Hemopoietic Progenitors + Differentiation of Human CD34 MafB ...

The Journal of Immunology

The Vitamin D3/Hox-A10 Pathway Supports MafB Function during the Monocyte Differentiation of Human CD34ⴙ Hemopoietic Progenitors1 Claudia Gemelli, Claudia Orlandi, Tommaso Zanocco Marani, Andrea Martello, Tatiana Vignudelli, Francesco Ferrari, Monica Montanari, Sandra Parenti, Anna Testa, Alexis Grande,2,3 and Sergio Ferrari2 Although a considerable number of reports indicate an involvement of the Hox-A10 gene in the molecular control of hemopoiesis, the conclusions of such studies are quite controversial given that they support, in some cases, a role in the stimulation of stem cell self-renewal and myeloid progenitor expansion, whereas in others they implicate this transcription factor in the induction of monocyte-macrophage differentiation. To clarify this issue, we analyzed the biological effects and the transcriptome changes determined in human primary CD34ⴙ hemopoietic progenitors by retroviral transduction of a full-length Hox-A10 cDNA. The results obtained clearly indicated that this homeogene is an inducer of monocyte differentiation, at least partly acting through the up-regulation of the MafB gene, recently identified as the master regulator of such a maturation pathway. By using a combined approach based on computational analysis, EMSA experiments, and luciferase assays, we were able to demonstrate the presence of a Hox-A10-binding site in the promoter region of the MafB gene, which suggested the likely molecular mechanism underlying the observed effect. Stimulation of the same cells with the vitamin D3 monocyte differentiation inducer resulted in a clear increase of Hox-A10 and MafB transcripts, indicating the existence of a precise transactivation cascade involving vitamin D3 receptor, Hox-A10, and MafB transcription factors. Altogether, these data allow one to conclude that the vitamin D3/Hox-A10 pathway supports MafB function during the induction of monocyte differentiation. The Journal of Immunology, 2008, 181: 5660 –5672.

A

lthough hemopoiesis is a complex process, it can be schematically divided into two sequential steps. In the initial commitment or lineage decision phase, multipotent hemopoietic stem cells (HSC)4 undergo a gradual restriction of their differentiation potential, eventually resulting in the production of unipotent hemopoietic progenitors/precursors (1, 2). During the subsequent terminal differentiation phase, these last cells give rise to all the mature blood cells, characterized by different phenotypes and specialized functions (1, 3, 4). Spontaneous or exogenously induced up-regulation of transcription factors is the mechanism that is generally invoked to explain the commitment of HSCs and the subsequent maturation of committed progenitors (5, 6). In this regard, a clear distinction has been established between transcription factors that are generically involved Department of Biomedical Sciences, University of Modena and Reggio Emilia, Modena, Italy Received for publication August 10, 2007. Accepted for publication August 7, 2008. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1

This work was supported by a grant from Associazione Italiana per la Ricerca sul Cancro (2006) and from Ministero dell’Universita` e della Ricerca Scientifica e Technologica-Cofin (2007). C.G. is a fellow of the Ergentech Laboratory of Genetics and Biotechnology.

2

These authors share the senior authorship of this investigation.

3

Address correspondence and requests for reprints to Dr. Alexis Grande, Dipartimento di Scienze Biomediche, Sezione di Chimica Biologica, Universita` di Modena e Reggio Emilia, Via Campi 287, 41100 Modena, Italy. E-mail address: [email protected]

4 Abbreviations used in this paper: HSC, hemopoietic stem cells; VD, 1␣,25-dihydroxyvitamin D3; HRE, Hox response element; NGFR, nerve growth factor receptor; ⌬LNGFR, low-affinity NGFR; QRT-PCR, quantitative real-time RT-PCR; SLR, signal log ratio; CTS, cathepsin; NE, nuclear extract.

Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 www.jimmunol.org

in the molecular control of hemopoietic cell differentiation and the so-called master or key regulators, which are by themselves able to promote the lineage commitment of pluripotent HSCs or the lineage switching of already committed progenitors (5, 6). Additional properties of such regulators are also represented by the capacity to inhibit the commitment toward alternative maturation lineages and the ability to transactivate and cooperate other transcription factors controlling the same differentiation lineage (7). Knockout and transgenic mouse experiments have allowed the identification of a large number in this last category of transcription factors, the most important being represented by Pax-5 for B lymphopoiesis, GATA-1 for erythroid differentiation, PU-1 for early myeloid commitment, and C/EBP␣ for granulocyte maturation (6). An additional method to characterize these master regulators in human hemopoiesis is represented by the viral transduction of the investigated transcription factor in leukemic cell lines and CD34⫹ hemopoietic progenitors (8, 9) or, alternatively, by the stimulation of these cells with soluble compounds that are able to modulate differentiation genetic programs (10 –12). Data obtained using this approach provided a clear and definitive demonstration of the crucial role played by VDR and MafB transcription factors in the molecular control of monocyte-macrophage differentiation (8, 10). In fact: 1) stimulation of cord blood CD34⫹ stem/progenitor cells with physiological levels of 1␣,25-dihydroxyvitamin D3 (VD) leads to a massive induction of such differentiation, which is mediated by its genomic VDR-dependent intracellular pathway (10); and 2) retroviral transduction of MafB in the same cells results in a comparable effect (8). A further, although controversial, regulator of human monocytopoiesis is represented by the Hox-A10 transcription factor. It is well known that Hox genes, originally identified as key regulators of embryonic development, also play a fundamental role in normal and leukemic hemopoiesis, controlling

The Journal of Immunology both self-renewal and commitment-differentiation processes (13, 14). In this regard, a number of reports indicate an involvement of the Hox-A10 gene in the regulation of monocyte commitment that is fundamentally based on three experimental observations. First, Hox-A10 expression is restricted to the CD34⫹ progenitor and myeloid precursor phase of hemopoiesis (15); secondly, this gene is a primary response gene of the VD monocyte differentiation inducer (16, 17); and finally, retroviral vector-mediated expression of its cDNA induces the monocyte differentiation of U937 (16) and CD34⫹ hemopoietic progenitors (18) inhibiting, at the same time, the commitment to lymphoid, erythroid, and granulocyte lineages (19). Despite this, a microarray study performed on CD34⫹ cells retrovirally transduced with Hox-A10 disclosed the up-regulation of genes belonging to the Wnt pathway, suggesting a role in the regulation of HSC self renewal (20). Similarly, in a distinct report, transplantation of Hox-A10-transduced CD34⫹ cells in NOD/ SCID mice resulted in a proliferative expansion of the myeloid progenitor compartment (19). Both reports confirmed the previously reported inhibition of erythroid differentiation, whereas the former also claimed a down-regulation of monocyte-related genes thus contradicting the previously mentioned data. This controversy is further complicated by the observation that transplantation of Hox-A10-transduced murine stem cells in recipient mice gives rise to an expansion of megakaryocyte progenitors, observed only in vitro, and the appearance of acute myeloid leukemias in vivo (21). A recent report, based on a transgenic mouse model in which transcription of the transgene is controlled through an inducible system, indicated Hox-A10 expression levels as the crucial parameter able to determine different biological responses (22). In this study, a low/intermediate expression of the transgene was associated with increased self-renewal activity of HSCs, whereas a higher expression resulted in a remarkable inhibition of erythroid and megakaryocyte differentiation. Both the conditions led to increased numbers of macrophages and neutrophils. Although some of these findings could be simply explained in terms of species specificity of the biological actions promoted by the considered gene, the role exerted by Hox-A10 in the molecular regulation of hemopoiesis is, according to the previously cited literature data, quite controversial. To better characterize this role we constructed a bicistronic retroviral vector expressing a full-length Hox-A10 cDNA and a truncated version of low-affinity nerve growth factor receptor (⌬LNGFR) used as marker gene. The biological effects exerted by Hox-A10 on hemopoiesis were assessed, infecting the U937 monoblastic cell line initially and primary CD34⫹ hemopoietic cells subsequently. Modulation of gene transcription determined in these last cells by Hox-A10 overexpression was also evaluated by means of the microarray methodology. The results obtained clearly suggested that the analyzed transcription factor is an inducer of monocyte-macrophage differentiation at least partly acting through the up-regulation of the MafB gene, recently indicated as master regulator of such maturation pathway. Additional investigation based on computational analysis, EMSA experiments, and luciferase assays allowed the identification of a Hox-A10-binding site in the promoter region of MafB, providing a plausible molecular mechanism explaining the observed differentiation effect.

