Greenhouse Gas, Animal Performance, and ... - Semantic Scholar

TECHNICAL REPORTS: ATMOSPHERIC POLLUTANTS AND TRACE GASES TECHNICAL REPORTS

Greenhouse Gas, Animal Performance, and Bacterial Population Structure Responses to Dietary Monensin Fed to Dairy Cows Scott W. Hamilton and Edward J. DePeters University of California–Davis Jeffery A. McGarvey and Jeremy Lathrop USDA-ARS Frank M. Mitloehner* University of California–Davis The present study investigated the effects of a feed additive and rumen microbial modifier, monensin sodium (monensin), on selected variables in lactating dairy cows. Monensin fed cows (MON, 600 mg d–1) were compared with untreated control cows (CON, 0 mg d–1) with respect to the effects of monensin on the production of three greenhouse gases (GHG), methane (CH4), nitrous oxide (N2O), and carbon dioxide (CO2), along with animal performance (dry matter intake; DMI), milk production, milk components, plasma urea nitrogen (PUN), milk urea nitrogen (MUN), and the microbial population structure of fresh feces. Measurements of GHG were collected at Days 14 and 60 in an environmental chamber simulating commercial dairy freestall housing conditions. Milk production and DMI measurements were collected twice daily over the 60-d experimental period; milk components, PUN, and MUN were measured on Days 14 and 60. The microbial population structure of feces from 6 MON and 6 CON cows was examined on three different occasions (Days 14, 30, and 60). Monensin did not affect emissions of methane (CH4), nitrous oxide (N2O), and carbon dioxide (CO2). Over a 24-h period, emissions of CH4, N2O, and CO2 decreased in both MON and CON groups. Animal performance and the microbial population structure of the animal fresh waste were also unaffected for MON vs. CON cows.

Copyright © 2010 by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America. All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Published in J. Environ. Qual. 39:106–114 (2010). doi:10.2134/jeq2009.0035 Published online 22 Oct. 2009. Received 27 Jan. 2009. *Corresponding author ([email protected]) © ASA, CSSA, SSSA 677 S. Segoe Rd., Madison, WI 53711 USA

C

alifornia is the largest dairy state in the United States, home to 1.8 million lactating cows producing approximately 24% of the nation’s milk supply (1.6 billion kg yr–1, Agricultural Statistics Board, 2007). The dairy industry in California has increased in size every year since 1985, and along with this growth, challenges have emerged including environmental impacts, cost of animal feed, and shrinking availability of suitable farmland and water for dairy production. Paramount among the problems facing the dairy industry is the impact the dairy industry has on the environment. A main environmental concern associated with the dairy industry is the emission of GHG. The primary GHG are methane (CH4), nitrous oxide (N2O), and carbon dioxide (CO2). Livestock are considered a major source of global CH4, together with N2O emissions from enteric fermentation and their manure (IPCC, 2001). Contributions of CH4 and CO2 from lactating dairy cows are primarily derived from enteric fermentation and respiration (Jungbluth et al., 2001), and to a lesser extent from stored manure (Shaw et al., 2007). Livestock respiration contributes significant amounts of CO2—approximately half of total CO2 emissions from both humans and animals worldwide. Under the Kyoto Protocol, livestock contributions of CO2 are not considered a net source, because the plant matter being consumed has previously sequestered atmospheric CO2 (FAO, 2006). Methane production from cattle is a complex process that involves anaerobic bacterial fermentation and archaeal methanogenesis. During this process, rumen microbes convert ingested organic matter into energy for microbial growth, and into fermentation end-products, including volatile fatty acids, alcohols, H2, and CO2. Methanogenic archaea are able to take some of these end products (i.e., formate, acetate, MeOH, and CO2) and reduce them with H2 to produce CH4 and H2O. Accumulated CH4 and other volatile gases produced in the rumen are eventually expelled through the mouth into the atmosphere via eructation. The U.S. Environmental Protection Agency (USEPA, 2004) estimated CH4 contributions from enteric methanogenesis to be 4.99 S.W. Hamilton, E.J. DePeters, and F.M. Mitloehner, Department of Animal Science, Univ. of California, Davis, Davis, CA, 95616. J.A. McGarvey and J. Lathrop, U.S. Department of Agriculture, Agricultural Research Service, Foodborne Contaminants Research Unit, Albany, CA, 94710. Abbreviations: CON, control group; DMI, dry matter intake; FA, fatty acid; GHG, greenhouse gas; MON, monensin group; MUN, milk urea nitrogen; PUN, plasma urea nitrogen; TMR, total mixed ration.

106

million tonnes annually, accounting for approximately 71% of total CH4 contributions from agriculture in the United States. Nitrous oxide, the most potent (heat trapping) GHG, is found in very small quantities in the atmosphere. However, it has a lifespan of up to 150 yr. Nitrous oxide is a product of enteric fermentation but total contributions of N2O from enteric fermentation are considered small (IPCC, 2001). The literature on N2O emissions from enteric fermentation is extremely limited and thus additional research is needed to determine the contribution of this potent GHG. Feeding the ionophore monensin (trade name Rumensin, Elanco Animal Health, Greenfield, IN) to dairy cattle has the potential to alter CH4 production in the rumen, because it selectively reduces the levels of gram-positive bacteria that produce the majority of the substrates for methanogenesis. Monensin predominantly inserts into the gram-positive bacterial cell membrane and functions as an antiporter, translocating extracellular sodium (Na+) or hydrogen (H+) ions for intracellular potassium (K+) ions (Russell and Houlihan, 2003), destroying chemi-osmotic gradients across the bacterial membrane, resulting in the inability of the bacterium to synthesize adenosine triphosphate (ATP), which results in cell death (Tedeschi et al., 2003). Gram-positive organisms are more likely to produce methanogenic substrates as their fermentation end products than gram-negative bacteria (i.e., formate, acetate, MeOH, etc.). Although monensin has little or no direct effect on methanogenic archaea, methane production should be reduced, due to the lower quantities of these methanogenic substrates (Russell and Houlihan, 2003). The effect of monensin on N2O emissions has not been previously reported. Herberg et al. (1978) measured the excretion pattern and tissue distribution of [14C] monensin in cattle, recovering approximately 95% of the labeled monensin in the feces, but not in urine. Davidson (1984) confirmed that almost all of the monensin consumed was recovered in feces with very little recovery in urine and tissue. With such high recovery rates in the feces, it is possible that monensin could affect fermentation in both the hind-gut and the fresh waste, although no findings have been reported in the literature. Monensin is also reported to affect animal performance. Increased milk production was found by Sauer et al. (1998) and Gallardo et al. (2005), but other workers found no effect of monensin on milk production (van der Merwe et al., 2001; Erasmus et al., 2005; Benchaar et al., 2006; Odongo et al., 2007). Thus, additional studies are needed to determine the effect of monensin on milk production. Similarly, the effect of monensin on DMI varied across studies. In several recent studies, DMI did not differ when cows were supplemented with monensin compared with unsupplemented control groups (Erasmus et al., 2005; Gallardo et al., 2005; Benchaar et al., 2006). In a review of 228 trials, including 11,274 cattle, (Goodrich et al., 1984), DMI decreased by 6.4% ( ± 5) when monensin was added to the diet (average 246 mg d–1), indicating considerable variability in response to monensin. Milk fatty acid (FA) composition can be used as an indicator of activity of rumen bacterial species. Unsaturated FA in the

