in vivo 22: 21-26 (2008)
Growth Inhibition and Induction of Apoptosis by 2-Methoxyestradiol in Rat Osteosarcoma and Malignant Fibrous Histiocytoma Cell Lines HIROMASA FUJII1, KANYA HONOKI1, TOSHIFUMI TSUJIUCHI2, AKIRA KIDO1, KAZUHIRO YOSHITANI1 and YOSHINORI TAKAKURA1 1Department
of Orthopedic Surgery, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521; of Life Science, Faculty of Science and Technology, Kinki University, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan
2Department
Abstract. 2-Methoxyestradiol (2-ME) has been found to possess antitumor activity in vivo and in vitro. It has been suggested that 2-ME induces apoptosis resulting in G2/M arrest of tumor cells. In this study, the effect of 2-ME was evaluated in rat osteosarcoma and malignant fibrous histiocytoma (MFH) cell lines. 2-ME was used at final concentrations of 100 nM to 2 ÌM. The effect of 2-ME on cell growth was measured by the MTS assay. Induction of apoptosis and activation of caspase-3 were investigated along with apoptosis-related gene expression. The data showed that 2-ME significantly inhibited cell growth, inducing apoptosis. The activity of caspase-3 was increased at 20 h and 40 h in both cell lines. 2-ME induced p16 expression, which was possibly involved in the apoptotic process. These results suggested that the 2-ME-induced apoptosis of rat osteosarcoma and rat MFH cells was accompanied by caspase3 activation through p16 induction. 2-Methoxyestradiol (2-ME) is a natural estrogenic metabolite formed by the hydroxylation of estradiol followed by its O-methylation in the liver (1). It is a highly potent anticancer agent that effectively induces apoptosis in tumor cells, both in vivo and in vitro (2). It is orally active in inhibiting tumor growth and metastatic spread in several tumor models, at doses that show no clinical signs of toxicity (3). Although 2-ME is formed from 17‚-estradiol (4), its anticancer action is not dependent on estrogen receptor binding (5). Previous studies have shown that one
Correspondence to: Kanya Honoki, MD, Ph.D., Department of Orthopedic Surgery, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521, Japan. Tel: +81 744 22 3051 ext. 2324, Fax: +81 744 25 6449, e-mail:
[email protected] Key Words: 2-Methoxyestradiol, apoptosis, rat osteosarcoma, rat malignant fibrous histiocytoma.
0258-851X/2008 $2.00+.40
mechanism for the cytotoxic effect of 2-ME is the interference with the stability of microtubules and subsequent arrest of cells in the G2/M phase of the cell cycle (6, 7). The pro-apoptotic action of 2-ME has been linked to the stimulation of the production of cellular reactive oxygen species, resulting in release of cytochrome c from the mitochondria and activation of caspases (8, 9). In some studies, several molecular mechanisms have been attributed to 2-ME-mediated cell death and apoptosis. Many drugs induce cancer cell death through apoptotic pathways. Apoptosis is initiated by two main pathways – the mitochondria-mediated and the death receptor-mediated. The mitochondria-mediated pathway is initiated by various changes in mitochondrial function including increased mitochondrial membrane permeability, reduced mitochondrial membrane potential, and release of cytochrome c and of the apoptosis-inducing factor. Interaction of the released cytochrome c with dATP and APAF-1 results in activation of the initiator caspase, caspase-9, which in turn triggers activation of the executor caspases of cell death (10, 11). The death receptor-mediated pathway is initiated following the binding of a specific ligand to a TNF receptor superfamily member (Fas, TNF RI, TNF RII, TRAIL, DR4, DR5). This binding is followed by the recruitment of the adaptor molecule FAS-associated death domain (FADD). Subsequently, FADD uses its death effector domain to recruit proximal caspase-8 or -10. This results in the formation of a death initiator signaling complex with the subsequent release of the activated forms of these caspases. Activation of caspase-8 or -10, in turn, triggers activation of executor caspases, which mediate cell death (12, 13). An effect of 2-ME has been shown in many cancer cells, but only few studies have shown an effect in sarcomas. We investigated the effect of 2-ME in COS1NR (rat osteosarcoma) and MFH1NR [rat malignant fibrous histiocytoma (MFH)] cell lines, both of which were established in our laboratory, along with the induction of apoptosis.