Materials and Methods Hemopoietic cell lines K562, KG1a, KG1, KASUMI1, HL60, NB4, THP1, and U937 cell lines were obtained from American Type Culture Collection and cultured in RPMI 1640 (Euroclone), supplemented with 10% heat-inactivated FBS (BioWhittaker) and 1 mM L-glutamine (Euroclone). Stimulation of U937

5661 Table I. Oligodeoxynucleotides used in RT-PCR reactions and in Hox-A10 cDNA cloninga Oligomers

Nucleotide Sequence (5⬘-3⬘)

HOXA10 DP HOXA10 RP MAFB DP MAFB RP2 CD11b DP CD11b RP CD163 DP CD163 RP IL-1␤ DP IL-1␤ RP IL7R DP IL7R RP CD115 DP CD115 RP p21 DP p21 RP GAPDH DP GAPDH RP

TCCCACAACAATGTCATGCTCGGAGAG ACCGCGTCGCCTGGAGATTCATCAG GCTCCGGCCGGCCGCAAAGTTTCCC GGCGGCGGCGACGCTTGGTGA GCTCATCGTGGGCAGCTCTC GCGACGGGAAGTCCCACTTCT GGAGCTGAGGCTAGTGGATG CCTTGATGTTTGCAGTTCCAG ATGGCAGAAGTACCTAAGCTCGC ACACAAATTGCATGGTGAAGTCAGTT ATGCACGATGTAGCTTACCGCCA TCTGGAGTGATGACTACATCCTC CAAGACAAACAGCCAGTGCAGA GCAGACAGGGCAGTAGTGCGT AGTTCCTTGTGGAGCCGGAGCTGGG TCCAGGACTGCAGGCTTCCTGTGGG GAAGGTGAAGGTCGGAGTC GAAGGCCATGCCAGTGAGCT

a Oligonucleotide primers were synthesized by MWG Biotech. All the synthesized oligomers were compared with the National Institutes of Health GenBank database through the BLAST software to avoid homologies with other gene sequences.

cells with VD was achieved by treatment with a 5 ⫻ 10⫺8 M concentration of this nuclear hormone (Hoffman-Laroche).

Primary hemopoietic cells Human CD34⫹ hemopoietic stem-progenitor cells were purified from umbilical cord blood samples as described (10, 23) and maintained in liquid culture for 2 wk. During the initial 5 days of culture, necessary for retroviral transduction, these cells were seeded at a 5–10 ⫻ 104/ml density in IMDM (Euroclone) containing 10% human serum (BioWhittaker) and early-acting human hemopoietic cytokines: 50 ng/ml stem cell factor and Flt3 ligand, 20 ng/ml thrombopoietin, 10 ng/ml IL-6 and IL-3 (R&D Systems). The subsequent phase of culture was accomplished under similar conditions without thrombopoietin and in the presence of 20% FBS. These experimental conditions normally promote a mixed granulomonocyte differentiation of CD34⫹ cells that is generally achieved within 14 days from plating (10, 24, 25). Treatment with VD was conducted with the same modalities of U937 cells. Myeloblasts, monoblasts, erythroblasts, and megakaryoblasts were generated by in vitro culture of cord blood CD34⫹ hemopoietic progenitors performed as already described (23, 25, 26). Normal human monocytes, neutrophils, and eosinophils were selected from Ficoll-separated PBMCs of adult samples and collected by immunomagnetic systems (8). Purity of isolated primary cell populations, determined by flow cytometry and morphological analysis (May-Gru¨nwald-Giemsa staining), always exceeded 95%.