rumen were reported to be more toxic to bacteria than more saturated FA, so rumen bacteria use biohydrogenation as a detoxification reaction (Russell, 2002). Butyrivibio fibrosolvens is one such species that uses biohydrogenation as a detoxification mechanism (Kepler and Tove, 1967), producing trans-11 octadecenoic acid (C18:1) from linoleic acid (Russell, 2002). Butyrivibio fibrosolvens has been historically classified as a gramnegative bacteria, though the species has a cell wall similar to a gram-positive bacteria (Cheng and Costerton, 1977) potentially making it sensitive to monensin. The objectives of the study were to determine if feeding monensin to lactating Holstein cows affects the animal, GHG emissions, lactation performance, and microbial population structure of the gastrointestinal tract and fresh waste.

Materials and Methods Animal Management Eighteen primiparous lactating Holstein dairy cows from the University of California, Davis dairy herd were selected based on milk yield, parity, and days in milk (DIM). Cows were in early- to mid-lactation, averaging 103 ± 37 DIM and 556 ± 44 kg body weight. Cows were randomly assigned to one of two treatment groups of nine cows each, control (CON) and monensin (MON) fed animals. Within the two treatment groups, cows were randomly assigned into three groups of three cows each (experimental unit, n = 3). The study consisted of two phases: short-term effects of dietary monensin on GHG emissions after 14 d (Day 14) of feeding, and the long-term effect of the treatments on GHG after 60 d (Day 60) of continuous feeding of monensin. The six groups were started on the trial on six consecutive days (alternating CON and MON) allowing for all groups to be measured for GHG in the chamber in the same order. All cows were fed the same diet (total mixed ration, TMR) twice daily, formulated to meet the 2001 National Research Council (NRC, 2001) requirements for lactating cows. The TMR was top-dressed at each feeding event with pellets containing either 0 g t–1 (CON) or 441 g t–1 (MON) of monensin (as fed basis), which delivered either 0 or 600 mg d–1 monensin, respectively. The chemical composition of the diet (Tables 1 and 2) was analyzed by Cumberland Valley Analytical Services, Inc. (Maugansville, MD) for crude protein (CP), acid detergent fiber (ADF), neutral detergent fiber (NDF), and selected minerals (Ca, P, Mg, K, Na, Fe, Mn, Zn, and Cu). The concentration of monensin in the pellet was determined at Eurofins Scientific, Animal Health Testing Laboratory (Memphis, TN). Cows were housed at the University of California, Davis dairy with an arrangement of sand-bedded freestalls, a concrete exercise area, and free access to water. Individual DMI was measured as the difference of feed DM offered from feed DM refused. Cows were trained to use individual Calan electronic feeding gates (American Calan, Inc., Northwood, NH). Feed refusals were weighed twice daily while cows were in the milking parlor (0600 and 1800 h) and then fresh feed was offered when the cows returned from the milking parlor. Cows were milked twice daily and milk yield

Hamilton et al.: Selected Variable Responses to Dietary Monensin Fed to Dairy Cows

107

Table 1. Ingredient and chemical composition of the basal diet for both control (CON) and monensin (MON) diets.

Table 2. Chemical composition (dry matter [DM] basis) of top-dress control (CON) and monensin (MON) treatment pellets.

Item Diet Ingredient, as-fed basis, 90% dry matter (DM) Grain mix†, g kg–1 375.1 Alfalfa hay, chopped, g kg–1 361.5 Almond hulls, g kg–1 119.7 Whole cottonseed, g kg–1 95.8 Soybean meal, g kg–1 20.8 Mineral mix‡, g kg–1 16.0 EnerG II§, g kg–1 8.0 Salt, g kg–1 3.2 Chemical component, DM basis ADF, g kg–1 216.0 NDF, g kg–1 290.0 Ash, g kg–1 84.0 NFC, g kg–1 416.0 CP, g kg–1 172.0 Ca, g kg–1 9.0 P, g kg–1 3.9 Mg, g kg–1 3.3 K, g kg–1 20.6 Na, g kg–1 4.3 Fe, mg kg–1 274 Mn, mg kg–1 63 Zn, mg kg–1 97 19 Cu, mg kg–1 † Grain mix contained (g 100 g–1 as-fed of grain mix) steam flaked corn (38.0), rolled barley (20.0), bakery product (16.0), beet pulp (12.7), dried distillers grain (6.0), wheat mill run (5.0), fat (2.2), and mold inhibitor (0.1). ‡ Mineral mix contained: Ca 8.5 g 100 g–1, Mg 6.4 g 100 g–1, P 4.4 g 100 g–1, Sodium (max) 12.5 g 100 g–1, K 1.0 g 100 g–1, Zn 3250 mg kg–1, Mn 2000 mg kg–1, Cu 500 mg kg–1, Se 16.8 mg kg–1, Vitamin A 396,832 IU kg–1, Biotin 44 mg kg–1, Rabon 2160 g t–1. § EnerG II, Vitrus Nutrition (vitrusnutrition.com), Fairlawn, OH.