21
in vivo 22: 21-26 (2008) Table π. Primer pairs used in semiquantitative RT-PCR.
Fas Fas-L p16INK4a p19ARF GAPDH
Forward primer (5'-3')
Reverse primer (5'-3')
CAGCTGCCTCCAGTGCTGGTA TCTGGAATGGGAAGACACATA CTTCACCAACGCCCCGAACAC GCAGAGCATGGGTCGCAGGTTC GGTGCTGAGTATGTCGTGGA
TCATGGTCCTCCCAGACCAT ACCAGATCCCCAGGATACTT CGGGAGAGGGTGGTGGGGTC CGGGAGAGGGTGGTGGGGTC GCCATGCCAGTGAGCTTCCC
Materials and Methods Cells and cell culture. The cell lines used in this study were 4hydroxy(amino)quinoline 1-oxide (4-HAQO)-induced rat osteosarcoma COS1NR (14) and 4-HAQO-induced rat MFH MFH1NR (15), both of which were established in our laboratory. All cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. The cells were incubated at 37ÆC in humidified 5% CO2. Drug treatment. 2-ME (Sigma, St. Louis, MO, USA) was dissolved in absolute ethanol to give a 20 mM stock solution and stored at –20ÆC. 2-ME was diluted in culture medium and used at final concentrations of 100 nM to 2 ÌM for 24-48 h and 72 h. Assessment of cell viability. The effect of 2-ME on cell growth was measured by the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)]-2H-tetrazolium, inner salt (MTS) colorimetric dye reduction assay, which closely correlated with viable cell numbers under our experimental conditions. Both cell lines were inoculated into 96-well microtiter plates (2,000 cells/well) allowed to attach to the plates for 4 h at 37ÆC, and then exposed to different concentrations of 2-ME (final concentration 100 nM to 2 ÌM). After 24, 48 and 72 h incubation, cell viability was measured using the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay reagent (Promega, Madison, WI, USA). In brief, 20 Ìl of MTS solution were added into each well, the plates were incubated for 1 h under a 5% CO2 atmosphere at 37ÆC, and cell proliferation was then measured at an emission wavelength of 492 nm. Detection of apoptosis by ELISA. Apoptosis induced by 2-ME in COS1NR and MFH1NR cells was determined with an Apostrandì ELISA Apoptosis Detection kit (BIOMOL International, Plymouth Meeting, PA, USA), according to the manufacturer's instructions. Caspase-3 activity assay. Cells were grown in 96-well dishes and treated with 1 ÌM of 2-ME, then caspase-3 activity was determined with a colorimetric ELISA assay kit (Sigma, MO, USA). In brief, after treatment with 2-ME, the cells were washed in phosphatebuffered saline (PBS) and assay buffer (20 mM HEPES, pH 7.4, 2 mM EDTA, 0.1% CHAPS, 5 mM DTT, diluted assay buffer) was added to each well, then 10 Ìl of caspase-3 substrate were added with shaking to mix. The plate was covered and incubated at 37ÆC overnight and the absorbance at 405 nm was then measured. RNA extraction and RT-PCR analysis. Total RNA was extracted using the RNeasy Total RNA system (Qiagen GmbH, Hilden, Germany) and first-strand cDNAs were synthesized from 600 ng
22
samples with the Superscript II RNase H reverse transcriptase system (Invitrogen Life Technologies, Carlsbad, CA, USA). All PCR reactions were performed using 1 Ìl of a 10 Ìl reaction mixture as the template. The primer sequences used for amplification of the rat Fas and Fas ligand, p16INK4a, and p19ARF genes are listed in Table I. The rat glyceraldehyde-3-phosphate dehydrogenase gene was used as an internal control to adjust the amounts of template. Aliquots of 10 Ìl of the amplification products were separated by electrophoresis in 1.5% agarose gels and visualized by ethidium bromide staining.