Retroviral vector construction and packaging Construction of the LXI⌬N and LMafBI⌬N retroviral vectors have been already described (8). To obtained the LHoxA10I⌬N retroviral vector, a full-length Hox-A10 cDNA was generated by RT-PCR performed on total RNA extracted from U937 cells using Hox-A10 primers (Table I). PCR amplification was conducted using a proofreading thermostable DNA polymerase (Fast Start High Fidelity PCR System; Roche Diagnostics) and an annealing temperature of 60°C. The amplified fragment was then inserted in the pCR2.1 TOPO T/A cloning vector (Invitrogen) generating the pCR2.1HoxA10 plasmid, where it was fully sequenced to exclude polymerase-induced mutations. Hox-A10 cDNAs were then excised with EcoRI and cloned in the EcoRI site of LXI⌬N vector (27) resulting in the construction of LHoxA10I⌬N retroviral vector. Packaging lines for the described construct were generated by transinfection in the ecotropic Phoenix and amphotropic GP⫹envAm12 cells, as previously described (25). Viral titers were assessed by flow cytometry analysis of ⌬LNGFR expression percentage upon infection of U937 cells and CD34⫹ hemopoietic progenitors.

Hemopoietic cell transduction and NGFR purification U937 hemopoietic cell line was transduced by two to three cycles of infection (4 h each) with viral supernatant in the presence of polybrene (8

5662

MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY

␮g/ml). CD34⫹ hemopoietic progenitors, preactivated for 48 h in liquid culture, were transduced by two cycles of infection (12 h each) with viral supernatant on retronectin-coated plates (10 ␮g/cm2). NGFR purification of transduced cells was performed after a 48-h post-transduction incubation using a purified mouse anti-human p75NGFR mAb and tiny FACS-compatible magnetic nanoparticles in a column-free magnetic system (EasySep Do-It-Your Self Selection Kit; Stem Cells Technologies) following the manufacturer’s guidelines.

Flow cytometric, cytochemical, and morphological analysis of differentiated hemopoietic cells The extent of myeloid differentiation in transduced U937 and CD34⫹ cells was monitored by flow cytometric, cytochemical, and morphological analysis. Flow cytometry analysis of CD11b, CD14, and CD163 Ags was conducted as already described (8) using a Coulter Epics XL flow cytometer. Cytochemical evaluation of specific chloroacetate esterase was performed using the naphthol AS-D chloroacetate (specific esterase) kit (SigmaAldrich). Morphological analysis was accomplished on cytocentrifuged cell samples upon May-Gru¨nwald-Giemsa staining.

RNA purification, semiquantitative and quantitative RT-PCR Total RNA was extracted from the various analyzed cell populations by means of total RNA purification kits as recommended by the manufacturer (Qiagen). RNA integrity and concentration was then verified by the BioAnalyzer technique (Applied Biosystems). Semiquantitative RT-PCR analysis was performed as previously described (28), using oligonucleotide primers reported in Table I. Normalization of the amplified samples was obtained by the GAPDH housekeeping gene (10). Results of a representative experiment of three performed were presented in each corresponding figure. Quantitative real-time RT-PCR (QRT-PCR) was performed with an ABI PRISM 7900 sequence detection system (Applied Biosystems) as already described (8), amplifying GAPDH mRNA as endogenous control. Statistical analysis of the QRT-PCR results was obtained using the (2⫺⌬⌬Ct) method (29) which calculates relative changes in gene expression of the target gene normalized to the endogenous control and relative to a calibrator sample. QRT-PCR reactions were performed on three independent experiments and always presented as means ⫾ SEM.

Nuclear extract (NE) preparation and Western blot analysis NEs were conducted as previously described with minor modifications (10) and used either for gel shift experiments (see EMSA) or Western blot analysis. The latter was performed as follows. Briefly, 20 ␮g of NEs of the analyzed cell populations were loaded onto 10% SDS-PAGE and blotted as described (10). Membrane was preblocked in blocking solution, supplemented with 5% nonfat powdered milk (Roche Diagnostics) for 1 h at room temperature, and then incubated with a 1/200 dilution of goat polyclonal anti-Hox-A10 (Santa Cruz Biotechnology), followed by a 1-h incubation at room temperature with a secondary Ab anti-goat conjugated to HRP 1/3000 (Sigma-Aldrich). Expression of ␤-actin (Sigma-Aldrich) was also analyzed to normalize the amounts of NE loaded in the various lanes. Detection was conducted by using the BM chemiluminescence blotting substrate (Roche Diagnostics). Results of a representative experiments of three performed were presented in each corresponding figure.

