Heat-Treated Polyethylene Degradation in Presence ...

International Journal of Molecular Biotechnology Vol. 4: Issue 1

www.journalspub.com

Heat-Treated Polyethylene Degradation in Presence of Extracellular Enzymes of Staphylococcus epidermidis Bappaditya Roy1,2,3 Keka Sarkar1,3, Rajat Banerjee3, Sumana Chatterjee1,* 1

Department of Chemistry, Basanti Devi College, Rashbihari Avenue, Kolkata, West Bengal, India 2 Department of Microbiology, The Ohio State University, Columbus, OH, USA 3 Department of Biotechnology, Dr. B. C. Guha Centre for Genetic Engineering and Biotechnology, University of Calcutta, Kolkata, West Bengal, India

ABSTRACT Staphylococcus epidermidis BP/SU1 can survive in a mineral medium supplemented with shredded autoclaved commercial LDPE (Low density polyethylene) as well as heat cast pure LDPE as its only carbon source and degrade commercial LDPE as seen by scanning electron microscopy. The extracellular supernatant of both the cultures show over expression of the same two proteins compared with the glucose supplemented one and the one where there is no carbon source. Tryptic digestion of these proteins was followed by Matrix Assisted Laser Desorption and Ionization-Mass Spectroscopy (MALDI-MS). Comparative proteomic analysis yielded significant homology with two proteins originating from Staphylococcal origin, one of them was fructose-bisphosphate aldolase class 1 (AAW52952) and the other one was superoxide dismutase (AAO04839). The effects of these two proteins were studied separately, along with the extracellular exudates, on commercial LDPE with the help of Fourier Transform-Infra Red spectroscopy (FT-IR) and Atomic Force Microscopy (AFM). The effect of the same two proteins on pure LDPE is studied using GC-MS (Gas Chromatography- Mass Spectrometry). Light scattering experiments with the residual mineral media after the proteins have acted on the pure LDPE give evidence of increase in the size of particulate matter when these enzymes act on it. Keywords: biodegradation, fructose-bisphosphate aldolase, polyethylene, Staphylococcus epidermidis, superoxide dismutase *Corresponding Author E-mail: [email protected] INTRODUCTION Nonbiodegradable thermoplastic polymers especially commercial polyethylene film of 20 µm thickness has monopolized the packaging industry due to its sheer virtuosity. The enormous amount of polyethylene produced and utilized on a daily basis has led to a serious accumulation problem that can be viewed as a threat to the environment. One way of tackling the problem would be to isolate and improve micro-organisms that can efficiently degrade the polymers currently used. In order to make this option viable the mechanism of biodegradation must be understood well. It is likely that

biodegradation is an enzyme mediated process, though till date no one enzyme can be solely given the responsibility of degrading the polyethylene. Literature suggests that laccase may be a suitable candidate [1] and so might be polyethylene glycol (PEG) dehydrogenase which is instrumental in polyethylene glycol metabolism [2]. Biodegradation of polymers generally proceed through the following steps [3]: (1) Attachment of microorganisms to the surface of the polymer. (2) Excretion of extracellular enzymes and cofactors leading to the breakdown of the polymer.

IJMB (2018) 10–22 © JournalsPub 2018. All Rights Reserved

Page 10

Heat-Treated Polyethylene Degradation

(3) Growth of the microorganism using the polymer as the carbon source. The hydrophilicity of the surface is an important factor leading to the ease with which the microorganisms get attached to the polyethylene surface [4]. Initial physical or chemical modification or degradation leads to the insertion of hydrophilic groups to the polymer surfaces making it more acceptable to bacterial attack [5]. Use of pro-oxidants like complex transition metals particularly Fe, Co, etc. can also facilitate the process of degradation [6]. All these methods require pretreatment of polyethylene, which is bound to be expensive. Instead waste polyethylene of random sources could be partially degraded by heat to induce biodegradation [7] which may introduce hydrophilic sites in it. These hydrophilic groups not only encourage the attachment of microorganisms, they also provide the requisite substrate environment for enzymatic action [8]. Staphylococcus epidermidis is known as an opportunistic pathogen causing infection in patients with implanted medical devices such as intravascular and peritoneal dialysis catheters, prosthetic heart valves, all of which are polymeric in origin [9]. The essential pathogenesis of polymer associated infection is due to the organism’s inherent ability to exude extracellular material which eventually leads to bio film formation [10]. Since research work so forth had been centered on the characteristics of bio film and how to eradicate it [11], little attention has been paid to the nature and function of the protein components getting exuded. This work aims at finding out the causative agents produced by the BP/SU1 strain of Staphylococcus epidermidis (Acc No. MTCC 9538) which is responsible for biodegradation of autoclaved commercial polyethylene film of less than 20 µm thickness when bred in a mineral media with shredded LDPE as its only carbon source [12].

