereby induction or repression of gene transcription (1, 2). In addition, glucocorticoids exert actions independently of changes in gene transcription. Such actions include modulation of the activity of intracellular kinases like the extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinase (JNK), and prolinerich tyrosine kinase 2 (Pyk2) (12–17). Pyk2, also known as related adhesion focal tyrosine kinase, cellular adhesion kinase ␤, or calcium-dependent tyrosine kinase (18, 19), is a member of the focal adhesion kinase (FAK) family of nonreceptor tyrosine kinases. Although Pyk2 and FAK are highly homologous, these proteins exhibit opposite effects on cell fate. Thus, whereas FAK activation leads to cell spreading and survival (20), Pyk2 induces reorganization of the cytoskeleton, cell detachment, and apoptosis (18, 20). Consistent with these lines 2

The abbreviations used are: GR, glucocorticoid receptor; ROS, reactive oxygen species; ERKs, extracellular signal regulated kinases; Pyk2, proline-rich tyrosine kinase 2; FAK, focal adhesion kinase; JNK, c-Jun N-terminal kinase; GFP, green fluorescent protein; nGFP, GFP targeted to the nucleus; nRFP, RFP targeted to the nucleus; WT, wild type; K⫺, kinase deficient; PI3K,phosphatidylinositol 3-kinase; BAPTA-AM, 1,2-bis(2-aminophenoxyl)ethaneN,N,N⬘,N⬘-tetraacetic acid.

VOLUME 282 • NUMBER 33 • AUGUST 17, 2007

Downloaded from http://www.jbc.org/ by guest on August 7, 2017

Bone fragility induced by chronic glucocorticoid excess is due, at least in part, to induction of osteocyte apoptosis through direct actions on these cells. However, the molecular mechanism by which glucocorticoids shorten osteocyte life span has remained heretofore unknown. We report that apoptosis of osteocytic MLO-Y4 cells induced by the synthetic glucocorticoid dexamethasone is abolished by the glucocorticoid receptor antagonist RU486, but not by inhibition of protein or RNA synthesis. Dexamethasone-induced apoptosis is preceded by a decrease in the number of cytoplasmic processes, an indicator of cell detachment. In addition, the focal adhesion kinase FAK prevents dexamethasone-induced apoptosis, whereas the FAK-related kinase Pyk2 increases the basal levels of apoptosis. Dexamethasone-induced apoptosis is also prevented in cells expressing kinase-deficient or phosphorylation-defective (Y402F) dominant negative mutants of Pyk2. Consistent with the requirement of tyrosine 402, dexamethasone induces rapid Pyk2 phosphorylation in this residue. Moreover, knocking down Pyk2 expression abolishes apoptosis and cell detachment induced by dexamethasone, and transfection with human Pyk2 rescues both responses. Furthermore, induction of apoptosis as well as cell detachment by dexamethasone is abolished by inhibiting the activity of JNK, a recognized downstream target of Pyk2 activation. These results demonstrate that glucocorticoids promote osteocyte apoptosis via a receptor-mediated mechanism that does not require gene transcription and that is mediated by rapid activation of Pyk2 and JNK, followed by inside-out signaling that leads to cell detachment-induced apoptosis or anoikis.

Glucocorticoids, FAK, Pyk2, and Osteocyte Apoptosis of evidence, we have recently demonstrated that mechanical stimulation promotes osteocyte survival by activating FAK (21). We now report that glucocorticoids promote osteocyte apoptosis by activating Pyk2 and JNK, hence opposing FAK-induced survival. These changes lead to cell detachment-induced apoptosis (anoikis). This action of glucocorticoids is exerted via a receptor-mediated mechanism, but it is independent of new gene transcription.

AUGUST 17, 2007 • VOLUME 282 • NUMBER 33

JOURNAL OF BIOLOGICAL CHEMISTRY

24121


EXPERIMENTAL PROCEDURES Materials—The synthetic glucocorticoid dexamethasone, etoposide, cycloheximide, actinomycin D, RU486, SB203580, wortmannin, EGTA, and gadolinium chloride were purchased from Sigma; SP600125 and nifedipine from EMD Biosciences, Inc. (San Diego, CA); Asp-Glu-Val-Asp-aldehyde (DEVD) and thapsigargin from Biomol Research Labs, Inc. (Plymouth Meeting, PA); PD98059 from New England Biolabs (Beverly, MA); PP1 from BioSource International (Camarillo, CA); [3H]leucine or [3H]uridine from Amersham Biosciences; and BAPTA-AM and phalloidin-Alexa Fluor 555 from Molecular Probes (Carlsbad, CA). DNA Constructs and Transient Transfections—pCDNA3, yellow fluorescent protein (YFP)-DEVD caspase3 sensor and green fluorescent protein (GFP) were purchased from Clontech. The plasmids encoding nuclear targeted GFP (nGFP) and red fluorescent protein (nRFP) were previously described (11, 22). Human wild type (WT) FAK was provided by S. Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, NJ) (23). Murine WT, kinase-deficient (K⫺), and autophosphorylation deficient (Y402F) Pyk2 mutants were provided by W-C. Xiong (University of Alabama, Birmingham, AL) (18). Human WT and K⫺ Pyk2 mutant fused to GFP (Pyk2GFP) were provided by D. Sancho (Universidad Auto´noma de Madrid, Madrid, Spain) (24). Dominant negative and constitutively active MEK were provided by N. Ahn (University of Colorado, Boulder, CO (25)). Wild type and dominant negative JNK were provided by E. R. Levin (University of California at Irvine, Long Beach, CA) (26, 27) and ⌬MEKK1, by N. R. Bhat (Medical University of South Carolina, Charleston, SC) (28). All the constructs used in this study have been shown to produce functional proteins. Cells were transiently transfected with a total amount of DNA of 0.1 ␮g/cm2 using Lipofectamine Plus (Invitrogen) as previously described (22, 29). The efficiency of transfection was ⬃60%. Cell Culture—Wild type MLO-Y4 osteocytic cells derived from murine long bones and MLO-Y4 cells stably transfected with nGFP were cultured as previously described (11, 30). Inhibition of RNA or Protein Synthesis—MLO-Y4 cells were incubated with 1 ␮Ci/ml [3H]leucine or [3H]uridine for 2.5 h, followed by addition of 1 ␮M cycloheximide or 2 ␮M actinomycin D. After 7.5 h, cells were scraped off the plates, protein and RNA were precipitated with ice-cold 5% trichloroacetic acid, and radioactivity was quantified. Protein concentration was determined using a detergent compatible Bio-Rad kit. [3H]Leucine or [3H]uridine incorporation was expressed as counts/min/␮g of protein. Quantification of Apoptotic Cells—Apoptosis was induced in semi-confluent cultures (less than 75% confluence) by treat-