EMSA The following single-strand oligomers and their complement, corresponding to putative Hox-A10-binding Hox response elements (HRE) 1 and 2, were used as probes in gel shift assay: HRE1 probe: 5⬘-GCACTTTAT GCCTG-3⬘ (spanning from ⫺943 bp to ⫺929 bp from transcriptional start site); HRE2 probe: 5⬘-TCTGCTTAATCGTTA-3⬘ (spanning from ⫺896 bp to ⫺881 from transcriptional start site). Complementary oligonucleotides were annealed and 5⬘ end labeled using [␥-32P]ATP (6000 Ci/mmol; GE Healthcare Europe) and T4 polynucleotide kinase (New England Biolabs) and purified with Microspin G-25 columns (GE Healthcare). The mobility shift reactions were conducted in gel shift buffer (10 mM Tris (pH 7.5), 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, 20% glycerol, 1 mM DTT) supplemented with 1 ␮g of polydeoxyinosinic-polydeoxycytidylic, 1.0 ⫻ 105 cpm of the indicated labeled probe, and 10 ␮g of NE, in a total volume of 20 ␮l. Supershift was obtained by adding, to the gel shift mix, an antiFlag Ab (Sigma-Aldrich). Binding reactions were incubated at room temperature for 30 min, resolved using a nondenaturing 4% polyacrylamide gel in 0.5⫻Tris-buffered EDTA, and prerun for 1 h at room temperature. Finally, the gel was fixed, vacuum dried, and exposed to x-ray films.

Plasmid expression vectors and cell transfection An overhang double-strand oligomer HRE1 probe, obtained by annealing single-strand oligonucleotides modified at the 5⬘ end with the BamHI and SalI restriction sites, was inserted into the BamHI/SalI-digested pT81Luc vector generating the pT81LucHRE1 plasmid. Nucleotide sequence analysis of this plasmid demonstrated that HRE1 site had been inserted as single-copy oligomer. Hox-A10 cDNA was excised with EcoRI from pCR2.1HoxA10 construct and then inserted in the EcoRI site of pcDNA3 vector (Invitrogen), obtaining the pcDNA3HoxA10 construct. The pCMVFlagHox-A10 plasmid, coding for a N-terminal Flag-tagged HoxA10 protein under the control of the CMV enhancer/promoter, was kindly provided by Prof. Fulvio Mavilio’s laboratory. HEK293T cells used in gel shift experiments were transiently transfected with 20 ␮g of the pCMVFlagHox-A10 vector using the calcium phosphate procedure. For luciferase assays, transient transfection of HEK293T cells was conducted in a 24-well plate with Lipofectamine 2000 (Invitrogen), using 200 ng of pT81LucHRE1 reporter plasmid, 50 ng of pcDNA3HoxA10 expression vector, 200 ng of pCMV␤-galactosidase (Clontech) to normalize for transfection efficiency, and a carrier plasmid to maintain a total DNA concentration of 800 ng. Mock-transfected HEK293T cells were used as control.

Reporter gene assay Forty-eight hours after transfection, cells were washed twice in cold 1⫻ PBS, resuspended in lysis buffer (1% Triton X-100, 25 mM glycylglycine (pH 7.8), 15 mM MgSO4, 4 mM EDTA (pH 8), 1 mM DTT), and assayed for ␤-galactosidase and luciferase expression. Luciferase measurements were performed using a Lumat LB 9501 (Berthold) luminometer. Each transfection was done in duplicate in the same experiment and luciferase activities were represented as the mean ⫾ SEM values of three independent experiments.