Roy et al

MATERIALS AND METHODS Chemicals and Stock Solutions The commercial LDPE films used in this report were obtained from the local market (Ganapati Polymers, Kolkata) where it is sold as 20-µm thick carry bags; these were then washed in benzene and alcohol to remove additives by immersing in the carry bags in the respective solvents for overnight and then drying them under the laminar flow. The pure LDPE without any additives had been specially procured from Reliance Industries Ltd and then heat cast (5mg of the polymer is uniformly dispersed on a glass petri dish and heated gently to obtain a thin film). The nutrient medium materials were obtained from Hi Media. The inorganic salts along with glucose were obtained from E-Merck. The protein molecular weight standards used were obtained from Chromous Biotech. The centrifugal filtering devices were obtained from Millipore. The tryptic digest kit used for peptide mass fingerprinting was obtained from Thermo Scientific Pierce Protein Research products. For bacterial expression, pET15b was purchased from Novagen. Restriction enzymes, Taq DNA polymerase, T4 DNA ligase, dNTP set, 100 bp DNA Ladder were purchased from New England BioLabs and Fermentas Life Sciences. Plasmid purification kit, DNA gelextraction kit and DNA sequencing reagents were all obtained from QIAGEN, Promega and Applied Biosystems, respectively. His-select nickel resin and superoxide dismutase (origin: E. coli) {CAS;9054-89-1, S5639} were purchased from Aldrich–Sigma Chemical Company. All other chemicals used were of analytical grade. Preparation of Extracellular Supernatant Carbon free mineral nutrient media [13] supplemented with 2% commercial shredded LDPE as its only carbon source is autoclaved and inoculated with cells obtained from overnight liquid culture of


Page 11


www.journalspub.com

BP/SU1 in enriched media(1% tryptone,0.5%Yeast extract,0.5% NaCl). 10 ml of this overnight liquid culture is centrifuged at 5000rpm for 10mins and the cell pellet so obtained is resuspended in 10 ml of autoclaved water and centrifuged. This process is repeated thrice to get the washed cell pellet to be used as inoculums in the LDPE based mineral media. The polyethylene based liquid culture is incubated at 37°C at 180 rpm shaking condition for about a month.(supplemented by mineral media as required). The extracellular supernatant is obtained by Millipore filtration of this culture using (0.22 µm pore sized cellulose filters, catalogue No. GSWPO4700). Characterization of the Commercial LDPE by Scanning Electron Microscopy (SEM) Polyethylene films of 1cm ×1 cm size are incubated, (shredding is avoided to prevent mechanical abrasions) with the extracellular supernatant of BP/SU1 at 37°C in shaking condition for seven days. Then they are recovered from the medium and carefully dried under the laminar flow. The control LDPE film which had been incubated in the mineral medium alone is treated in the same manner. 2 mm 2 mm squares of these films were gold coated to a thickness of 20 to 25 nm by using Hitachi ion splatter E-102. The microscopic characterization was done by using Hitachi S 3400-N scanning electron microscope. Mass Spectrum and Database Search This extra cellular supernatant of the shredded LDPE culture was concentrated with the help of AmiconTM (10 kDa cut off regenerated cellulose, catalogue no.UFC901008, Millipore Corp. USA) to 1/10th of its original volume. The two most prominent differentially expressed Colloidal Coomassie (Bio-Rad) stained bands were excised from the 12% SDS polyacrylamide gel of the concentrated