ment with the glucocorticoid dexamethasone (1 ␮M) or with etoposide (50 ␮M) for the indicated times. Cells were incubated for 2.5 h with cycloheximide or actinomycin D, or for 30 min with inhibitors or Ca2⫹ modulators, before addition of the proapoptotic agents. Apoptosis was assessed by trypan blue uptake or by enumerating MLO-Y4 cells expressing nGFP or nRFP exhibiting chromatin condensation and nuclear fragmentation under a fluorescence microscope, as previously reported (11). Apoptosis was also quantified by measuring caspase 3 activation in cells transiently transfected with a plasmid encoding a caspase 3 sensor fusion protein along with nRFP, as previously reported (31–33). The caspase 3 sensor consists of enhanced YFP fused to the amino acid sequence cleaved by caspase 3 (DEVD), and also contains a dominant N-terminal nuclear export signal and a C-terminal nuclear localization signal. In living cells in which caspase 3 is inactive, the nuclear export sequence prevails and the fluorescent protein localizes in the cytoplasm. In apoptotic cells, the active caspase 3 cleaves off the protein at the DEVD sequence, removing the nuclear export sequence resulting in nuclear localization of the fluorescent caspase 3 sensor. The percentage of cells with increased caspase 3 activity was determined by analyzing under a fluorescence microscope the subcellular localization of the caspase 3 sensor. At least 250 cells from fields selected by systematic random sampling for each experimental condition were examined in all apoptosis assays. Quantification of Cell Detachment—The effect of dexamethasone or etoposide on cell detachment was quantified by enumerating the number of cytoplasmic processes of MLO-Y4 cells expressing GFP. Cells were classified in two groups: those having 3 or less (ⱕ3) and those having more than 3 cytoplasmic processes. Data are expressed as percentage of cells with ⱕ3 cytoplasmic processes. H&E and Actin Staining—MLO-Y4 cells were stained with hematoxylin and eosin (H&E) following standard procedures. Cells then were dehydrated, mounted using Eukitt mounting medium (Electron Microscopy sciences, Washington, PA), and visualized by phase microscopy. For actin filament visualization, cells were fixed in neutral buffered formalin for 10 min, followed by permeabilization with 0.1% Triton X-100 for 5 min, and incubation with 1% bovine serum albumin in phosphatebuffered saline for 30 min to block unspecific staining. Actin filaments were stained with 5 units/ml phalloidin-Alexa Fluor 555 in phosphate-buffered saline containing 0.1% bovine serum albumin for 20 min, as previously described (34). Cells were visualized by confocal microscopy. Small Interfering RNA—The expression of murine Pyk2 or the irrelevant protein lamin A/C was silenced by treating for 3 h MLO-Y4 cells with 280 nM of the corresponding small interfering RNA (Custom SMARTpool, Dharmacon Research Inc., Lafayette, CO). Two days after silencing, Pyk2 expression was recovered by transfection with human Pyk2-GFP or with GFP as negative control. The pro-apoptotic agents were added 2 days after transfection and apoptosis and cell detachment were quantified after 6 h. Western Blot Analysis—Protein lysates from MLO-Y4 cells were prepared as previously reported (11). Proteins were separated on 10% SDS-polyacrylamide gels and electrotransferred

Glucocorticoids, FAK, Pyk2, and Osteocyte Apoptosis

RESULTS Glucocorticoid-induced Apoptosis Does Not Require New Gene Transcription and It Is Mediated by the GR—We and others have previously demonstrated that glucocorticoids induce apoptosis of osteocytic MLO-Y4 cells (11, 29, 35). We have used this cell model herein to gain insight into the mechanism of the pro-apoptotic effect of glucocorticoids. We found that dexamethasone induced apoptosis even in the presence of the protein synthesis inhibitor cycloheximide or the RNA synthesis inhibitor actinomycin D (Fig. 1A); even though [3H]leucine or [3H]uridine incorporation into proteins or RNA were effectively blocked (21.4 ⫾ 0.8 and 9.6 ⫾ 5.1% of control cultures, respectively). The pro-apoptotic effect of etoposide on osteocytic cells, used here for comparison, was


FIGURE 1. Glucocorticoid-induced osteocyte apoptosis is mediated by the glucocorticoid receptor, but does not require new gene transcription. A, MLO-Y4 cells were treated for 2.5 h with vehicle, 1 ␮M cycloheximide, or 2 ␮M actinomycin D, followed by a 6-h treatment with 1 ␮M dexamethasone or 50 ␮M etoposide. Dead cells were enumerated by trypan blue uptake. B and C, MLO-Y4 cells stable transfected with nGFP (MLO-GFP cells) were incubated with vehicle or 10 nM RU486 before addition of dexamethasone or etoposide for 6 h, as detailed under “Experimental Procedures. ” Apoptosis was quantified by evaluating nuclear morphology of transfected (fluorescent) cells (B) and cell detachment, by determining the number of cytoplasmic prolongations (C). Bars represent mean ⫾ S.D. of triplicate determinations. *, p ⬍ 0.05 versus vehicle-treated cultures.

similarly unaffected by the presence of the protein or RNA synthesis inhibitors (Fig. 1A). To determine whether the GR was required for glucocorticoid-induced apoptosis in osteocytic cells, we examined the effect of dexamethasone in the presence of RU486, a GR antagonist (36). Apoptosis induced by 6 h treatment with dexamethasone was absent in cells pre-treated with RU486, whereas apoptosis induced by etoposide was not affected, demonstrating the specificity of the receptor antagonist on the glucocorticoid effect (Fig. 1B). Microscopic examination revealed a profound effect of dexamethasone on the shape of MLO-Y4 cells. Based on this observation, we set up experiments to quantify the phenomenon by evaluating the number of cytoplasmic processes, as an indicator of cell rounding and detachment. Six-h treatments with dexamethasone increased the percentage of cells with ⱕ3 cytoplasmic processes, and this effect was absent in cells pre-treated with RU486 (Fig. 1C), indicating that cell detachment is also mediated by the GR. Taken together, these results indicate that the pro-apoptotic effect of glucocorticoids does not require new gene transcription, is mediated by the GR, and it is associated with cell detachment. Cell Detachment Precedes Induction of Osteocyte Apoptosis by Glucocorticoids—To determine whether cell detachment preceded or followed dexamethasone-induced apoptosis, time course experiments were performed in which apoptosis and cell detachment were evaluated in the same cultures. Apoptosis induced by dexamethasone was first detected 3 h after the addition of the hormone (Fig. 2, A and B), whereas the increase in the percentage of cells exhibiting ⱕ3 cytoplasmic processes was VOLUME 282 • NUMBER 33 • AUGUST 17, 2007