Biotin-labeled transcription, GeneChip hybridization, and microarray data analysis RNA pools (100 ng) of LXI⌬N- and LHoxA10I⌬N-transduced CD34⫹ cells, obtained from three independent experiments, were converted in labeled cRNA according to the two-cycle protocol advised by Affymetrix. cRNA has been used to hybridize Affymetrix HG-U133A GeneChip arrays as already described (23). Images obtained by scanning chips of untransduced and LXI⌬N- and LHoxA10I⌬N-transduced CD34⫹ cells were processed using GeneChip operating software. This software allows assignment of a detection (absent or present), to quantify mRNA expression levels in terms of a signal value and to attribute a change, increased, decreased, or not changed to each transcript when comparing two analyzed cell populations. Changes in the expression levels of the analyzed mRNAs, observed comparing the considered sample (LHoxA10I⌬N-transduced cells) to the baseline (LXI⌬N-transduced cells), were then expressed as signal log ratio (SLR; fold change, 2SLR). The transcripts showing change equal to increased, SLR ⱖ1, signal ⱖ100, and detection present were selected as increased; on the contrary, the transcripts showing change equal to decreased, SLR ⱕ⫺1 and, in the baseline sample, signal ⱖ100 and detection present were selected as decreased. To identify similarities between gene expression profiles of Hox-A10transduced CD34⫹ progenitors and the transcriptome of other myeloid cells, we analyzed a wider dataset including data previously obtained in our laboratory (30) and concerning hemopoietic CD34⫹ stem/progenitors, in vitro-differentiated precursors, HoxA-10- or MafB-transduced CD34⫹ cells. Gene expression data were scaled to target intensity 150 using GeneChip operating software (Affymetrix). Gene expression profiles were then analyzed using GeneSpring GX software version 7.3 (Agilent); per chip and per gene normalization were achieved, respectively, dividing each signal by the median of signals across the chip and the median of its values across samples. To remove genes that are not expressed or always expressed at low levels, normalized data were filtered using GeneSpring to select transcripts detected as present according to MAS 5.0 absolute analysis algorithm in at least 10% of samples. Then genes, the normalized expression levels of which were always between 0.5 and 2 across all of the samples, were filtered out. The gene list generated was used to perform unsupervised hierarchical clustering analysis, using Pearson correlation as a similarity measure and average linkage. Supervised analysis was subsequently conducted to select genes differentially expressed among CD34⫹ cells and myeloid precursors. With the use of GeneSpring GX software, data were further filtered to select genes with 2-fold change difference between CD34⫹ and at least one of the precursor cells contexts. The selected gene list was then analyzed performing a one-way ANOVA


FIGURE 1. Hox-A10 expression in normal hemopoietic cell populations and in leukemic cell lines. a, Microarray analysis results showing the levels of Hox-A10 expression in primary hemopoietic cell contexts: normal cord blood CD34⫹ stem/progenitor cells; CD34⫹-derived erythroblasts, megakaryoblasts, myeloblasts, and monoblasts; and adult peripheral blood monocytes, neutrophils, and eosinophils. x-axis, Sample populations; yaxis, signals of Hox-A10 expression levels. b, Expression levels of Hox-A10 mRNA in hemopoietic cell lines, having different phenotypes, were assessed by semiquantitative RT-PCR analysis. GAPDH mRNA was also amplified to normalize RNA amounts of the different analyzed samples. Agarose gels stained with ethidium bromide are shown. The size of amplified gene fragments is reported on the right of each panel.

between the myeloid cell contexts (CD34⫹ and precursor cells) to identify differentially expressed genes: 1009 transcripts were selected applying Benjamini and Hochberg multiple testing correction and p value cutoff of 0.01. Data concerning these genes were used for per gene and per chip hierarchical clustering analysis based on Pearson correlation and average linkage method. Expression profiles of cell populations used for this analysis were retrieved from the publicly available www.xlab.unimo.it/XLab/ExpDataView.php.

Results Endogenous expression of Hox-A10 gene in hemopoietic cells To define the appropriate cell context in which the effect exerted by Hox-A10 in the commitment/differentiation process could be investigated, we analyzed the endogenous expression of this Hox gene in primary cells and cell lines of the hemopoietic system. Microarray data obtained in our laboratory using primary hemopoietic cells evidenced that Hox-A10 mRNA is expressed in CD34⫹ stem/progenitor cells, in myeloblasts, in monoblasts, and to a lesser extent in megakaryoblasts, whereas it is completely absent in erythroblasts and in terminally differentiated cells, such as granulocytes and monocytes (Fig. 1a). Accordingly, semiquantitative RT-PCR analysis, performed in hemopoietic cell lines, revealed that Hox-A10 is selectively expressed in early myeloblastic (KG1a, KG1) and monoblastic cell lines (Kasumi1, THP1, U937; Fig. 1b). These data globally suggest that Hox-A10 expression is restricted to the myeloid progenitor/precursor compartment of hemopoiesis.