extracellular supernatant and prepared for Mass Spectroscopy using standard procedure of in-gel tryptic digestion (Thermo Scientific Pierce Protein Research-89871). Samples were nitrogen dried before being inserted onto a time-offlight mass-spectrometer (Applied Biosystems 4800, MALDI TOF/TOFTM analyzer) Positive ion mass spectra were recorded using (20 kV) of the total acceleration energy. Protein identification was performed by searching the MS/MS spectra against the NCBI database, using a local MASCOT search engine on GPS Explorer TM software (Applied Biosystems). Bacterial culture and extracellular protein extraction: Staphylococcus epidermidis BP/SU1 was cultured in a carbon free mineral nutrient medium [13] supplemented with: (a) 0.2% (w/v) of autoclaved pure polyethylene from Reliance Industries. (b) 0.2% (w/v) of autoclaved shredded commercial LDPE. (c) 0.2% (w/v) of glucose. At 37°C for 20 days using washed cell pellets from enriched medium as described before. Cell free supernatant (a), (b) and (c) were obtained by Millipore (0.22 μm) filtering these cultures. They were concentrated using 10 kDa cut-off amicons (Millipore Corp., USA) to 1/10th of its original volume at 4C and used for SDSPAGE analysis (20μl of the concentrated exudates was loaded per lane compared to5μl of molecular weight marker) and enzyme assays. Extracellular Enzyme Assay The enzymes whose activity were tested for were Fructose-bisphosphate aldolase (FBPA), superoxide dismutase (SOD), Laccase and PEG (polyethylene glycol) dehydrogenase. The assays were done using standard protocols given in the supplementary materials.


Page 12


Cloning, Expression and Purification of Recombinant FBPA The genomic DNA was isolated using lysozyme lysis standard method from Staphylococcus epidermidis BP/SU1. The integrity of the genomic DNA isolated was checked on 0.7% agarose gel. Further it was used as a template for amplification of fructose-bisphosphate aldolase (FBPA) gene by PCR using Staphylococcus epidermidis RP62A fbaA gene specific primers (forward primer: 5ATCATATGATGAATA AAGAACAATTAG-3; reverse primer: 5ATGGATCCTTAGTTTTTATTTACTG AC-3). The PCR amplified gene was cloned into pGEM-T vector (Promega) and transformed into XL1Blue strain of E. coli. The transformed colonies were screened by colony PCR with the help of M13 primers and then seen in 0.7% agarose gel. The plasmids DNA of the positive clones are next purified by QIAGEN DNA mini prep method (primary construct). Now the FBPA gene was sub-clone into the pET15b His-tag expression vector. 4 μg of pET15b and primary construct, both were digested with two restriction enzymes, namely NdeI and BamHI separately at 37C for two hours. The digested product was analyzed in 1.5% agarose gel electrophoresis and the desired ~891bp band was gel extracted and purified using the Promega Gel extraction protocol. The purified DNA was then self-ligated with T4 DNA ligase at 8C (overnight) followed by the transformation of the ligation mixture in XL1Blue strain of E. coli. The transformed cells was spread on ampicillin selectable Luria-Bertani (LB) agar plate and incubated at 37C for overnight. Next day, 12 colonies were screened by colony PCR using insert specific primer and further confirmed by restriction digestion. The digested mixture was analyzed in 1.5% agarose gel electrophoresis. Finally, FBPA gene sequence of S. epidermidis BP/SU1 was confirmed by automated DNA sequencing based on Big-dye methods