to polyvinylidene difluoride membranes. Immunoblottings were performed using a rabbit anti-phosphorylated Pyk2 antibody (BioSource, Camarillo, CA) or rabbit anti-Pyk2 antibody that recognizes both the human and murine protein (Upstate, Charlottesville, VA). Human GFP-Pyk2 expression was detected using a mouse monoclonal anti-GFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA). ␤-Actin was detected using a mouse monoclonal antibody (Sigma). After incubation with primary antibodies, blots were exposed to anti-rabbit or anti-mouse antibody conjugated with horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA) and developed using a chemiluminescence substrate (Pierce). The intensity of the bands was quantified using the Versadoc Imaging system (Bio-Rad). Real Time PCR—Total RNA was obtained using Ultraspec RNA isolation reagent (Biotecx Laboratories, Houston, TX). Reverse transcription was performed using the High Capacity cDNA Archive Kit. Primers and probes for the housekeeping gene ChoB (probe, 5⬘-TCCAGAGCAGGATCC-3⬘, forward primer, CCCAGGATGGCGACGAT and reverse primer, CCGAATGCTGTAATGGCGTAT) (Assay-by-Design service) and TaqMan Gene Expression Assay for murine Pyk2 (Mm00552840_m1) were used. The PCR was performed using 20 ␮l of Gene Expression Assay Mix TaqMan Universal Master Mix containing 80 ng of each cDNA template in triplicates, using an ABI 7300 Real Time PCR system. The -fold change in expression was calculated using the ⌬⌬Ct comparative threshold cycle method. All the reagents were from Applied Biosystems. Image Acquisition—Fluorescent images were collected on an Axiovert 200 inverted microscope or an Axioplan 2 microscope (Carl Zeiss Light Microscopy, Gottingen, Germany) with a LD A-Plan, ⫻32/0.40 lens and a low light camera (Polaroid DMC Ie, Polaroid Corp., Cambridge, MA), using filter sets for GFP, YFP, or RFP, and the Image-Pro Plus acquisition software (Media Cybernetics, Silver Spring, MD). Confocal images were obtained with an Axiovert LSM410 inverted confocal microscope (Zeiss LSM410) using the 568-nm line of an Argon-Krypton laser and a 590-nm long pass emission filter. Statistical Analysis—Data were analyzed by one-way analysis of variance, and the Student-Newman-Keuls method was used to estimate the level of significance of differences between means.




24123


detachment at 24 h. These findings indicate that changes in cell shape precede glucocorticoid-induced cell detachment. In contrast, cell detachment induced by etoposide occurred subsequent to apoptosis induced by this agent. The Mechanism of Glucocorticoid-induced Apoptosis Involves Focal Adhesion Kinases—Cell attachment and survival depend on the formation of focal adhesions and activation of focal adhesion-associated proteins, such as FAK (37, 38). We have previously shown that phosphorylation of FAK is required for the anti-apoptotic effect of mechanical stimulation on osteocytic cells; and that osteocytic cells overexpressing FAK are resistant to the pro-apoptotic effect of dexamethasone (21). Based on this and on evidence indicating that FAK and Pyk2 have opposite effects on cell survival (17, 18, 20), we investigated whether Pyk2 was involved in the effect of glucocorticoids on osteocytic cells. Dexamethasone induced rapid phosphorylation of Pyk2 in tyrosine 402, which was maximal at FIGURE 2. Time course of glucocorticoid-induced osteocyte apoptosis. Cells were incubated with vehicle (veh), dexamethasone (dex), or etoposide (etop) for the indicated times. Apoptosis was quantified by determin- 10 min and declined to basal levels ing the percentage of MLO-GFP cells exhibiting nuclear fragmentation and chromatin condensation (A) or the by 30 min (Fig. 4A). Moreover, conpercentage of MLO-Y4 cells in which the YFP-caspase 3 sensor (green) co-localized with nRFP (red), seen orange sistent with our previous observain the merged images (B). C, MLO-GFP cells were treated with vehicle or DEVD before addition of the pro-apoptotic agents. The percent of apoptotic cells was determined as in A. Bars represent mean ⫾S.D. of triplicate tions (21), dexamethasone induced determinations. apoptosis in cells expressing empty vector but not in cells overexpressdetected as early as 1 h after addition of the glucocorticoid (Fig. ing FAK (Fig. 4B). In contrast, whereas dexamethasone was able 3A). On the other hand, etoposide-induced apoptosis was to induce apoptosis in cells overexpressing wild type Pyk2, the detected after 3– 6 h, but cell detachment could not be seen pro-apoptotic effect of the glucocorticoid was abolished in cells until 24 h of treatment (Figs. 2, A and B, and 3A). Representative expressing either a Pyk2 mutant that lacks kinase activity (K⫺) images of cultures treated for 6 h with the agents depicting of murine or human origin (Fig. 4, B and C) or a murine Pyk2 apoptotic and morphologic changes are shown in Figs. 2 and mutant that cannot be phosphorylated in tyrosine 402 (Y402F) 3A, respectively. (Fig. 4B). Retraction of osteocyte cytoplasmic processes and cell Remarkably, cells expressing wild type or K⫺ Pyk2 exhibited rounding induced by dexamethasone was also revealed by actin a higher level of basal apoptosis than vector-transfected cells. reorganization visualized by confocal microscopy of cells This effect was observed even when 10 times lower plasmid stained with Alexa Fluor 555-conjugated phalloidin (Fig. 3B). concentrations were transfected into the cells, leading to lower Indeed, the glucocorticoid-induced disruption of stress fibers expression of the proteins, suggesting that it was not due to and formation of peripheral actin rings as early as 1 h and these supra-physiological levels of Pyk2 expression (Fig. 4, B–D). changes were maintained throughout the 24-h culture. In con- Increased basal apoptosis was not observed in cells transfected trast, cells treated with etoposide only showed changes in actin with Y402F Pyk2. In contrast to their effect on dexamethasonefilament organization after 24 h. induced apoptosis, overexpression of FAK, or wild type or Consistent with previous observations by us (11), apoptosis mutated Pyk2 did not affect the pro-apoptotic effect of etopoinduced by either dexamethasone or etoposide (measured at 6 side (Fig. 4, B and C). or 24 h) was inhibited by the cell permeable caspase 3 inhibitor We next investigated the requirement of Pyk2 expression for DEVD (Fig. 2C). However, DEVD did not prevent dexametha- dexamethasone-induced apoptosis and changes in cell shape, sone-induced cell detachment at either 6 or 24 h (Fig. 3C). On by silencing the expression of murine Pyk2 with small interferthe other hand, DEVD prevented etoposide-induced cell ence RNAs. Pyk2 mRNA and protein expression was greatly