Pellet Item CON MON† Component ADF, g kg–1 165.0 156.0 NDF, g kg–1 375.0 382.0 Ash, g kg–1 103.0 111.0 CP, g kg–1 202.0 210.0 Ca, g kg–1 20.7 22.5 P, g kg–1 8.4 8.1 Mg, g kg–1 3.6 3.5 K, g kg–1 8.9 9.5 Na, g kg–1 0.6 1.7 Fe, mg kg–1 287 305 Mn, mg kg–1 94 112 Zn, mg kg–1 95 96 13 18 Cu, mg kg–1 † MON pellet contained 441 g t–1 monensin (Rumensin 80, Elanco Animal Health, Indianapolis, IN) fed to provide 600 mg head–1 d–1.

was measured (Westfalia Surge, Naperville, IL). Milk samples were collected at consecutive evening and morning milkings before relocation of cows to the environmental chamber and preserved with 2-bromo-2-nitro-propane-1–3-diol (Dairy & Foods Labs, Inc., Modesto, CA). A composite of the two samples was made and milk components (protein, lactose, fat, and solids) were analyzed using a Bentley 150 Infrared Milk Analyzer (Bentley Instruments, Inc., Chaska, MN). Milk and blood samples were collected on Days 14 and 60 and analyzed for milk urea nitrogen (MUN) and plasma urea nitrogen (PUN) using a Technicon Autoanalyzer according to method N-10a (Marsh et al., 1957). Fatty acid composition of milk fat was determined by gas chromatography of methyl esters as described by DePeters et al. (2001).

Environmental Chamber The validation experiments that were conducted to evaluate the performance of the environmental chamber and gas monitoring system were described in Sun et al. (2008). In short, the chamber (4.4 by 2.8 by 10.5 m; 142 m3 volume) used had a continuous ventilation rate of 2022 m3 h–1 (at 20°C and 1 ATM), resulting in a chamber residence time of approximately 4.75 min, equivalent to 12.64 air exchanges h–1. The chamber temperature was maintained at 20°C. Ambient temperature and

108

relative humidity were measured in 10 min intervals using two HOBO sensors (Onset Computer, Bourne, MA) located inside the chamber. Typical dairy freestall housing conditions for three cows were simulated via three freestall stanchions at the west end of the chamber where animals could rest. Head gates were installed at the east end of the chamber where feed was offered in bunks. Ad libitum water was provided by an automatic refilling water bowl. Cows were milked inside the chamber with a mobile milking unit. Cow excreta (urine and feces) accumulated on the concrete floor until the chamber was cleaned (after 24 h). All reported gas measurements occurred from cow and fresh waste. The environmental chamber facility is certified by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALACI), and the Institutional Animal Care and Use Committee (IACUC) approved the project to certify the health and welfare of the animals.

Chamber and Experimental Procedures The chamber had one incoming and one outgoing air duct. Atmospheric analytical instruments were located in the attic space above the chamber to pull air samples through Teflon tubing (12.7 mm ID, 0.25 m long) from each air duct immediately above the chamber ceiling. Background samples of the empty chamber were collected before the experimental periods to assess background concentrations of GHG concentrations in the incoming and outgoing air. After 1 h of empty chamber measurements, three cows were placed inside the chamber. The first hour after cows entered the chamber was used to measure air emissions from cows only (emissions from enteric fermentation and respiration only; no waste present in chamber). In the proceeding 22 h, emissions from cows and waste were measured as waste accumulated over time without removal. After 23 h, cows were removed from the chamber and returned to the dairy.

Gas Measurements Methane, N2O, and CO2 from dairy cows and their excreta were continuously measured using a photoacoustic INNOVA

Journal of Environmental Quality • Volume 39 • January–February 2010

model 1412 Field Gas Monitor (INNOVA AirTech Instrument, Ballerup, Denmark). The detection limits of the INNOVA 1412 are 0.30 μL L–1 for CH4, 0.02 μL L–1 for N2O, and 0.74 μL L–1 for CO2. Samples of all three gases were taken every minute, and the sampling interval for inlet and outlet air switched every 20 min.

Microbial Population Structure Analysis of Fresh Waste Fecal Sample Collection Fecal (colonic) samples were collected on Days 14, 30, and 60 from six CON and six MON cows. Immediately after sampling the material was placed on ice, and processed within 24 h of sampling.

Viable Counts of Bacteria and Chemical Analysis of Fresh Fecal Waste All detailed microbial methods can be found in the supplemental material section of the present work. In short, samples were quantified for viable bacteria by performing serial dilutions in phosphate buffered saline that was vortex agitated for two min, plated onto brain heart infusion agar plates and incubated at 37°C for 3 d under normal atmospheric conditions or in an anaerobic chamber.

DNA Extraction from Waste Samples From each colonic sample, two 0.5-g subsamples were taken for DNA extraction. DNA was extracted using a modification of the MoBio UltraClean Fecal DNA Isolation Kit (MoBio, Solano Beach, CA) described previously (McGarvey et al., 2007).

PCR Amplification of 16S rRNA Genes and Library Construction PCR amplification of 16S rRNA genes was performed using the primers 27f (5’ AGAGTTTGATCCTGGCTCAG 3’) and 1392r (5’ GACGGGCGGTGTGTAC 3’) (Lane 1991). PCR were performed as recommended by Polz and Cavanaugh (1998) to reduce bias in amplification.

DNA Template Preparation, Sequencing, and Analysis DNA templates were prepared and sequencing reactions performed. The predicted 16S rDNA sequences from this study were compared to 16S rDNA sequences in a BLASTable database constructed from sequences downloaded from the Ribosomal Database Project (Release 8.1; http://rdp8.cme.msu.edu).