Roy et al

(Applied Biosystems) and the sequences were identified by BLAST comparison (http://www.ncbi.nlm.nih.gov/blast/Blast.c cg). pET15b plasmid containing S. epidermidis BP/SU1 FBPA gene were further transformed into the E. coli strain BL21 (DE3), which carries a T7 polymerase enabling promoters specific for T7 to give high expression of genes which are under these promoters. After initial overnight growth in LB medium in presence of ampicillin (100 μg/ml), 1% inoculums (v/v) were transferred to 1 lit fresh LB medium with same concentration of ampicillin, incubated at 37C in shaking condition until an OD600 of 0.6. After cooling the cultures, induction of gene expression commenced by the addition of 0.5 mM IPTG (isopropyl-1-thio-β-Dgalactoside, an inducer) and shaking at 22C was continued overnight. Cells were harvested by centrifugation (5000 rpm for 15 min) and stored at –20C. The cell pellet was resuspended in 100 mM TrisHCl, pH 7.0, 100 mM NaCl, 14 mM βmercaptoethanol, 0.25% Tween-20, 10 mM imidazole, 0.1 mM PMSF and sonicated 10 times with 20 sec pulse with 2 min interval. The cell lysate was centrifuged at 10,000g for 45 min and the supernatant was collected and transferred carefully into the Ni-NTA column previously equilibrated with 20 column bed volume of buffer containing 100 mM Tris-HCl, pH 7.0, 100 mM NaCl, 10 mM imidazole and then washed with 4 column bed volume of same buffer containing. Finally, the His-tagged protein was recovered by elution with 10 ml 100 mM Tris-HCl, pH 7.0, 100 mM NaCl, 200 mM imidazole. The purity of collected fractions was assessed by SDS-PAGE and found to be about 98% pure. The fractions containing enzyme were dialyzed against 100 mM Tris-HCl, pH 7.0, 100 mM NaCl, 5% glycerol at 4C, overnight. The product was finally stored at –80C.


Page 13


www.journalspub.com

Characterization of the Polyethylene Surface Topography by Atomic Force Microscopy (AFM) Enzymes and concentrated extracellular supernatant treated LDPE films were further characterized through atomic force microscopy [14]. Morphologies of the LDPE films were observed by tapping mode AFM (Innova/Veeco) in air at 25C. A rectangular Si cantilever with spring constants of 20 N/m was used for the AFM observation with a light tapping force (setpoint amplitude/ free oscillating amplitude = 2.93 V). The scan rate was typically in the 0.5 Hz. The scan angle was set to 0. The resonance frequency was in the 276– 318 kHz range. All LDPE films used in the experiment were washed repeatedly with Milli-Q water and finally dried before the AFM measurement. Characterization of the Polyethylene Film Through Fourier Transform InfraRed Spectroscopy (FT-IR) Analysis The infrared absorption (IR) spectrum was recorded with a Thermo Scientific Nicolet 6700 FT-IR spectrophotometer. A solid pellet was formed by mixing air-dried samples of control, concentrated extracellular supernatant and enzyme treated LDPE films with potassium bromide to make an intimate mixture and scanned between 400 and 4000 cm–1 with air as reference. Characterization of the Polyethylene Film Through Gas Chromatography Mass Spectroscopy (GC-MS) The heat cast pure polyethylene is subjected to FBPA and SOD treatment (20mg of polyethylene along with 50 µg/ml of the respective protein in 10 ml of mineral media) were incubated at 37°C in a rotary shaker. After 17 days the supernatant was separated from the polymer, washed with double distilled water and air- dried. 2 mg of the polymer sample was suspended in 4 ml of chloroform and sonicated in an

ultrasonicator for 19 minutes at 55°C in a glass centrifuge tubes fitted with Teflon tapes to avoid loss due to evaporation [15]. GC-MS measurements were carried out on this chloroform extract in a Perkin Elmer Instrument Clarus 680 GC coupled with SQ8t MS using Elite 5 MS (30m×0.25mm×0.25µm) column. Helium is used as a carrier gas. The oven temperature was programmed from 50°C for 4 min to 250°C at a heating rate of 5°C/min and then it was held at 250°C for 20 min. Samples were introduced in the spitless injection mode. The identification of the degradation products was established by comparison with NST database. Characterization of the Supernatant Through Light Scattering The above supernatant is Millipore filtered to remove the polyethylene pieces and subjected to Static light Scattering in a dust free covered cuvette using Hitachi F7000 Flourimeter. Both the emission and excitation wavelength are kept at 360 nm and the band passes are kept at 5 nm each. The static light scattering is studied through a time period for 15 minutes. For Dynamic Light Scattering a Malvern Zen 3600 instrument is used. The liquid supernatants used for the static and dynamic light scattering experiments are directly syringe filtered into the dust free cuvette. RESULTS AND DISCUSSIONS Figures 1 and 2 show the scanning electron micrograph (SEM) of the autoclaved polyethylene surface that had been incubated with the extracellular supernatant of the organism BP/SU1, and the one which had been incubated in the mineral medium alone. The one that had been incubated with the extra cellular supernatant of the organism BP/SU1 growth showed a clear evidence of pore formation and a uniform level of degradation which was not evident in the


Page 14


plastic incubated in the same conditions with the mineral media alone. This picture provides a strong evidence for the LDPE

Roy et al

degrading action of the extra cellular supernatant of the organism BP/SU1.