upper panels). Cell detachment was quantified by enumerating the number of cytoplasmic processes using a filter set for GFP. To allow simultaneous assessment of apoptosis, cells were co-transfected with nRFP and apoptotic cells were quantified using a filter set for RFP (Fig. 5C, lower panels). Dexamethasone did not induce apoptosis or cell detachment in cells in which Pyk2 expression had been knocked down (Fig. 5, D and E). Moreover, transfection of human wild type Pyk2, but not K⫺ Pyk2, rescued both apoptosis and cell detachment induced by the glucocorticoid. On the other hand, silencing the control protein lamin did not affect apoptosis or cell detachment induced by dexamethasone. In addition, transfection of wild type or K⫺ Pyk2 not only increased basal levels of apoptosis confirming the results of Fig. 4C, but also increased the percentage of cells with ⱕ3 cytoplasmic processes (Fig. 5E). Knocking down or overexpressing Pyk2 did not modify the response of osteocytic cells to etoposide. Taken together, these findings indicate that Pyk2 expression, its kinase activity, and tyrosine 402 are required for glucocorticoid-induced apoptosis and cell detachment. Furthermore, these results demonstrate that overexpression of Pyk2 increases osteocytic cell FIGURE 3. Glucocorticoid-induced osteocyte apoptosis is preceded by cell detachment. A, cells were detachment and apoptosis; and that incubated with vehicle (veh), dexamethasone (dex), or etoposide (etop) for the indicated times. Cell this effect is independent of Pyk2 detachment was quantified in MLO-GFP cells as detailed under “Experimental Procedures. ” Representa- kinase activity, although it requires tive images of MLO-GFP or MLO-Y4 cells stained with H&E show the morphologic changes observed after 6 h of treatment. B, actin filament reorganization was visualized in MLO-Y4 cells by confocal microcopy of tyrosine 402 phosphorylation. cells stained with phalloidin-Alexa Fluor 555. C, MLO-GFP cells were treated with vehicle or DEVD before Glucocorticoid-induced Apoptoaddition of the pro-apoptotic agents. Cell detachment was quantified as in A. Bars represent mean ⫾S.D. sis Requires Ca2⫹ Entry through of triplicate determinations. Stress-activated Ca2⫹ Channels reduced compared with mock-transfected cells or cells trans- and Activation of JNK—In line with the requirement of Pyk2 fected with the negative control small interfering RNA for for the pro-apoptotic effect of glucocorticoids and previous lamin, as determined by real time reverse transcriptase-PCR evidence indicating that elevation of cytosolic Ca2⫹ leads to and Western blotting, respectively (Fig. 5, A and B). Trans- Pyk2 activation (20), dexamethasone did not induce osteofection with human wild type or K⫺ Pyk2 fused to GFP cyte apoptosis in cells in which intracellular Ca2⫹ was cherecovered Pyk2 expression, as evidenced by Western blot lated with BAPTA-AM (Fig. 6A). Depletion of intracellular analysis using anti-Pyk2 and anti-GFP antibodies (Fig. 5B) stores with thapsigargin, however, did not affect the proand by fluorescence microscopy (Fig. 5C, upper panels). apoptotic action of dexamethasone. In contrast, chelation of Likewise, GFP expression in control-transfected cells was extracellular calcium with EGTA abolished the pro-apoptodocumented by Western blot analysis with anti-GFP anti- tic effect of dexamethasone. In addition, blockade of L-type bodies (Fig. 5B) and by fluorescence microscopy (Fig. 5C, voltage-sensitive calcium channels with nifedipine had no




24125


on the pro-apoptotic effect of dexamethasone. Consistent with these findings, cells expressing a dominant negative form of JNK (26, 27) were protected from dexamethasone-induced apoptosis, whereas cells expressing a dominant negative form of MEK, the kinase that phosphorylates ERKs (25), were still responsive (Fig. 6D). Likewise, blockade of JNK activity by either the SP600125 inhibitor or the dominant negative JNK also prevented dexamethasone-induced cell detachment (Fig. 6, E and F). The findings described above established that both Pyk2 and JNK are required for the effects of glucocorticoids on osteocytic cells. To directly establish a link between Pyk2 and JNK activation, we examined whether the inability of dexamethasone to affect cells overexpressing the unphosphorylatable Y402F Pyk2 was reversed by JNK activation. We found that overexpression of wild type JNK that acts as a moderate constitutively active kinase (26) or of a constitutively active form of MEKK1 (⌬MEKK1) that is an upstream JNK activator (28), rescued the dexamethasoneinduced pro-apoptotic effect and the reduction in the number of cytoFIGURE 4. FAK prevents, whereas Pyk2 kinase activity and phosphorylation are required for, glucocor- plasmic processes in Y402F Pyk2 ticoid-induced apoptosis. A, Pyk2 phosphorylation in tyrosine 402 was determined by Western blot analysis expressing cells (Figs. 7, A and B). of MLO-Y4 cells treated with dexamethasone for the indicated times. A representative experiment and the mean -fold changes (⫾ S.D.) in five independent experiments are shown. B–D, cells were transiently transfected On the other hand, cells expressing with the indicated amounts of Pyk2 along with nGFP (for murine Pyk2) or nRFP (for human Pyk2-GFP). Forty vector or a constitutively active hours after transfection, apoptosis was assayed as detailed under “Experimental Procedures.” *, p ⬍ 0.05 versus which activates ERKs, vehicle-treated cultures for each construct; #, p ⬍ 0.05 versus vector-transfected, vehicle-treated cultures. D, Pyk2 MEK, levels were determined by Western blotting in MLO-Y4 cells transiently transfected with wild type and mutated remained unresponsive to the glumurine Pyk2 or human Pyk2-GFP. Western blotting for ␤-actin shows sample loading. Bars represent mean ⫾S.D. of cocorticoid. These findings confirm triplicate determinations. that activation of Pyk2 and JNK are linked and establish that JNK lies effect, whereas inhibition of stress-activated channels with downstream of Pyk2 activation by dexamethasone. Taken together, these findings strongly suggest that glugadolinium abolished glucocorticoid-induced apoptosis. Moreover, BAPTA, EGTA, and gadolinium prevented Pyk2 cocorticoids activate Pyk2 by inducing Ca2⫹ entrance from the phosphorylation induced by dexamethasone (Fig. 6B). extracellular space leading to a rapid rise in intracellular Ca2⫹. Pyk2 activation has been shown to result in activation of sev- Pyk2 activation, in turn, leads to activation of JNK, followed by eral kinases, including Src, ERKs, and PI3K, as well as the pro- cell detachment and apoptosis. apoptotic members of mitogen-activated protein kinase family p38 and JNK (20, 39, 40). We therefore investigated which of DISCUSSION these kinases was involved in the pro-apoptotic effect of gluBoth cell survival and attachment are controlled by the focal cocorticoids on osteocytes. To this end, we used pharmacologic adhesions, sites at the plasma membrane in which integrins inhibitors at concentrations known to effectively inhibit the interact with the extracellular matrix and with intracellular corresponding kinases in osteocytic and osteoblastic cells (11, structural and catalytic molecules (42– 44). Signaling mediated 21, 29, 41). Inhibition of JNK with SP600125 blocked dexa- by integrins is bidirectional. Thus, extracellular matrix proteins methasone-induced osteocyte apoptosis (Fig. 6C). On the other induce integrin engagement and activate intracellular signaling hand, inhibitors of Src, ERKs, PI3K, or p38 kinases had no effect (referred to as outside-in signaling). In turn, activation of intra-