Results Cell proliferation. Cell proliferation following treatment with 100 nM, 200 nM, 500 nM, 1 ÌM, or 2 ÌM of 2-ME is shown in Figure 1. The data show that 2-ME statistically significantly inhibited cellular growth in a dose- and timedependent manner (Figure 1). Detection of apoptosis. The proportion of apoptotic cells determined by colorimetric assay increased in both cell lines in a dose-dependent manner with 2-ME treatment, while growth rates decreased (Figure 2). Thus, the induction of apoptosis was associated with cell growth suppression in both tumor cell lines. Caspase-3 activity and Fas and Fas-ligand mRNA expression. The activity of caspase-3 measured by ELISA increased at 20 h and 40 h in both cell lines treated with 1 ÌM of 2-ME (Figure 3). Expression of Fas and Fas-ligand mRNA increased with 2-ME treatment at 16 h or 36 h in COS1NR. This finding correlated closely with caspase-3 activity (Figure 4), while expression of Fas and Fas-ligand mRNA was not affected by 2-ME treatment in MFH1NR. Expression of p16 mRNA in both cell lines after treatment. Expression of p16 mRNA appears higher at 36 h in COS1NR and at both 16 h and 36 h in MFH1NR. p19 mRNA expression was unaffected in these cell lines (Figure 5).
Discussion 2-ME, an endogenous natural product of estradiol metabolism, has been shown to have activity against tumor cell lines in preclinical models. It inhibits the growth of
Fujii et al: Growth Inhibition and Induction of Apoptosis by 2-Methoxyestradiol
Figure 2. The proportion of apoptotic cells as determined with colorimetric assay increased in both cell lines in a dose dependent fashion, while growth rates decreased with 2-ME treatment. All values represent means from 5 replicated results.
Figure 1. The effect of 2-ME on COS1NR and MFH1NR cell lines. Cell growth of both cell lines was inhibited by 2-ME in dose- and timedependent manner. All values represent means from 5 replicated results and error bars show standard deviation.
various cancer cells, including lung, breast, pancreatic, hepatocellular carcinoma, neuroblastoma, medulloblastoma, melanoma and gastric cancer (1, 16-18). However, only a few studies have demonstrated an effect of 2-ME on sarcomas. Golebiewska et al. reported that the effect of 2ME varies among cell types. Although 2-ME seems to inhibit the growth of most tumor types in vitro and in vivo, the mechanisms of cell growth inhibition are multifactorial and depend on the tumor type (5). The inhibitory effects of 2-ME have been attributed to several mechanisms, including disruption of microtubule function (19) inhibition of superoxide dismutase (20), inhibition of angiogenesis (21), and induction of apoptosis (22, 23). 2-ME has been demonstrated to cause G2/M
Figure 3. Caspase-3 activity was increased in a time-dependent manner after both 20 and 40 h in 2-ME-treated COS1NR and MFH1NR cell lines. All values represent means from 5 replicated results.
arrest, to bind to tubulin and microtubules inhibiting both polymerization and depolymerization, and to cause abnormal spindle formation in cultured cells (4). In this study, we found that 2-ME inhibited rat osteosarcoma and rat MFH cell growth through the induction of apoptosis. Apoptosis is initiated by two main pathways, the death receptor-mediated 'extrinsic pathway' and the mitochondria-mediated 'intrinsic pathway' (24) and both pathways are intimately connected, converging into a common pathway causing the activation of effector enzymes termed caspases (25). The death receptordependent pathway is mediated by a death-inducing signaling complex, which is formed by recruitment of a Fasassociated death domain and procaspase-8 to the death receptor, thereby activating caspase-8 (26). Caspase-8 directly activates caspase-3, leading to apoptosis (27). The mitochondrial ‘intrinsic pathway' is mediated by Bcl-2
23
in vivo 22: 21-26 (2008)
Figure 4. The expression of Fas and Fas-ligand mRNA increased with 2ME treatment at 16 h or 36 h in COS1NR, while the expression of Fas and Fas-ligand mRNA was not affected by 2-ME treatment in MFH1NR.