Fig. 1. The SEM images of the LDPE treated with the extra-cellular exudate of BP/SU1.

Fig. 2. The SEM image of the film treated with autoclaved mineral media alone under the same conditions. Five most prominent protein (approximately 66kDa {A}, 55kDa{B}, 35kDa{C}, 33kDa{D}, 25kDa{E}) bands are excised from the denatured polyacrylamide electrophorized gel

(Figure 3) according to standard protocol. After in-gel tryptic digestion the product was subjected to MALDI TOF/TOF for protein identification by MS and MS/MS analysis, respectively [16].


Page 15


www.journalspub.com

It was found that the 35 kDa protein (C) shows maximum similarity with Fructosebisphosphate aldolase (FBPA) class 1 (EC 4.1.2.13) protein of Staphylococcus epidermidis RP62A (AAW52952) and the 25 kDa protein (E) shows maximum similarity with Superoxide dismutase (SOD) (AAO04839) of Staphylococcus epidermidis (ATCC 12228). The three other proteins obtained from the extracellular exudates do not show appreciable similarity with any proteins of Staphylococcal origin deposited in the NCBI database. The MS and MS/MS results for the proteins have been given in supplementary section.

Fig. 3. Colloidal Coomassie blue-stained sodium dodecyl sulfate polyacrylamide gel image for identification of over expressed proteins in the extracellular supernatant by comparison with protein ladder and a purified protein (32 kDa).

The comparison of the extracellular protein profile of the cultures grown in pure polyethylene(a) commercial LDPE(b) and glucose(c) as their only source of carbon shows that there are two predominant protein bands at an approximate position of 25 kDa and 35 kDa (Figure 4) that are present in the commercial LDPE sample and that of the pure polyethylene one in greater proportions compared to that of the same amount of glucose supplemented one.

Fig. 4. Colloidal Coomassie blue-stained sodium dodecyl sulfate polyacrylamide gel image. (a) Concentrated extracellular supernatant of BP/SU1 cultivated in pure polyethylene. (b) Concentrated extracellular supernatant of BP/SU1 cultivated in commercial LDPE. (c) Concentrated extracellular supernatant of BP/SU1 cultivated in glucose. (d) Molecular weight marker. (e) Mineral media used as control.


Page 16


The extracellular supernatant of (a), (b) and (c) had been tested for the presence of these FBPA, Laccase and SOD by doing enzyme assays. Since Yamshita et al [2] identified SOD and Diglycolic acid dehydrogenase as the same ether bond splitting enzyme we did an additional PEG dehydrogenase assay to detect the presence of SOD. We got an increased activity of FBPA and SOD in the exudates of virgin polymer (a) and commercial LDPE (b) compared with that of glucose but we did not obtain any consistent activity for laccase in any of our extracellular supernatants (Supporting data

Roy et al.

in supplementary section). In order to investigate the effect of FBPA and SOD on commercial autoclaved LDPE we have incubated 1 cm × 1 cm of LDPE pieces with the 50 µg/ml of purified Staphylococcus epidermidis FBPA expressed in E. coli, commercially obtained active SOD and extracellular supernatant of BP/SU1 grown in mineral media and shredded LDPE. After incubation at 37˚C for 10 days it was subjected to studies by AFM and FT-IR. AFM studies (Figure 5) shows the surface topology of LDPE samples.

Fig. 5. AFM topographic images of LDPE films treated with the following (a) SOD, (b) FBPA, (c) extracellular supernatant of BP/SU1, (d) mineral medium under the same conditions.


Page 17


www.journalspub.com

The extracellular supernatant, purified Staphylococcus epidermidis FBPA expressed in E. coli and commercially obtained active SOD treated polyethylene shows a pitted and rough surface compared to the control which is much smoother.