Statistical Analysis Methane, N2O, and CO2, as well as milk components, fatty acids, DMI, PUN, and MUN were analyzed using repeated measures analysis. Independent variables included day (Day 14 vs. Day 60), treatment (CON vs. MON), and the repeated time factor (h). Least-squares means were used to compare significant categorical variables. A time by treatment interaction analysis was also included where significant. Independent variables included treatment (CON vs. MON), day (Day 14 and Day 60), and a treatment day interaction. Significance was detected using an alpha equal to 0.05. All analyses were conducted using SAS v. 9.1 (SAS Inst. Inc, Cary, NC). The percent coverage of the total operational taxonomic units (OTUs) identified in each sample was calculated using

the equation C = 1 – (n/N) × 100 where C is the percent coverage, n is the number of singlet OTUs, and N is the number of clones examined. Each OTU was assigned to a phylum using the Classifier software (Cole et al., 2003) which assigns an OTU sequence to a phylum using a naïve Bayesian rRNA classifier trained on the known type strain 16S sequences. Once the OTU of each library were assigned to a phylum, pair-wise comparisons of the phyla within the libraries were performed using the Student’s t test. In addition, comparisons of the 16S rDNA libraries were analyzed using the Library Compare software (Cole et al., 2003), which estimates the likelihood that the frequency of membership in a given taxon is the same for the two libraries using the equation:

⎛N ⎞ p( y | x) = ⎜ 2 ⎟ ⎝ N1 ⎠

( x + y )! ⎛ N ⎞ x!y!⎜1+ 2 ⎟ N1 ⎠ ⎝

( x + y +1)

where N1 and N2 are the total number of sequences for library 1 and 2, respectively and x and y are the number of sequences assigned to an OTU from library 1 and 2, respectively. The percentage of a phylum in one library was considered significanly different from another library if both statistical methods (Student’s t test and Compare) were in agreement.

Results and Discussion Gas Emissions There were no differences between treatments for the GHG emissions of CH4, N2O, and CO2 for Day 14 or Day 60 (Fig. 1). Odongo et al. (2007) reported a 7% reduction for CH4 emissions over a 6-mo period when cows were fed monensin ranging from 307.3 to 708.1 mg d–1; however, the difference in CH4 emissions was not significant until the fourth month of their study. Thus a decrease in CH4 emissions in response to dietary monensin might occur only long term. Short-lived (3–6 wk) reductions of CH4 emissions in beef steers were reported in the literature, but emissions eventually returned to pre-ionophore feeding levels (Guan et al., 2006). Short-lived CH4 decreases in steers with emissions returning to control levels after 9 to 12 d were also reported (Carmean and Johnson, 1990; Rumpler et al., 1986). Dry matter composition of the diet in the present study was similar to diets fed by Rumpler et al. (1986) and Carmean and Johnson (1990) (70–90% dry matter basis). There was a decrease of CH4, N2O, and CO2 emissions in the present study from Day 14 to Day 60 (Fig. 1) for both treatments (P < 0.05). Cows were introduced into the chamber at 0800 h and over the 23 h residence time in the environmental chamber (Fig. 2), there was a decrease of CH4, N2O, and CO2 emissions for both treatments (P < 0.05). This can be explained because cows ruminate less at night compared with daytime. Kinsman et al. (1995) found CO2 and CH4 emissions increased after feeding and then declined to their lowest concentrations overnight. Sun et al. (2008) also observed a diurnal pattern with high levels during the day and decreasing levels at night. The accumulation of waste while cows were in the chamber did not correspond with


109

the decrease in GHG emissions, indicating enteric fermentation is the primary source of GHG. This finding agrees with those of Sun et al. (2008), who measured GHG emissions from waste after cows were removed from an environmental chamber. In the present study for Day 14, the average estimated emission rates of CH4, N2O, and CO2 between treatments were 11.24 vs. 11.43, 0.02 vs. 0.02, and 512.4 vs. 531.56 g cow–1 h–1 for CON and MON, respectively. Emission rates of CH4, N2O, and CO2 for Day 60 were 9.32 vs. 9.86, 0.01 vs. 0.01, and 444.83 vs. 460.91 g cow–1 h–1 for CON and MON, respectively. Methane emission rates were lower than those reported for both dry and lactating cows (Sun et al., 2008) but greater than the historical emission rate (Ritzman and Benedict, 1938) used by some of the air regulatory agencies.

Animal Performance Animal performance measurements are reported in Table 3. Dry matter intake was similar between treatments for both Day 14 and Day 60. Both MON and CON cows showed DMI similar to those reported by others (Phipps et al., 2000; Mackintosh et al., 2002; Odongo et al., 2007). The maximum time of exposure to monensin in the present study was 60 d. Mackintosh et al. (2002) fed monensin at 0 or 300 mg d–1 for 28 d, whereas Odongo et al. (2007) and Phipps et al. (2000) fed monensin for 168 and 91 d, respectively. Phipps et al. (2000) reported no change in DMI when monensin was fed at 150, 300, or 450 mg d–1, and Odongo et al. (2007) reported no differences in DMI when cows consumed between 307.3 to 708.1 mg d–1. Independent of comparing responses in DMI for MON vs. CON cows, the current study fed a dry chopped alfalfa hay forage-based ration (TMR 90% DM), in contrast to other studies that fed corn silage-based TMR. Corn silage constituted approximately 43.5% (Odongo et al., 2007) and approximately 35.4% (Phipps et al., 2000) of the diet DM. Erasmus et al. (2005) fed a chopped alfalfa (Medicago sativa L.) hay ration and did not observe an effect on DMI, although monensin was included at approximately one-third the level that was used in the present study. Gallardo et al. (2005) fed a partial mixed ration to cows grazing a mixedalfalfa pasture consuming approximately 22.9 kg d–1, using a controlled release capsule providing 335 mg d–1 monensin and observed no effect on DMI. Dry matter intake did not change over time from Day 0 to Day 14 for either treatment, but DMI did increase over time from Day 0 to Day 60 (P < 0.05) regardless of the treatment. Tedeschi et al. (2003) suggested that the effect of monensin on DMI was a consequence of stage of lactation and subsequent energy requirement of the animal. Cows used in the present study were all in their first lactation averaging 103 ± 37 DIM and 40.2 kg cow–1 d–1 of milk. In comparison, cows used in the studies by Odongo et al. (2007) and Phipps et al. (2000) were a combination of primiparous and multiparous cows averaging 92 and 49 DIM, and 26.1 and 26.7 kg cow–1 d–1 of milk, respectively. In contrast to the suggestion by Tedeschi et al. (2003), cows in the present study and studies by Odongo et al. (2007) and Phipps et al. (2000) showed no effect of monensin on DMI though stage of lactation, parity, and subsequent energy requirement varied.