matrix leads to survival, loss of this interaction causes detachment-induced apoptosis or anoikis (44). The findings reported herein together with previous observations of ours demonstrate that integrin engagement maintains osteocyte survival and that glucocorticoids oppose this integrin/FAK-dependent anti-apoptotic signaling by activating Pyk2 and JNK. This rapid intracellular signaling is followed by inside-out signaling that causes osteocyte detachment and leads to anoikis. Although not directly investigated in the present study, it is likely that glucocorticoids promote apoptosis of osteoblasts by a similar mechanism than the one described here for osteocytes. Indeed, survival of both osteoblasts and osteocytes is maintained by their interaction with extracellular matrix proteins, as indicated by the fact that neutralizing antibodies to the extracellular matrix protein fibronectin or inhibitors of metalloproteinases induce osteoblast apoptosis (47–49). Moreover, transgenic mice expressing collagenase-resistant collagen type-I exhibit increased prevalence of osteoblast and osteocyte apoptosis (50), and, osteocyte apoptosis is also elevated in metalloproteinase-2 null mice (51). Therefore, cellular interactions with intact or cryptic sites of extracellular matrix proteins are required to maintain osteocyte and osteoblast viability. Osteocytes are tethered through integrins to the lacunar and canalicular walls by fibers composed of proteoglycans (52). It has been proposed that fluid movement in FIGURE 5. Pyk2 is required for glucocorticoid-induced apoptosis and cell detachment. Pyk2 expression the canaliculi resulting from was silenced in MLO-Y4 cells using small interfering RNAs (siRNA). Control cultures were left untreated (⫺) or mechanical loading generates a silenced for the irrelevant protein lamin A/C. Pyk2 expression was rescued by transfecting GFP (negative control) or Pyk2-GFP constructs. Cells were co-transfected with nRFP to allow apoptosis quantification. A and B, drag force that shortens the disPyk2 levels were determined (A) by real time reverse transcriptase-PCR using primers specific for murine Pyk2, tance between osteocyte memnormalized by ChoB; and B, by Western blotting using an anti-Pyk2 antibody recognizing both murine and human Pyk2. The expression of hPyk2-GFP (and the GFP control) was confirmed by blotting with an anti-GFP branes and the canalicular wall, antibody; and equal sample loading by using an anti-␤-actin antibody. C, the expression of GFP, Pyk2-GFP, and inducing strain at the membrane nRFP was visualized under a fluorescence microscope. D and E, apoptosis (D) and cell morphology (E) were level (53). We have recently demquantified as detailed under “Experimental Procedures. ” *, p ⬍ 0.05 versus vehicle-treated cultures for each construct; #, p ⬍ 0.05 versus vector-transfected, vehicle-treated cultures. Bars represent mean ⫾S.D. of tripli- onstrated that bone loading is cate determinations. required to maintain osteocyte viability (54), and mechanical forces cellular signaling or changes in the composition of the focal are transduced into intracellular survival signaling by integrins adhesions regulates the interaction of integrins with extracel- and a signalsome comprising cytoskeletal and catalytic proteins lular matrix proteins (referred to as inside-out signaling) (45, including FAK (21). The current studies support the notion that 46). Whereas association of integrins with the extracellular osteocyte fate is controlled by the balance between FAK and




24127


PI3K, downstream targets of FAK with recognized pro-survival effects on osteoblastic cells (11, 21, 22). These changes in signaling downstream of focal adhesion kinases induced by glucocorticoids, combined with down-regulation of genes that prolong survival, such as interleukin-6, insulin growth factors, transforming growth factor ␤, collagenase type I, and integrin ␤1 (1, 58 – 61), could result in the increased prevalence of osteocyte and osteoblast apoptosis observed in vivo. Consistent with our findings in osteocytes, glucocorticoids modulate intracellular signaling in other cells through rapid actions independent of transcriptional effects, but dependent on the GR. Specifically, ERKs, PI3K, p38, and JNK kinases are activated or inhibited by these agents depending on the cell type (2, 13, 62– 66). In addition, glucocorticoids activate Pyk2. Moreover, similar to our findings in osteocytic cells, overexpression of a kinase-inactive Pyk2 mutant abolishes glucocorticoid-induced apop2ⴙ FIGURE 6. Ca entry through stress-activated channels and activation of JNK are required for glucocor- tosis of myeloma cells (17). ticoid-induced osteocyte apoptosis. A and B, MLO-GFP cells were treated with vehicle, BAPTA-AM (10 ␮M), Support for the in vivo relevance thapsigargin (0.01 ␮M), EGTA (5 mM), nifedipine (10 ␮M), or gadolinium (Gd) chloride (50 ␮M), before addition of of the mechanism described herein vehicle (veh) or dexamethasone (dex) for 6 h for quantification of apoptosis (A) or for 10 min for detection of Pyk2 phosphorylation by Western blotting (B). Apoptosis and cell detachment were quantified as detailed has been provided by studies in under “Experimental Procedures, ” in MLO-GFP cells treated with SP600125 (3 ␮M), PP1 (1 ␮M), PD98059 (50 transgenic mice expressing a dimer␮M), wortmannin (30 nM), or SB203580 (100 ␮M) before addition of dexamethasone (C and E) or in MLO-Y4 cells transfected with the indicated constructs (D and F). *, p ⬍ 0.05 versus vehicle-treated cultures. dn, dominant ization-deficient GR that lacks the ability to bind to DNA (67). In line negative. Bars represent mean ⫾S.D. of triplicate determinations. with the evidence of the present Pyk2. Thus, FAK overexpression abolishes glucocorticoid-in- report that glucocorticoid-induced apoptosis of osteocytes duced apoptosis of osteocytes. Conversely, Pyk2 overexpres- (and most likely osteoblasts) is mediated through a transcripsion leads to osteocyte apoptosis even in the absence of glu- tion-independent mechanism, Tuckermann et al. (67) have cocorticoids. Consistent with these findings, FAK activation found that DNA binding of the GR is indeed dispensable for the prevents anoikis in different cell types (55–57); and Pyk2 over- deleterious effect of glucocorticoids on the skeleton of these expression induces apoptosis of fibroblasts (18). Similar to our mice. Earlier work of ours (22, 41) has demonstrated that nonresults, Xiong and Parsons (18) found that the kinase-deficient Pyk2 (K⫺) is also able to stimulate apoptosis. The mechanism of genotropic actions of the receptors for estrogens or vitamin D this phenomenon is unknown. One possibility is that by over- can be dissociated from transcriptional effects using synthetic expressing either form of Pyk2, the ratio Pyk2/FAK at the focal ligands. This knowledge, along with the findings reported adhesions increases, thereby counteracting the pro-survival herein, raises the hope that one may be able to design in the effect of FAK. The inability of the unphosphorylatable Y402F future anti-inflammatory glucocorticoid analogs incapable of Pyk2 to induce apoptosis might result from deficient targeting activating Pyk2; and hence spare the skeleton from the adverse of the mutant to the focal adhesions or its failure to displace effect of classical glucocorticoids. The precise mechanism by which glucocorticoids activate FAK. Our findings indicate that one of the consequences of Pyk2 Pyk2 in osteocytes is unclear. However, our findings implicate a activation is the activation of the pro-apoptotic kinase JNK. raise in intracellular Ca2⫹ via stress-activated channels. In line However, it is likely that changes in the ratio between Pyk2 and with these findings, Pyk2 activation by stress inducers is Ca2⫹ FAK activity induced by glucocorticoids favor apoptosis by dependent (16). Moreover, Pyk2 is activated by agents that additional mechanisms, such as reducing the activity of ERKs or increase cytoplasmic Ca2⫹, such as thapsigargin, Ca2⫹ iono-