Micrococcus and Acinetobacter action on paraffins begin with the generation of primary alcohols [17]. Primary alcohol confers a strong peak at 1050–1000 cm–1. The control showed a broad absorbance at 1120 cm-1, which is the fingerprint region for the ether bond however, this band was missing in the enzyme and extracellular supernatant treated samples. As expected the carbonyl index (A1714/A14672) is lower for FBPA, SOD and extracellular supernatant treated samples (data given in Table 1) compared to the control LDPE film, which is a well-documented feature of biotic degradation [18].

The normalized FT-IR data, which showed the finger print region of change (Figure 6), depicted a prominent absorbance peak at 1018 cm–1 in the LDPE samples that had been treated with FBPA, SOD and extracellular supernatant. This peak was very low in the control. The first step of

Fig. 6. FT-IR spectroscopic images of LDPE films treated with (a) SOD, (b) FBPA, (c) extracellular supernatant of BP/SU1, (d) mineral media under the same conditions. Table 1. Carbonyl and double bond index of enzymes and EC-sup treated commercial LDPE. Sample LDPE

Carbonyl index (A1714/A1472)

Double bond index (A1640/A1472)

SOD treated

0.65

0.76

FBPA treated

0.68

0.85

EC-Sup treated

0.84

0.84

Mineral media treated (control)

1.72

0.765

Though the double bond index(A1640/A1472) gets increased in the FBPA and extracellular supernatant treated sample as

expected for biodegradation it remains almost same as that of the control in case of SOD treated sample indicative of the fact


Page 18


that the mechanism of degradation might be different in case of the two systems. Degradation products of a diverse nature were detected through GC-MS in the chloroform extracts of the pure LDPE (Figure 7) treated by enzymes as described.

Roy et al

However, their concentrations were not high as virgin polyethylene is not readily degradable. In case of enzyme treated ones oxygenated hydrocarbons like ketones and carboxylic acid were detected at the initial stages of the experiment that is before 600 secs.

Fig. 7. GC-MS chromatogram of chloroform extracted degradation products of heat cast pure polyethylene treated with SOD (green) FBPA (red) and mineral media (black) under same conditions. In the SOD treated samples traces of hexanoic acid were detected and in FBPA treated sample we observed a small peak of 3-heptanone.Both these peaks were absent in the control. Interestingly hydrocarbons both branched and linear in the range of 16 to 20 carbon atoms which are usual by products of chain scission of the LDPE is missing in the enzyme treated polyethylene extracts but is present in the control polyethylene extract. Octanoic acid and dodecane is detected in all the chromatograms. Docosane (C22H46) remains the most abundant hydrocarbon

[15] in all three chromatograms only it shifts towards longer retention time with the addition of enzymes. Both the light scattering experiments give an evidence of the increase in the particle size when the pure polyethylene is in presence of the proteins than when compared to either the protein solution or the pure polyethylene pieces alone (data given in the supplementary section). This may indicate an association of the enzymes with the degradation products of the polyethylene leading to an increase in


Page 19


www.journalspub.com

the size of the enzyme molecules. Increase in the degradation of the polyethylene in presence of these enzymes may also occur so that the turbidity of the media increases. Fructose-bisphosphate aldolase (FBPA) are group of enzymes of lyases family (EC 4.1.2.13), which catalyzes an aldol cleavage reaction of 1, 6 Fructose phosphate. Pertinently the bacteria Staphylococcus epidermidis can produce Class I fructose-bisphosphate aldolase [19]. It was also reported that class I fructose-bisphosphate aldolase (33.04 kDa), (SA2399) is over expressed when Staphylococcus aureus switches from a biofilm mode of propagation to a planktonic mode of propagation [20]. Though normally an intracellular protein FBPA is known to be surface associated in case of Streptococcus oralis existing in multiple forms depending upon the pH of the medium [21]. It was found that in response to low oxygen tension, Mycobacterium tuberculosis expressed fructose-bisphosphate aldolase into the extracellular medium of the culture filtrates [22]. Very recently an aromatic polyesterase capable of degrading PET( polyethylene terephthalate) was characterized [26] which has structural similarity with FBPA. Superoxide dismutase (SOD) is known to be involved during the degradation of recalcitrant xenobiotics. Extracellular SOD is expressed when the bacteria of the Gordonia sp. are forced to utilize poly (cis 1, 4 isoprene) i.e. natural rubber as its sole carbon source [23]. SOD is expressed extracellularly when lignin degrader Phanerochaete chrysosporium is exposed to dibenzo-p-dioxin [24] and it is noteworthy to mention here that we also had obtained activity for both the enzymes, FBPA and SOD. Chemically polyethylene shares similarity with polyethylene glycol, as the methylene linkage (-CH2-CH2-) is present in both the polymers. The ESR