5663

FIGURE 2. Expression of Hox-A10 mRNA and protein in retrovirally transduced and in VD-treated U937 cells. a, Schematic map of the LHoxA10I⌬N retroviral vector used to infect U937 cells. In this vector, the viral long terminal repeat (LTR) drives the expression of a bicistronic transcript containing Hox-A10 cDNA and the ⌬LNGFR marker gene inserted downstream of an internal ribosome entry site (IRES) sequence. Arrow, transcription start site; SD, splice donor; ␺, packaging signal; SA, splice acceptor; A(n), polyadenylation site. b, RT-PCR analysis of HoxA10 mRNA expression performed 7 days after infection in transduced and NGFR-purified U937 cells. Western blot analysis of Hox-A10 protein expression was performed 7 days postinfection on nuclear extracts of transduced/NGR-purified (c) and VD-treated (d) U937 cells. In b and c, U937 cells infected with the empty vector (LXI⌬N) were used as control. The size of the detected protein is reported on the right; the analyzed samples are described at the top of each panel. Expression of ␤-actin was also analyzed to normalize the amounts of nuclear extract loaded in the various lanes.

Biological effects promoted by retroviral Hox-A10 transduction in U937 cells On the basis of data described thus far, we initially overexpressed Hox-A10 cDNA in the U937 hemopoietic cell line, due to its monoblastic phenotype and responsivity to compounds inducing monocyte-macrophage differentiation. For this purpose, we constructed the LHoxA10I⌬N retroviral vector expressing a Hox-A10 full-length cDNA and a truncated version of ⌬LNGFR, used as marker gene, in the context of a bicistronic transcript driven by the viral long terminal repeat (Fig. 2a). Biological effects promoted by Hox-A10 overexpression were always assessed by comparison with the LXI⌬N retroviral vector (empty vector), containing only the marker gene, and all assays necessary to monitor such effects were conducted on cells transduced with the mentioned vectors and purified for NGFR expression. RT-PCR and Western blot analysis performed on transduced U937 cells evidenced that the retroviral transcript was regularly produced (Fig. 2b), and expression of the transgene at the protein level was comparable with that obtained upon VD stimulation, as demonstrated by densitometric analysis showing respectively a 5.1- and 3.3-fold increase over the corresponding controls, i.e., “empty” vector for Hox-A10-transduced cells and untreated cells for VD stimulation, respectively (Fig. 2, c, lanes 1 and 2, and d, lanes 1 and 3). A preliminary assessment of Hox-A10 differentiation capacity was performed by flow cytometry analysis evidencing, in cells transduced with this transcription factor, a gradual increase of

5664

MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY moglobin-aptoglobin complex, the CD115 Ag, receptor for the MCSF, the IL-1␤ and IL-7R, previously detected at high levels in monocyte precursors (23), the MafB transcription factors (8) and the p21waf-1 growth arrest gene (Fig. 3c). Among the others, the induced expression of MafB appeared of particular interest due to the crucial role that this transcription factor plays in the molecular control of monocyte differentiation. In this regard it is worth underlining that QRT-PCR, performed on the same cell samples, confirmed this finding evidencing a 3.9 ⫾ 0.2 (mean ⫾ SEM) increase of MafB mRNA levels. Cell counts demonstrated that the induction of monocyte differentiation observed in Hox-A10-transduced cells was accompanied by a reduced proliferation activity given that the number of expansions in these cells averaged 6.9 vs 13.8 of control cells transduced with the empty vector (Fig. 3d). This observation was in agreement with the up-regulated expression of the p21waf-1 gene detected in Hox-A10-transduced cells (Fig. 3c). These results substantially confirm previous studies indicating that retroviral transduction of Hox-A10 induces the monocyte differentiation of U937 cells. At the same time, they allowed us to sensibly enrich the list of monocyte-related genes up-regulated in this cell context by transduction with the analyzed transcription factor. Differentiation effect observed in human CD34⫹ hemopoietic progenitors upon retroviral Hox-A10 transduction