sion, thereby prolonging the resorbing activity of osteoclasts. Future studies are required to examine this possibility. Finally, recent evidence indicates that increased endogenous glucocorticoids may contribute to the bone fragility associated with old age. Thus, like patients treated with glucocorticoids, older individuals are ⬃10 times more likely to suffer fractures than younger individuals with the same mineral density (81). Similar to glucocorticoid excess, aging in mice is associated with increased osteocyte and osteoblast apoptosis and decreased bone strength that is not completely explained by a reduction in bone mineral density (82). Although Pyk2 null mice do not show gross anatomical alterations (83), recent studies revealed that these animals exhibit higher bone mass. This phenotype appears to result from defecFIGURE 7. Pyk2 activation by glucocorticoids results in activation of JNK leading to osteocyte anoikis. MLO-Y4 cells were transfected with the indicated constructs together with nGFP. Forty hours after transfection, tive osteoclast attachment and cells were treated with vehicle or dexamethasone for 6 h. Apoptosis (A) and cell detachment (B) were quantified resorption leading to osteopetrosis as detailed under “Experimental Procedures. ” *, p ⬍ 0.05 versus vehicle-treated cultures for each construct. ca, (84) combined with increased bone constitutively active. Bars represent mean ⫾S.D. of triplicate determinations. formation and improved bone phores as well as growth factors (16, 39, 68, 69). A potential structure (85). Whether the response to glucocorticoids is mechanism by which glucocorticoids could stimulate Ca2⫹ altered in Pyk2-deficient mice or whether Pyk2 null mice are influx from the extracellular space is by increasing the produc- protected from aging-induced bone fragility warrants furtion of reactive oxygen species (ROS) (70). In agreement with ther investigations. In summary, we describe herein a novel pathway triggered by this contention, elevated levels of ROS activate Pyk2 in several glucocorticoids in osteocytes mediated by the GR. It involves cell types (71, 72). Besides Pyk2, ROS elevation modulates the activity of mem- activation of rapid intracellular signaling leading to detachbers of the Rho family of small GTPases, focal adhesion-associ- ment-induced apoptosis. Interference with this pathway may ated proteins involved in cytoskeleton organization and cell prove beneficial for counteracting the adverse skeletal impact attachment (73). ROS up-regulates the activity of the small of glucocorticoid- or aging-induced osteocyte apoptosis leadGTPase RhoA and the Rho-activated effector kinase ROCK ing to bone fragility. (74). Activation of Rac1, another small GTPase, also depends on ROS production and leads to inhibition of endothelial cell Acknowledgments—We thank Kanan Vyas and William Webb for adhesion (75). Moreover, RhoA, Rac1, as well as Cdc42 are all technical assistance and members of the University of Arkansas Medcapable of activating the JNK pathway (73). Furthermore, JNK ical Sciences Center for Osteoporosis and Metabolic Bone Diseases for activation by Pyk2 depends on Rho/ROCK activation in vascu- insightful suggestions. lar smooth muscle cells (76). Future studies are needed to determine whether anoikis of osteocytes induced by glucocorticoids REFERENCES involves changes in ROS production and/or the activity of small 1. Necela, B. M., and Cidlowski, J. A. (2004) Proc. Am. Thorac. Soc. 1, GTPases. 239 –246 In contrast to their pro-apoptotic effect on osteocytes and 2. Rhen, T., and Cidlowski, J. A. (2005) N. Engl. J. Med. 353, 1711–1723 osteoblasts, glucocorticoids prolong the lifespan of osteoclasts 3. Newell-Price, J., Bertagna, X., Grossman, A. B., and Nieman, L. K. (2006) (77, 78), but the mechanism of this effect remains unknown. Lancet 367, 1605–1617 4. Weinstein, R. S. (2001) Rev. Endocr. Metab. Disord. 2, 65–73 Pyk2 is critical for osteoclast function as its phosphorylation in 5. Van Staa, T. P. (2006) Calcif. Tissue Int. 79, 129 –137 tyrosine 402 is required for formation of the sealing zone and 6. Mazziotti, G., Angeli, A., Bilezikian, J. P., Canalis, E., and Giustina, A. initiation of bone resorption by the osteoclast (79, 80). In view (2006) Trends Endocrinol. Metab. 17, 144 –149 of this evidence, the findings of the present report raise the 7. Weinstein, R. S., Jilka, R. L., Parfitt, A. M., and Manolagas, S. C. (1998) possibility that the pro-survival effects of glucocorticoids on J. Clin. Investig. 102, 274 –282 osteoclasts result from activation of Pyk2 and increased adhe8. O’Brien, C. A., Jia, D., Plotkin, L. I., Bellido, T., Powers, C. C., Stewart, S. A.,



42. 43. 44. 45. 46. 47. 48. 49. 50. 51.

52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67.

68.

69. 70. 71. 72. 73. 74. 75.

76.

77.