spectrum for biotically degraded polyethylene shows peak characteristic to peroxy radicals and photo-oxidation of polyethylene begins with the generation of free radicals, which absorb oxygen to give hydroperoxides [17]. Hence, it is not unusual to expect SOD having some polyethylene degrading activity that needs to be investigated further. CONCLUSION This investigation revealed that BP/SU1 strain of Staphylococcus epidermidis is capable of exuding enzymes that actively participate in the process of biodegradation, contrary to the popular view that the microorganisms only passively consume the low molecular weight products of abiotic oxidation for their survival. Though there are multiple proteins which are exuded in the extracellular supernatant and each of them might have their own specific functions in dealing with recalcitrant hydrophobic substrates [25] only two enzymes FBPA and SOD could be identified at this juncture to be involved in polyethylene degradation. ACKNOWLEDGEMENTS The authors acknowledge the help of Mr Sufi O. Raja and Mr Azhar Nehal (Department of Biochemistry), Mr Dibyajnan Chakraborty (Department of Microbiology), Ms Puja Biswas (DBTIPLS) Calcutta University, Dr. Dipa Roy of Department of Polymer Science and Technology, University of Calcutta and Mr Sandip Chakraborty of Indian Institute of Chemical Biology. Mr Bablu Mordina of IOCL is thanked for the procurement of virgin polyethylene. The project was funded by DST (Green Scheme) India. REFERENCES [1] A. Sivan. New Perspectives in plastic biodegradation, Curr Opin Biotechnol. 2011; 22: 422–6p.


Page 20


[2] M. Yamashita, A. Tani, F. Kawai. A new ether bond-splitting enzyme found in gram-positive polyethylene glycol 6000-utilizing bacterium, Pseudonocardia sp. strain K1, Appl Microbiol Biotechnol. 2005; 66: 174– 9p. [3] J. Arutchevli, M. Sudhakar, A. Aratkar, M. Doble, S. Bhaduri, P.V. Uppara. Biodegradation of polyethylene and polypropylene, Ind J Biotech. 2007; 7: 9–22p. [4] C. Mayer, Moritz, C. Krischner, W. Borchard, R. Maibum, J. Wingender, H.C. Flemming. The role of intermolecular interactions: studies on model systems for bacterial biofilms, Int J Biol Macromol. 1999; 26: 3–16p. [5] E. Chiellini, A. Corti, D.S. Graziano, D.A. Salvatore. Oxo-biodegradable polymers: effect of hydrolysis degree on biodegradation behaviour of poly(vinyl alcohol), Polym Degrad Stabil. 2006; 91: 3397–406p. [6] I. Jakubowicz. Evaluation of degradability of biodegradable polyethylene(PE), Polym Degrad Stabil. 2003; 80: 39–43p. [7] H.J. Jeon, M.N. Kim. Isolation of a thermophilic bacterium capable of low- molecular- weight polyethylene degradation, Biodegradation. 2013; 24(1): 89–98p. [8] A.C. Albertsson, C. Barenstedt, S. Karlsson, T. Lindberg. Degradation product pattern and morphology changes as means to differentiate abiotically and biotically aged degradable polyethylene, Polymer. 1995; 36: 3075–83p. [9] M. Ribeiro, F.J. Monterio, M.P. Ferraz. Infection of orthopedic implants with emphasis on bacterial adhesion process and techniques used in studying bacterial-material interactions, Biomatter. 2012; 2(4): 176–94p. [10] P.D. Fey, M.E. Olson. Current concepts in Biofilm Formation of