110

Fig. 1. Environmental chamber results of average greenhouse gas (GHG) emissions (CH4 = methane; N2O = nitrous oxide; CO2 = carbon dioxide) from lactating dairy cows and their fresh waste for control (CON) vs. Monensin (MON) treatments over a 23-h period at Day 14 and Day 60.

Milk yield did not differ between treatments on Day 14 or Day 60 (Table 3), which agrees with previous studies (Ramanzin et al., 1997; Erasmus et al., 2005; Benchaar et al., 2006). Cows in the experiment by Odongo et al. (2007) that received monensin at varying levels with a maximum of approximately 708 mg d–1 (near the level fed in the present study) were not different in milk yield compared with the control group. Phipps et al. (2000) reported increased milk yield when monensin was included at either 150 or 300 mg d–1, but not when inclusion levels reached 450 mg d–1. Gallardo et al. (2005) reported milk yield to be greater when monensin was supplemented at 335 mg d–1 for both short-term (0–150 DIM) and also long-term (305 d adjusted lactation) compared with the nonsupplemented control. Milk yield in the present study did not change over time from Day 0 to Day 14 for either MON or CON. Milk yield did increase from Day 0 to Day 60 (P < 0.05) for both treatments. Primiparous cows do not follow a similar lactation curve as commonly observed for multiparous cows, so the increase in milk yield over time might not be anticipated.


Fig. 2. Environmental chamber results of average greenhouse gas (GHG) emissions (CH4 = methane; N2O = nitrous oxide; CO2 = carbon dioxide) from lactating dairy cows and fresh waste for control (CON) vs. Monensin (MON) treatments over a 23-h period at Day 14 (panels A-C) and Day 60 (panels D–F). Table 3. Least square means and standard errors for animal performance variables in response to control (CON) vs. monensin (MON) treatments (n = 3). Response Dry matter intake, kg d–1 Day 14 Day 60 Milk yield, kg d–1 Day 14 Day 60 Milk fat, g 100 g–1 Day 14 Day 60 Milk protein, g 100 g–1 Day 14 Day 60 Milk lactose, g 100 g–1 Day 14 Day 60 Total solids, g 100 g–1 Day 14 Day 60 Milk urea N, mg dL–1 Day 14 Day 60 Plasma urea N, mg dL–1 Day 14 Day 60

Treatment CON MON

P

SEM

27.7 28.5

27.5 28.1

0.64 0.11

0.33 0.15

39.8 40.8

39.9 40.1

0.93 0.25

0.86 0.36

3.75 3.95

3.87 3.94

0.52 0.92

0.10 0.10

3.14 3.19

3.21 3.15

0.55 0.77

0.08 0.08

5.19 5.20

5.19 5.15

0.89 0.32

0.03 0.03

12.61 12.86

12.79 12.73

0.49 0.57

0.15 0.15

11.37 12.60

12.29 13.92

0.43 0.27

0.73 0.73

12.23 13.14

13.02 14.49

0.51 0.28

0.77 0.77

In the present study, no differences were observed between treatments for percent fat, protein, lactose, or total solids in milk

(Table 3). Sauer et al. (1998) observed a temporary but significant reduction in percent milk fat, but no change in milk protein and solids concentration in response to the first exposure to dietary monensin. Milk fat percent did not change when cows were exposed to monensin for a second time exactly 161 d after termination of the first monensin exposure, indicating possible adaptations by the rumen microbial population. Benchaar et al. (2006) also reported a decrease in percent milk fat, but not in milk protein, with monesin feeding. In contrast, both milk fat percent and milk protein percent were reduced in response to monensin feeding (Phipps et al., 2000; Odongo et al., 2007). Conversely, Ramanzin et al. (1997) observed no change in both percent milk fat and milk protein in response to monensin. Benchaar et al. (2006) observed a slight but significant decrease in percent solids but no change in lactose. Mackintosh et al. (2002) observed an increase in lactose yield. Typically, the reduction in milk fat percent was often in response to an increase in milk yield as milk fat yield remained unchanged (Phipps et al., 2000). Separating responses of milk components to monensin by feeding practices (TMR vs. individual components), studies featuring TMR feeding systems reported reductions in percent milk fat (Benchaar et al., 2006; Odongo et al., 2007). Studies that fed monensin other than in a TMR similar to the present study did not report differences in milk fat percent (Ramanzin et al.,1997; van der Merwe et al., 2001). Gallardo et al. (2005) fed a partial TMR in addition to a pasture-based diet and observed decreases in percent milk fat but not percent milk protein. These findings, as well as the findings in the present study, with respect to milk fat percent are in agreement with a survey by Duffield


111

et al. (2003). The response of milk component production is difficult to explain as several studies featuring different feeding systems and different inclusion rates do not consistently report similar observations. Concentrations of PUN and MUN can be used as indicators of N utilization in the rumen. There were no differences between CON and MON treatment cows for either PUN or MUN concentrations (Table 3). Plasma urea N and MUN concentrations are closely related (Kauffman and St-Pierre, 2001), since urea enters milk from the blood by passive diffusion (Gustafsson and Palmquist, 1993). Poos et al. (1979) reported increased PUN and decreased ruminal ammonia in lambs fed monensin. Similarly, increased PUN levels were observed with a decrease in rumen ammonia levels in lactating dairy cows in response to monensin treatment (Martineau et al., 2007). These findings are not consistent with the current study. Martineau et al. (2007) reported no effect of monensin on MUN concentrations compared with an unsupplemented control, which agrees with the current study. Fatty acid composition of the milk fat is presented in Table 4. At Day 14, C16:1 trans, C18: trans 11 were higher in MON vs. CON cows. There was a trend of higher amounts of C18: trans 9 and C22:4 n6 in MON cows compared with CON cows. Monensin treated cows had greater amounts of fatty acids C20:5 and C22:4 n6 at Day 60 than CON cows, and tended to have a greater amount of C22:5 n3. There were no differences between CON and MON for all C18:2 fatty acids at both Day 14 and Day 60, which is in agreement with Dhiman et al. (1999). Previous research showed that monensin increased C18:2 concentrations (da Silva et al., 2007). In the present study there were trends (P < 0.10) for increased concentrations of C18:1 fatty acids in MON treated cows compared with CON animals, which agrees with previous reports (Sauer et al., 1998; da Silva et al., 2007). The amount of trans-11 octadecenoic acid (C18:1), which was reported to be produced by B. fibrisolvens (Russell, 2002) was higher in MON treated vs. control cows only at Day 14 but not at Day 60. These observed trends indicate that MON might have short-lived impacts on biohydrogenation in the rumen.