Giancotti, F. G., and Ruoslahti, E. (1999) Science 285, 1028 –1032 Clark, E. A., and Brugge, J. S. (1995) Science 268, 233–239 Frisch, S. M., and Ruoslahti, E. (1997) Curr. Opin. Cell Biol. 9, 701–706 Ginsberg, M. H., Partridge, A., and Shattil, S. J. (2005) Curr. Opin. Cell Biol. 17, 509 –516 Hynes, R. (2002) Cell 110, 673– 687 Globus, R. K., Doty, S. B., Lull, J. C., Holmuhamedov, E., Humphries, M. J., and Damsky, C. H. (1998) J. Cell Sci. 111, 1385–1393 Karsdal, M. A., Larsen, L., Engsig, M. T., Lou, H., Ferreras, M., Lochter, A., Delaisse, J. M., and Foged, N. T. (2002) J. Biol. Chem. 277, 44061– 44067 Karsdal, M. A., Andersen, T. A., Bonewald, L., and Christiansen, C. (2004) DNA Cell Biol. 23, 155–165 Zhao, W., Byrne, M. H., Wang, Y., and Krane, S. M. (2000) J. Clin. Investig. 106, 941–949 Inoue, K., Mikuni-Takagaki, Y., Oikawa, K., Itoh, T., Inada, M., Noguchi, T., Park, J. S., Onodera, T., Krane, S. M., Noda, M., and Itohara, S. (2006) J. Biol. Chem. 281, 33814 –33824 You, L. D., Weinbaum, S., Cowin, S. C., and Schaffler, M. B. (2004) Anat. Rec. 278A, 505–513 You, L. D., Cowin, S. C., Schaffler, M. B., and Weinbaum, S. (2001) J. Biomech. 34, 1375–1386 Aguirre, J. I., Plotkin, L. I., Stewart, S. A., Weinstein, R. S., Parfitt, A. M., Manolagas, S. C., and Bellido, T. (2006) J. Bone Miner. Res. 21, 605– 615 Frisch, S. M., Vuori, K., Ruoslahti, E., and Chan-Hui, P. Y. (1996) J. Cell Biol. 134, 793–799 Gilmore, A. P. (2005) Cell Death Differ. 12, 1473–1477 Zhan, M., Zhao, H., and Han, Z. C. (2004) Histol. Histopathol. 19, 973–983 Vanden Berghe, W., Francesconi, E., De Bosscher, K., Resche-Rigon, M., and Haegeman, G. (1999) Mol. Pharmacol. 56, 797– 806 Cheng, S. L., Zhang, S. F., Mohan, S., Lecanda, F., Fausto, A., Hunt, A. H., Canalis, E., and Avioli, L. V. (1998) J. Cell. Biochem. 71, 449 – 458 Chang, D. J., Ji, C., Kim, K. K., Casinghino, S., McCarthy, T. L., and Centrella, M. (1998) J. Biol. Chem. 273, 4892– 4896 Doherty, W. J., Derome, M. E., McCarthy, M. B., and Gronowicz, G. A. (1995) J. Bone Joint Surg. Am. 77, 396 – 404 Stellato, C. (2006) Proc. Am. Thorac. Soc. 1, 255–263 Gardai, S. J., Hoontrakoon, R., Goddard, C. D., Day, B. J., Chang, L. Y., Henson, P. M., and Bratton, D. L. (2003) J. Immunol. 170, 556 –566 Zhang, J. P., Wong, C. K., and Lam, C. W. (2000) Clin. Exp. Immunol. 122, 20 –27 Miller, A. L., Webb, M. S., Copik, A. J., Wang, Y., Johnson, B. H., Kumar, R., and Thompson, E. B. (2005) Mol. Endocrinol. 19, 1569 –1583 Engelbrecht, Y., de Wet, H., Horsch, K., Langeveldt, C. R., Hough, F. S., and Hulley, P. A. (2003) Endocrinology 144, 412– 422 Tuckermann, J., Schilling, A. F., Priemel, M., Stride, B., Kirilov, M., Wintermantel, T., Tronche, F., Amling, M., and Schultz, G. (2005) J. Bone Miner. Res. 20, S27. Murasawa, S., Matsubara, H., Mori, Y., Masaki, H., Tsutsumi, Y., Shibasaki, Y., Kitabayashi, I., Tanaka, Y., Fujiyama, S., Koyama, Y., Fujiyama, A., Iba, S., and Iwasaka, T. (2000) J. Biol. Chem. 275, 26856 –26863 Hiregowdara, D., Avraham, H., Fu, Y., London, R., and Avraham, S. (1997) J. Biol. Chem. 272, 10804 –10810 Iuchi, T., Akaike, M., Mitsui, T., Ohshima, Y., Shintani, Y., Azuma, H., and Matsumoto, T. (2003) Circ. Res. 92, 81– 87 Frank, G. D., Motley, E. D., Inagami, T., and Eguchi, S. (2000) Biochem. Biophys. Res. Commun. 270, 761–765 Tai, L. K., Okuda, M., Abe, J., Yan, C., and Berk, B. C. (2002) Arterioscler. Thromb. Vasc. Biol. 22, 1790 –1796 Jaffe, A. B., and Hall, A. (2005) Annu. Rev. Cell Dev. Biol. 21, 247–269 Touyz, R. M. (2005) Antioxid. Redox. Signal. 7, 1302–1314 van Wetering, S., van Buul, J. D., Quik, S., Mul, F. P., Anthony, E. C., ten Klooster, J. P., Collard, J. G., and Hordijk, P. L. (2002) J. Cell Sci. 115, 1837–1846 Ohtsu, H., Mifune, M., Frank, G. D., Saito, S., Inagami, T., Kim-Mitsuyama, S., Takuwa, Y., Sasaki, T., Rothstein, J. D., Suzuki, H., Nakashima, H., Woolfolk, E. A., Motley, E. D., and Eguchi, S. (2005) Arterioscler. Thromb. Vasc. Biol. 25, 1831–1836 Kim, H. J., Zhao, H., Kitaura, H., Bhattacharyya, S., Brewer, J. A., Muglia, L. J.,