Roy et al

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]


Staphylococcus epidermidis, Future Microbiol. 2010; 5(6): 917–33p. F. Gomes, P. Texeira, R. Oliviera. Staphylococcus epidermidis as the most frequent cause of nosocomial infections: old and new fighting strategies, Biofouling. 2014; 30: 131– 41p. S. Chatterjee, B. Roy, D. Roy, R. Banerjee. Enzyme mediated biodegradation of heat treated commercial polyethylene by Staphylococcal species, Polym Degrad Stab. 2010; 91: 195–200p. A. Oceguera-Cervantes, A. CarriloGarcia, N. Lopez, S. Bolanos Nunez, M.J. Cruz-Gomez, C. Wacher, H. Loza-Tavera. Characterization of the Polyurethanolytic Activity of two Alicycliphilus sp strains able to degrade polyurethane and Nmethylpyrrolidone, Appl Environ Microbiol. 2007; 73: 6214–37p. K.M. Drummond, R.A. Shanks, F. Cser. Morphological analysis of linear low density polyethylene films by atomic force microscopy, J Appl Polym Sci. 2002; 83: 777–84p. L.C. Rodrigo, N. Haider, A.R. Greus, S. Karlsson. Ultrasonication and microwave assisted extraction of degradation products from degradable polyolefin blends aged in soil, J Appl Polym Sci. 2001; 79: 1101–12p. H.W. Lahm, H. Langen. Mass spectrometry: a tool for identification of protein separated by gels, Electrophoresis. 2000; 21: 2105–14p. A.C. Albertsson, S.O. Andersson, S. Karlsson. The mechanism of biodegradation of polyethylene, Polym Degrad Stab. 1987; 18: 73– 87p. P.K. Roy, S. Titus, P. Surekha, E. Tulsi, C. Deshmukh, C. Rajagopal. Degradation of abiotically aged LDPE films containing pro-oxidant by bacterial consortium, Polym Degrad Stab. 2008; 93: 1917–22p. Page 21


www.journalspub.com

[19] B.N. Jayanthi, P.M. Ramachandra, P.S. Murthy, T.A. Venkitasubramanian. Fructose diphosphate aldolase-class I (Schiff base) from Mycobacterium tuberculosis H37Rv, J Biosci. 1981; 3: 323–32p. [20] S. Schlag, C. Nerz, T.A. Birkenstock, F. Altenberend, F. Götz. Inhibition of Staphylococcal biofilm formation by nitrite, J Bacteriol. 2007; 189(21): 7911–19p. [21] J.C. Wilkins, D. Beighton, K.A. Homer. Effect of acidic pH on expression of surface associated proteins of Streptococcus oralis, Appl Environ Microbiol. 2003; 69(9): 5290–6p. [22] I. Rosenkrands, R.A. Slayden, J. Crawford, C. Aagaard, C.E. Barry III, P. Andersen. Hypoxic response of Mycobacterium tuberculosis studied by metabolic labeling and proteome analysis of cellular and extracellular proteins, J Bact. 2000; 184(13): 3485–91p.

[23] C. Schulte, M. Arenskötter, M.M. Berekaa, Q. Arenskötter, H. Priefert, A. Steinbüchel. Possible involvement of an extracellular superoxide dismutase (SodA) as a radical scavenger in poly (cis-1,4-isoprene) degradation, Appl Environ Microbiol. 2008; 74: 7643–53p. [24] H. Kurihara, H. Wariishi, H. Tanaka. Chemical stress-responsive genes from the lignin-degrading fungus Phanerochaete chrysosporium exposed to dibenzo-p-dioxin, FEMS Microbiol Lett. 2002; 212: 217–20p. [25] M. Koutny, J. Lemaire, A.M. Delort. Biodegradation of polyethylene films with pro oxidant additives, Chemosphere. 2006; 64: 1243–52p. [26] Harry P. Austin et.al Characterization and engineering of aplastic-degrading aromatic polyesterase, PNAS. 2018; www.pnas.org/cgi/doi/10.1073/pnas.1 718804115.


Page 22