Table 4. Total fatty acid composition of milk fat in response to control (CON) vs. monensin (MON) treatments (g 100 g–1 fat).

Microbiological Analysis of Fresh Waste

Conclusions

Culture analysis of the colonic samples taken from MON and CON animals revealed no difference in coliform, aerobic or anaerobic bacterial plate counts (Table 5). To further analyze the colonic contents of the animals’ 16S rRNA, gene libraries containing 1152 sequences from CON vs. MON cows were constructed monthly, for a total of 3456 sequences for each group. The levels of coverage for the OTUs within the MON-derived library was 87.6 and 88.3% for the CON-derived library. The 16S rRNA gene sequences in the libraries were classified to the phylum level using the Classifier software (Table 6). Using the Student t test, we were unable to detect any significant difference at the phylum level between the libraries developed for MON and CON animals (P < 0.05). The Library Compare software was also unable to detect any significant difference between total CON and total MON libraries down to the genus level.

Feeding monensin at a rate of 600 mg head–1 d–1 with an alfalfa-hay based ration did not change emissions of GHG (CH4, CO2, and N2O) compared with the nonsupplemented control. Previous studies reported no reductions in CH4 when cows were fed high DM diets, similar to those in the present study, while in other studies, effects on CH4 responses could be related to dietary composition. It is not clear if the type of diet is the primary factor in determining the effects of monensin on GHG reductions. However, it is possible that longer feeding applications of monensin may result in effects on GHG. Animal performance (DMI, milk yield, milk components), ammonia emissions, and concentrations of PUN and MUN were not affected by monensin addition to the diet. The microbial population structure of the animal colonic contents was not affected by monensin. It is possible that the ru-

112

Fatty acid C4 C6 C8 C9 C10 C11 C12 C13 C14 C14:1 cis C15 C16 C16:1 trans C16:1 cis C17 C17:1 trans C18 C18:1 trans-5 C18:1 trans-7 C18:1 trans 6 & 8 C18:1 trans 9 C18:1 trans 10 C18:1 trans 11 C18:1 trans 12 C18:1 trans 13 & 14 C18:1 cis 9 & 10 C18:1 cis 11 C18:1 cis 12 C18:1 cis 13 C18:1 trans 16 C18:2 C18:2 cis9 trans11 C18:3 C20:0 C20:3 C20:4 C20:5 C22:4 n6 C22:5 n3 C22:5 n6 C22:6

Day 14 CON MON 3.27 3.00 2.23 1.99 1.23 1.06 0.04 0.03 2.59 2.26 0.06 0.06 2.67 2.41 0.15 0.13 8.8 8.71 0.49 0.55 0.93 0.93 29.14 29.37 0.27 0.35 1.16 1.38 0.62 0.64 0.03 0.03 14.19 12.92 0.03 0.03 0.03 0.03 0.40 0.46 0.27 0.41 0.60 1.11 0.95 1.14 0.55 0.58 0.85 1.01 19.25 20.28 0.44 0.43 0.49 0.53 0.06 0.07 0.44 0.44 3.45 3.16 0.38 0.50 0.63 0.60 0.17 0.16 0.16 0.13 0.17 0.17 0.04 0.04 0.03 0.04 0.08 0.08 0.01 0.01 0.01 0.01

Treatment Day 60 P CON MON 0.43 3.33 3.50 0.13 2.24 2.10 0.08 1.23 1.15 0.17 0.04 0.03 0.14 2.74 2.52 0.62 0.06 0.06 0.21 2.85 2.79 0.35 0.14 0.15 0.82 9.23 9.31 0.46 0.53 0.55 0.88 0.88 0.91 0.75 28.53 28.44 0.03 0.26 0.28 0.18 1.15 1.23 0.30 0.56 0.58 0.46 0.008 0.003 0.22 13.54 13.34 0.90 0.03 0.02 0.62 0.03 0.02 0.11 0.37 0.38 0.08 0.30 0.32 0.23 0.55 0.42 0.01 1.01 1.04 0.85 0.55 0.39 0.51 0.86 0.62 0.41 19.32 20.62 0.95 0.39 0.43 0.80 0.51 0.35 0.39 0.05 0.04 0.99 0.43 0.29 0.22 3.73 3.61 0.06 0.43 0.48 0.43 0.65 0.59 0.26 0.16 0.16 0.42 0.22 0.19 0.71 0.18 0.19 0.25 0.03 0.04 0.10 0.03 0.04 0.94 0.07 0.09 0.83 0.01 0.01 0.75 0.01 0.001

P 0.61 0.34 0.32 0.44 0.27 0.65 0.71 0.65 0.84 0.77 0.51 0.90 0.51 0.55 0.13 0.36 0.83 0.55 0.28 0.76 0.77 0.74 0.52 0.30 0.36 0.31 0.27 0.28 0.35 0.25 0.59 0.36 0.14 0.89 0.36 0.64 0.01 0.04 0.07 0.88 0.30