Figure 5. The expression of p16 mRNA appears higher at 36 h in COS1NR and at both 16 h and 36 h in MFH1NR. The p19 mRNA expression was unaffected in these cell lines.
family proteins, and Bid-Bak heterodimers that regulate the release of cytochrome c from mitochondria and activation of caspase-3 and caspase-9 (27, 28). The extrinsic and the intrinsic pathways In the present study, induction of apoptosis occurred with increased Fas-L expression along with caspase-3 activation when rat osteosarcoma cells were treated with 2-ME. Increased expression of p16 mRNA was also observed in both cells after 36 h of treatment with 2-ME and was possibly involved in the induction of apoptosis. Thus, the effect of 2-ME on these sarcomas might be associated with the death receptor-dependent pathway. Garcia et al. reported that oral administration of 2-ME (75 mg/kg body weight) for 4 weeks inhibited tumor growth by about 60% with no evidence of toxicity in a breast cancer model, reduced the number of metastases in a lung tumor model by 59%, and reduced tumor size in mice with angiosarcoma by 68% (29). Furthermore, Zhang et al. evaluated the efficacy of 2-ME administration orally to hormonerefractory prostate cancer patients in whom other treatments, including hormone therapy, had failed. They concluded that 2-ME was safe and well-tolerated (30). Many studies have indicated that the growth inhibitory effect of 2ME is specific to tumor cells and does not affect normal cells. Further studies will help to elucidate the mechanism of the effect of 2-ME on tumor growth inhibition and its use in treatment might become feasible in clinical settings. In conclusion, our results suggest that 2-ME inhibits cell growth of rat osteosarcoma and MFH in a dose- and timedependent manner, inducing apoptosis, and is a potential treatment for these sarcomas.
References
Acknowledgements This work was supported by the Foundation for Promotion of Cancer Research in Japan.
24
1 Zhu BT and Conney AH: Is 2-methoxyestradiol an endogenous estrogen metabolite that inhibits mammary carcinogenesis? Cancer Res 58: 2269-2277, 1998. 2 Klauber N, Parangi S, Flynn E, Hamel E and D'Amato RJ: Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and Taxol. Cancer Res 57: 81-86, 1997. 3 Fotsis T, Zhang Y, Pepper MS, Adlercreutz H, Montesano R, Nawroth PP and Schweigerer L: The endogenous oestrogen metabolite 2-methoxyoestradiol inhibits angiogenesis and suppresses tumor growth. Nature 368: 237-239, 1994. 4 Seegers JC, Aveling ML, Van Aswegen CH, Cross M, Koch F and Joubert WS: The cytotoxic effects of estradiol-17‚, catecholestradiols and methoxyestradiols on dividing MCF-7 and HeLa cells. J Steroid Biochem 32: 797-809, 1989. 5 Schumacher G and Neuhaus P: The physiological estrogen metabolite 2-methoxyestradiol reduces tumor growth and induces apoptosis in human solid tumors. J Cancer Res Clin Oncol 127: 405-410, 2001. 6 Brueggemeier RW, Bhat AS, Lovely CJ, Coughenour HD, Joomprabutra S, Weitzel DH, Vandre DD, Yusuf F and Burak WE Jr: 2-ME: A new 2-methoxy estrogen analog that exhibits antiproliferative activity and alters tubulin dynamics. J Steroid Biochem Mol Biol 78: 145-156, 2001. 7 Ochi T and Oda T: Structure-effect relationship in the induction of mitotic phase-specific abnormality of centrosome integrity and multipolar spindles by steroidal estrogens and their derivatives in cultured mammalian cells. J Steroid Biochem Mol Biol 78: 113-122, 2001. 8 Huang P, Feng L, Oldham EA, Keating MJ and Plunkett W: Superoxide dismutase as a target for the selective killing of cancer cells. Nature 407: 390-395. 2000. 9 Lambert C, Thews O, Biesalski HK, Vaupel P, Kelleher DK and Frank J: 2-methoxyestradiol enhances reactive oxygen species formation and increases the efficacy of oxygen radical generating tumor treatment. Eur J Med Res 7: 404-414, 2002. 10 Ferri KF and Kroemer G: Control of apoptotic DNA degradation. Nat Cell Biol 2: 63-64, 2000.