24129


Manolagas, S. C., and Weinstein, R. S. (2004) Endocrinology 145, 1835–1841 9. Gohel, A., McCarthy, M. B., and Gronowicz, G. (1999) Endocrinology 140, 5339 –5347 10. Jilka, R. L., Weinstein, R. S., Bellido, T., Roberson, P., Parfitt, A. M., and Manolagas, S. C. (1999) J. Clin. Investig. 104, 439 – 446 11. Plotkin, L. I., Weinstein, R. S., Parfitt, A. M., Roberson, P. K., Manolagas, S. C., and Bellido, T. (1999) J. Clin. Investig. 104, 1363–1374 12. Druilhe, A., Letuve, S., and Pretolani, M. (2003) Apoptosis 8, 481– 495 13. Limbourg, F. P., and Liao, J. K. (2003) J. Mol. Med. 81, 168 –174 14. Chauhan, D., Pandey, P., Ogata, A., Teoh, G., Treon, S., Urashima, M., Kharbanda, S., and Anderson, K. C. (1997) Oncogene 15, 837– 843 15. Blaukat, A., Ivankovic-Dikic, I., Gronroos, E., Dolfi, F., Tokiwa, G., Vuori, K., and Dikic, I. (1999) J. Biol. Chem. 274, 14893–14901 16. Tokiwa, G., Dikic, I., Lev, S., and Schlessinger, J. (1996) Science 273, 792–794 17. Chauhan, D., Hideshima, T., Pandey, P., Treon, S., Teoh, G., Raje, N., Rosen, S., Krett, N., Husson, H., Avraham, S., Kharbanda, S., and Anderson, K. C. (1999) Oncogene 18, 6733– 6740 18. Xiong, W., and Parsons, J. T. (1997) J. Cell Biol. 139, 529 –539 19. Sasaki, H., Nagura, K., Ishino, M., Tobioka, H., Kotani, K., and Sasaki, T. (1995) J. Biol. Chem. 270, 21206 –21219 20. Avraham, H., Park, S., Schinkmann, K., and Avraham, S. (2000) Cell. Signal. 12, 123–133 21. Plotkin, L. I., Mathov, I., Aguirre, J. I., Parfitt, A. M., Manolagas, S. C., and Bellido, T. (2005) Am. J. Physiol. 289, C633–C643 22. Kousteni, S., Bellido, T., Plotkin, L. I., O’Brien, C. A., Bodenner, D. L., Han, L., Han, K., DiGregorio, G. B., Katzenellenbogen, J. A., Katzenellenbogen, B. S., Roberson, P. K., Weinstein, R. S., Jilka, R. L., and Manolagas, S. C. (2001) Cell 104, 719 –730 23. Chan, P. Y., Kanner, S. B., Whitney, G., and Aruffo, A. (1994) J. Biol. Chem. 269, 20567–20574 24. Sancho, D., Nieto, M., Llano, M., Rodriguez-Fernandez, J. L., Tejedor, R., Avraham, S., Cabanas, C., Lopez-Botet, M., and Sanchez-Madrid, F. (2000) J. Cell Biol. 149, 1249 –1262 25. Mansour, S. J., Matten, W. T., Hermann, A. S., Candia, J. M., Rong, S., Fukasawa, K., Vande Woude, G. F., and Ahn, N. G. (1994) Science 265, 966 –970 26. Pedram, A., Razandi, M., and Levin, E. R. (1998) J. Biol. Chem. 273, 26722–26728 27. Pedram, A., Razandi, M., and Levin, E. R. (2001) Endocrinology 142, 1578 –1586 28. Pawate, S., and Bhat, N. R. (2006) Antioxid. Redox. Signal. 8, 903–909 29. Plotkin, L. I., Manolagas, S. C., and Bellido, T. (2002) J. Biol. Chem. 277, 8648 – 8657 30. Kato, Y., Windle, J. J., Koop, B. A., Mundy, G. R., and Bonewald, L. F. (1997) J. Bone Miner. Res. 12, 2014 –2023 31. Plotkin, L. I., Manolagas, S. C., and Bellido, T. (2006) Bone 39, 443– 452 32. Almeida, M., Han, L., Bellido, T., Manolagas, S. C., and Kousteni, S. (2005) J. Biol. Chem. 280, 41342– 41351 33. Liu, Y., Porta, A., Peng, X., Gengaro, K., Cunningham, E. B., Li, H., Dominguez, L. A., Bellido, T., and Christakos, S. (2004) J. Bone Miner. Res. 19, 479 – 490 34. Carter, C. A., and Bellido, T. (1999) J. Cell. Physiol. 178, 320 –332 35. Kogianni, G., Mann, V., Ebetino, F., Nuttall, M., Nijweide, P., Simpson, H., and Noble, B. (2004) Life Sci. 75, 2879 –2895 36. Agarwal, M. K., Hainque, B., Moustaid, N., and Lazer, G. (1987) FEBS Lett. 217, 221–226 37. Hanks, S. K., Ryzhova, L., Shin, N. Y., and Brabek, J. (2003) Front. Biosci. 8, D982–D996 38. Cary, L. A., and Guan, J. L. (1999) Front. Biosci. 4, D102–D113 39. Yu, H., Li, X., Marchetto, G. S., Dy, R., Hunter, D., Calvo, B., Dawson, T. L., Wilm, M., Anderegg, R. J., Graves, L. M., and Earp, H. S. (1996) J. Biol. Chem. 271, 29993–29998 40. Heidkamp, M. C., Scully, B. T., Vijayan, K., Engman, S. J., Szotek, E. L., and Samarel, A. M. (2005) Am. J. Physiol. 289, C471–C482 41. Vertino, A. M., Bula, C. M., Chen, J. R., Almeida, M., Han, L., Bellido, T., Kousteni, S., Norman, A. W., and Manolagas, S. C. (2005) J. Biol. Chem. 280, 14130 –14137

Glucocorticoids, FAK, Pyk2, and Osteocyte Apoptosis Ross, F. P., and Teitelbaum, S. L. (2006) J. Clin. Investig. 116, 2152–2160 78. Weinstein, R. S., Chen, J. R., Powers, C. C., Stewart, S. A., Landes, R. D., Bellido, T., Jilka, R. L., Parfitt, A. M., and Manolagas, S. C. (2002) J. Clin. Investig. 109, 1041–1048 79. Lakkakorpi, P. T., Bett, A. J., Lipfert, L., Rodan, G. A., and Duong, L. T. (2003) J. Biol. Chem. 278, 11502–11512 80. Sanjay, A., Houghton, A., Neff, L., Didomenico, E., Bardelay, C., Antoine, E., Levy, J., Gailit, J., Bowtell, D., Horne, W. C., and Baron, R. (2001) J. Cell Biol. 152, 181–195 81. Hui, S. L., Slemenda, C. W., and Johnston, C. C., Jr. (1988) J. Clin. Investig. 81, 1804 –1809 82. Weinstein, R. S., Jia, D., Chambers, T. M., Hogan, E. A., Berryhill, S. B., Shelton, R., Stewart, S. A., Jilka, R. L., and Manolagas, S. C. (2006) J. Bone

Miner. Res. 21, S62 83. Okigaki, M., Davis, C., Falasca, M., Harroch, S., Felsenfeld, D. P., Sheetz, M. P., and Schlessinger, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 10740 –10745 84. Gil-Henn, H., Destaing, O., Bruzzaniti, A., Neff, L., Sims, N., Aoki, K., Alles, N., Sanjay, A., Baron, R., and Schlessinger, J. (2006) J. Bone Miner. Res. 21, S67 85. Buckbinder, L., Crawford, D. T., Qi, H., Ke, H. Z., Olson, L. M., Long, K. R. Bonette, P. C., Baumann, A. P., Hambor, J. E., Grasser, W. A., III, Pan, L. C., Owen, T. A., Luzzio, M. S., Hulford, C. A., Gebmard, D. F., Paralkar, V. M., Simmons, M. A., Kath, J. C., Roberts, W. G., Smock, S. L., Guzman-Perez, A., Brown, T. A., and Li, M. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 10619 –10624




Glucocorticoids Induce Osteocyte Apoptosis by Blocking Focal Adhesion Kinase-mediated Survival: EVIDENCE FOR INSIDE-OUT SIGNALING LEADING TO ANOIKIS Lillian I. Plotkin, Stavros C. Manolagas and Teresita Bellido J. Biol. Chem. 2007, 282:24120-24130. doi: 10.1074/jbc.M611435200 originally published online June 20, 2007

Access the most updated version of this article at doi: 10.1074/jbc.M611435200 Alerts: • When this article is cited • When a correction for this article is posted

This article cites 85 references, 31 of which can be accessed free at http://www.jbc.org/content/282/33/24120.full.html#ref-list-1


Click here to choose from all of JBC's e-mail alerts