Table 5. Bacterial cultural analysis of colonic material collected from control (CON) and monensin (MON) animals. CPC (SD) † APC (SD) AnPC (SD) CON 1.3X106 (1.1 × 106) 2.8X107 (1.4 × 107) 3.9X107 (3.1 × 107) MON 1.2X106 (1.3 × 106) 8.6X107 (6.7 × 107) 2.2X107 (2.2 × 107) † CPC = coliform plate count; APC = aerobic plate count; AnPC = anaerobic plate count. Results are expressed as the mean of six animals over a 3 mo period. Table 6. Percentage of 16S rRNA gene clones assigned to phyla at each time point for control (CON) and monensin (MON) animals. Phylum Actinobacteria Verrucomicrobia TM7 Lentisphaerae Spirochaetes Proteobacteria Bacteroidetes Firmicutes Unknown

Day 14 CON MON 0.0 0.0 0.4 0.2 0.4 0.0 1.3 1.4 0.1 0.2 3.5 3.1 45.6 46.5 42.4 40.5 5.3 7.2

Day 30 CON MON 0.0 0.1 0.1 0.4 0.2 0.3 1.8 1.0 0.0 0.0 3.2 3.0 43.0 41.7 43.7 46.8 7.4 5.6

Day 60 CON MON 0.0 0.1 0.8 1.2 0.2 0.1 0.5 0.8 0.2 0.2 3.1 1.9 46.1 36.4 45.4 54.9 3.4 4.1

men microbiology was altered and that the bacterial populations in the colon were not. However, there were no changes in PUN and only small changes in milk fatty acids, which could suggest little rumen effect of monensin. Future experiments examining several locations within the gastrointestinal tract (rumen, ileum, and colon) are in preparation to examine this possibility. Potential areas for further investigation on the effects of monensin fed with a dry alfalfa hay forage-based ration could include: (i) feeding monensin in a step-wise inclusion rate, starting with low concentrations, compared with immediate start with high supplementation levels, and (ii) using rumen fistulated cows to measure volatile fatty acid concentrations, rumen pH, and identify rumen microbial populations. Using rumen fistulated cows would also allow for in vitro fermentation experiments to directly measure gas emissions from enteric fermentation while also determining the effects of introducing monensin in the ration at high concentrations, similar to the present study.

References Agricultural Statistics Board. 2007. Agricultural statistics, 2007. National Agricultural Statistics Service. Available at http://www.ers.usda.gov/ publications/ldp/xlstables/regprod(P).xls> (accessed 23 Aug. 2007; verified 2 Oct. 2009).USDA, Washington, DC. Benchaar, C., H.V. Petit, R. Berthiaume, T.D. Whyte, and P.Y. Chouinard. 2006. Effects of addition of essential oils and monensin premix on digestion, ruminal fermentation, milk production, and milk composition in dairy cows. J. Dairy Sci. 89:4352–4364. Carmean, B., and D.E. Johnson. 1990. Persistence of monensin-induced changes in methane emissions and ruminal protozoa numbers in cattle. J. Anim. Sci. 68:517. Cheng, K.J., and J.W. Costerton. 1977. Ultrastructure of Butyrivibrio fibrisolvens: A gram-positive bacterium. J. Bacteriol. 129:1506–1512. Cole, J.R., B. Chai, T.L. Marsh, R.J. Farris, Q. Wang, S.A. Kulam, S. Chandra, D.M. McGarrell, T.M. Schmidt, G.M. Garrity, and J.M. Tiedje. 2003. The ribosomal database project (RDP-II): Previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res. 31:442–443. da Silva, D.C., G.T. Santos, A.F. Branco, J.C. Damasceno, R. Kazama, M. Matsushita, J.A. Horst, W.B.R. dos Santos, and H.V. Petit. 2007. Production performance and milk composition of dairy cows fed whole or