Fujii et al: Growth Inhibition and Induction of Apoptosis by 2-Methoxyestradiol
11 Reed JC and Green DR: Remodeling for demolition: changes in mitochondrial ultrastructure during apoptosis. Mol Cell 9: 13, 2002. 12 Ashkenazi A and Dixit VM: Death receptors: signaling and modulation. Science 281: 1305-1308, 1998. 13 Sartorius U, Schmitz I and Krammer PH: Molecular mechanisms of death-receptor-mediated apoptosis. Chembiochem 2: 20-29, 2001. 14 Mii Y, Tsutsumi M, Shiraiwa K, Miyauchi Y, Honoki K, Maruyama H, Ogushi H, Masuhara K and Konishi Y: Transplantable osteosarcomas with high lung metastatic potential in Fischer 344 rats. Jpn J Cancer Res 79: 589-592, 1988. 15 Mii Y, Maruyama H, Miyauchi Y, Yokose Y, Masuhara K and Konishi Y: Experimental studies on malignant fibrous histiocytomas in rats. 1. Production of malignant fibrous histiocytomas by 4-hydroxyamino quinoline-1-oxide in bone of Fischer 344 strain rats. Cancer 50: 2057-2065, 1982. 16 Kumar AP, Garcia GE and Slaga TJ: 2-Methoxyestradiol blocks cell cycle progression at G2/M phase and inhibits growth of human prostate cancer cells. Mol Carcinog 31: 111-124, 2001. 17 Shimada K, Nakamura M, Ishida E, Kishi M and Konishi N: Roles of p38 and c-jun NH2-terminal kinase-mediated pathways in 2-methoxyestradiol-induced p53 induction and apoptosis. Carcinogenesis 24: 1067-1075, 2003. 18 Gao N, Rahmani M, Dent P and Grant S: 2-Methoxyestradiolinduced apoptosis in human leukemia cells proceeds through a reactive oxygen species and Akt-dependent process. Oncogene 24: 3797-3809, 2005. 19 Hamel E, Lin CM, Flynn E and D'Amato RJ: Interactions of 2-methoxyestradiol, an endogenous mammalian metabolite, with unpolymerized tubulin and with tubulin polymers. Biochemistry 35: 1304-1310, 1996. 20 Huang P, Feng L, Oldham EA, Keating MJ and Plunkett W: Superoxide dismutase as a target for the selective killing of cancer cells. Nature (Lond.) 407: 390-395, 2000. 21 Fotsis T, Zhang Y, Pepper MS, Adlercreutz H, Montesano R, Nawroth PP and Schweigerer L: The endogenous oestrogen metabolite 2-methoxyoestradiol inhibits angiogenesis and suppresses tumor growth. Nature (Lond.) 368: 237-239, 1994.
22 Yue TL, Wang X, Louden CS, Gupta S, Pillarisetti K, Gu JL, Hart TK, Lysko PG and Feuerstein GZ: 2-Methoxyestradiol, an endogenous estrogen metabolite, induces apoptosis in endothelial cells and inhibits angiogenesis: possible role for stress-activated protein kinase signaling pathway and Fas expression. Mol. Pharmacol 51: 951-962, 1997. 23 Nakagawa YY, Ogane N, Inoki Y and Kitoh N: The endogenous estrogen metabolite 2-methoxyestradiol induces apoptotic neuronal cell death in vitro. Life Sci 58: 1461-1467, 1996. 24 Gupta S: Molecular steps of death receptor and mitochondrial pathways of apoptosis. Life Sci 69: 2957-2964, 2001. 25 Rossi D and Gaidano G: Messengers of cell death: apoptotic signaling in health and disease. Haematologica 88: 212-218, 2003. 26 Kim R, Tanabe K, Uchida Y, Emi M, Inoue H and Toge T: Current status of the molecular mechanisms of anticancer druginduced apoptosis. The contribution of molecular-level analysis to cancer chemotherapy. Cancer Chemother Pharmacol 50: 343-352, 2002. 27 Barnhart BC, Alappat EC and Peter ME: The CD95 type I/type II model. Semin Immunol 15: 185-193, 2003. 28 Kim R: Recent advances in understanding the cell death pathways activated by anticancer therapy. Cancer 103: 15511560, 2005. 29 Garcia GE, Wisniewski HG, Lucia MS, Arevalo N, Slaga TJ, Kraft SL, Strange R and Kumar AP: 2-Methoxyestradiol Inhibits Prostate Tumor Development in Transgenic Adenocarcinoma of Mouse Prostate: Role of Tumor Necrosis Factor-·-Stimulated Gene 6. Clin Cancer Res 12: 980-988, 2006. 30 Zhang M, Altuwaijri S and Yeh S: RRR-·-Tocopheryl succinate inhibits human prostate cancer cell invasiveness. Oncogene 23: 3080-3089, 2004.
Received September 4, 2007 Revised November 20, 2007 Accepted November 30, 2007
25