ground flaxseed with of without monensin. J. Dairy Sci. 90:2928–2936. Davidson, K. 1984. Monensin absorption and metabolism in calves and chickens. J. Agric. Food Chem. 32:1273–1277. Dhiman, T.R., G.R. Anand, L.D. Satter, and M.W. Pariza. 1999. Conjugated linoleic acid content of milk from cows fed different diets. J. Dairy Sci. 82:2146–2156. DePeters, E.J., J.B. German, S.J. Taylor, S.T. Essex, and H. Perez-Monti. 2001. Fatty acid and triglyceride composition of milk fat from lactating Holstein cows in response to supplemental Canola oil. J. Dairy Sci. 84:929–936. Duffield, T., R. Bagg, D. Kelton, P. Dick, and J. Wilson. 2003. A field study of dietary interactions with monensin on milk fat percentage in lactating dairy cattle. J. Dairy Sci. 86:4161–4166. Erasmus, L.J., P.H. Robinson, A. Ahmadi, R. Hinders, and J.E. Garrett. 2005. Influence of prepartum and postpartum supplementation of a yeast culture and monensin, or both, on ruminal fermentation and performance of multiparous dairy cows. Anim. Feed Sci. Technol. 122:219–239. FAO. 2006. Livestock’s long shadow; Environmental issues and options. Available at http://www.fao.org/docrep.010/a0701e/a0701e00.HTM > (accessed 5 July 2007; 2 Oct. 2009). Food and Agriculture Organization of the United Nations, Rome, Italy. Gallardo, M.R., A.R. Castillo, F. Bargo, A.A. Abdala, M.G. Maciel, H. PerezMonti, H.C. Castro, and M.E. Castelli. 2005. Monensin for lactating dairy cows grazing mixed-alfalfa pasture and supplemented with partial mixed ration. J. Dairy Sci. 88:644–652. Goodrich, R., J. Garrett, D. Gast, M. Kirick, and D. Larson. 1984. Influence of monensin on the performance of cattle. J. Anim. Sci. 58:1484–1498. Guan, H., K.M. Wittenberg, K.H. Ominski, and D.O. Krause. 2006. Efficacy of ionophores in cattle diets for mitigation of enteric methane. J. Anim. Sci. 84:1896–1906. Gustafsson, A.H., and D.L. Palmquist. 1993. Diurnal variation of rumen ammonia, serum urea, and milk urea in dairy cows at high and low yields. J. Dairy Sci. 76:475–484. Herberg, R., J. Manthey, L. Richardson, C. Cooley, and A. Donoho. 1978. Excretion and tissue distribution of [14C] monensin in cattle. J. Agric. Food Chem. 26:1087–1090. IPCC. 2001. Good practice guidance and uncertainty management in national greenhouse gas inventories. Available at http://www.ipcc-nggip.iges. or.jp/public/gp/english > (accessed 5 July 2007; verified 25 Sept. 2009). IPCC National Greenhouse Gas Inventories Program Technical Support Unit, Kanagawa, Japan. Jungbluth, T., E. Hartung, and G. Brose. 2001. Greenhouse gas emissions from animal house and manure stores. Nutr. Cycling Agroecosyst. 60:133–145. Kepler, C.R., and S.B. Tove. 1967. Biohydrogenation of unsaturated fatty acids. J. Biol. Chem. 242:5686–5692. Kinsman, R., F.D. Sauer, H.A. Jackson, and M.S. Wolynetz. 1995. Methane and carbon dioxide emissions from dairy cows in full lactation monitored over a six-month period. J. Dairy Sci. 78:2760–2766. Kauffman, A.J., and N.R. St-Pierre. 2001. The relationship of milk urea nitrogen to urine nitrogen excretion in Holstein and Jersey cows. J. Dairy Sci. 84:2284–2294. Lane, D.J. 1991. 16S/23S rRNA sequencing, p. 115–175. In E. Stakebrandt and M. Goodfellow (ed.) Nucleic acid sequencing techniques in bacterial systematics. Wiley & Sons, New York. Mackintosh, E., R. Phipps, J. Sutton, D. Humphries, and J.I.D. Wilkinson. 2002. Effect of monensin on rumen fermentation and digestion and milk production in lactating dairy cows. J. Anim. Feed Sci. 11:399–410. Marsh, W.H., B. Fingerhut, and E. Kirsch. 1957. Determination of urea nitrogen with the diacetyl method and an automatic dialyzing apparatus. Tech. Bull. Regist. Med. Technol. 27:239–246. Martineau, R., C. Benchaar, H.V. Petit, H. Lapierre, D.R. Ouellet, D. Pellerin, and R. Berthiaume. 2007. Effects of lasalocid or monensin supplementation on digestion, ruminal fermentation, blood metabolites, and milk production of lactating dairy cows. J. Dairy Sci. 90:5714–5725. McGarvey, J.A., W.G. Miller, R. Zhang, Y. Ma, and F. Mitloehner. 2007. Bacterial population dynamics in diary waste during aerobic and anaerobic treatment and subsequent storage. Appl. Environ. Microbiol. 73:193–202. NRC. 2001. Nutrient requirement of dairy cattle. 7th rev. ed. Natl. Academy Press, Washington, DC. Odongo, N.E., R. Bagg, G. Vessie, P. Dick, M.M. Or-Rashid, S.E. Hook, J.T.


113

Gray, E. Kebreab, J. France, and B.W. McBride. 2007. Long-term effects of feeding monensin on methane production in lactating dairy cows. J. Dairy Sci. 90:1781–1788. Phipps, R.H., J.I.D. Wilkinson, L.J. Jonker, M. Tarrant, A.K. Jones, and A. Hodge. 2000. Effect of monensin on milk production of HolsteinFriesian dairy cows. J. Dairy Sci. 83:2789–2794. Polz, M.F., and C.M. Cavanaugh. 1998. Bias in template to product ratios in multitemplate PCR. Appl. Environ. Microbiol. 64:3724–3730. Poos, M.I., T.L. Hanson, and T.J. Klopfenstein. 1979. Monensin effects of diet digestibility, ruminal protein bypass and microbial protein synthesis. J. Anim. Sci. 48:1516–1524. Ramanzin, M., L. Bailoni, S. Schiavon, and G. Bittante. 1997. Effect of monensin on milk production and efficiency of dairy cows fed two diets differing in forage to concentrate ratios. J. Dairy Sci. 80(6):1136–1142. Ritzman, E.G., and F.G. Benedict. 1938. Nutritional physiology of the adult ruminant. Carnegie Inst., Washington, DC Rumpler, W., D.E. Johnson, and D. Bates. 1986. The effect of high dietary cation concentrations of methanogenesis by steers fed with or without ionophores. J. Anim. Sci. 62:1737–1741. Russell, J. 2002. Rumen microbiology and its role in ruminant nutrition. J.B. Russell Publ. Co., Ithaca, NY. Russell, J.B., and A. Houlihan. 2003. Ionophore resistance of ruminal bacteria and its potential impact on human health. FEMS Microbiol. Rev.

114

27:65–74. Sauer, F.D., V. Fellner, R. Kinsman, J.K. Kramer, H.A. Jackson, A.J. Lee, and S. Chen. 1998. Methane output and lactation response in Holstein cattle with monensin or unsaturated fat added to the diet. J. Anim. Sci. 76:906–914. Shaw, S.L., F.M. Mitloehner, W. Jackson, E.J. DePeters, J.G. Fadel, P.H. Robinson, R. Holzinger, and A.H. Goldstein. 2007. Volatile organic compound emissions from dairy cows and their waste as measured by proton-transfer-reaction mass spectrometry. Environ. Sci. Technol. 41:1310–1316. Sun, H., S.L. Trabue, K. Scoggin, W.A. Jackson, Y. Pan, Y. Zhao, I.L. Malkina, J.A. Koziel, and F.M. Mitloehner. 2008. Alcohol, volatile fatty acid, phenol, and methane emissions from dairy cows and fresh waste. J. Environ. Qual. 37:615–622. Tedeschi, L.O., D.G. Fox, and T.P. Tylutki. 2003. Potential environmental benefits of ionophores in ruminant diets. J. Environ. Qual. 32:1591–1602. USEPA. 2004. US emissions inventory 2004: Inventory of U.S. greenhouse gas emissions and sinks: 1990–2002. U.S. Environ. Protection Agency, Washington, DC. van der Merwe, B.J., T.J. Dugmore, and K.P. Walsh. 2001. The effect of monensin on milk production, milk urea nitrogen and body condition score of grazing dairy cows. S. Afr. J. Anim. Sci. 31:49–55.