FIGURE 3. Differentiation effect promoted by Hox-A10 transduction in U937 cells. a, Histogram reporting the results of flow cytometry analysis of the myeloid related CD11b Ag, measured as positivity percentage, in HoxA10 (f) and empty vector (u)-transduced U937 cells. x-axis, Days posttransduction. y-axis, mean ⫾ SEM. b, Morphological analysis performed 14 days postinfection on empty vector and Hox-A10-transduced/NGFR purified U937 cells. c, Semiquantitative RT-PCR analysis of a distinct panel of myeloid-related genes conducted under the same experimental conditions. Agarose gels stained with ethidium bromide are presented. Top, Analyzed cell populations; sides, investigated genes. Normalization of amplified RNA amounts was achieved by the GAPDH housekeeping gene. d, Histogram showing cell counts obtained in U937 cells transduced with empty vector (LXI⌬N; 䡺) and Hox-A10 (LHox-A10I⌬N; E). x-axis, Days post-transduction. y-axis, mean ⫾ SEM obtained from three independent experiments.

CD11b expression that reached 33.8 ⫾ 0.5% positivity (mean ⫾ SEM) at day 7 post-infection (Fig. 3a), and by morphological analysis indicating that these cells assumed a pro-monocytic phenotype (Fig. 3b). To provide additional evidence of such capacity, we also investigated, by means of semiquantitative RT-PCR, the induction at the mRNA level of a number of myeloid differentiation markers selected on the basis of expression profiling data previously obtained in our laboratory (8, 23). Beside the already mentioned CD11b Ag, these reactions also disclosed the up-regulation of other monocyterelated genes, such as the CD163 Ag, scavenger receptor for he-

To confirm these data in a primary cell model, the retroviral vectors described thus far were used to transduce cord blood CD34⫹ hemopoietic stem/progenitor cells expanded in liquid culture (see Materials and Methods for details). The experimental plan adopted for these cells included a 48-h pre-activation period, a 24-h transduction conducted by two cycles of infection (12 h each), and a further 48-h post-transduction incubation that was immediately followed by NGFR purification. Myeloid differentiation was then monitored on transduced/NGFR-purified cells by a combination of immunophenotypic, cytochemical, and morphological analysis that were performed at day 14 of liquid culture. Transgene dosage analysis, performed in these cells by QRTPCR, indicated that Hox-A10 mRNA was 25 ⫾ 4 (mean ⫾ SEM) times more expressed in Hox-A10-transduced CD34⫹ cells as compared with VD-stimulated CD34⫹ cells, i.e., the biological sample used in our experimental system as control for endogenous Hox-A10 expression. Although this result is in apparent contrast with that observed in U937 cells, it is substantially the consequence of a different basal mRNA endogenous levels of Hox-A10, which is remarkably higher in hemopoietic cell lines (including U937) as compared with primary hemopoietic cells (Ref. 15 and data not shown). In addition, by using a sophisticated transgenic mouse model allowing an inducible expression of Hox-A10 in vivo, Magnusson et al. (22) have recently demonstrated that the monocytopoietic effect driven by this transcription factor is observed in a wide range of transgene expression levels up to ⬃500fold higher than endogenous controls. Flow cytometry analysis of Hox-A10-transduced cells revealed an evident up-regulation of several monocyte specific surface markers such as the CD14 and CD163 Ags. In a representative experiment, reported in Fig. 4a, CD14 Ag reached a 44.4% positivity in Hox-A10-transduced cells vs 23.5% of control cells infected with the empty vector. Similarly, these values appeared to be, respectively, 52.9 and 26.6% for the CD163 Ag (Fig. 4a). The up-regulated expression of these surface Ags was also observed on mean fluorescence intensities varying from 20.7 to 44.6 for CD14 and from 4.9 to 10.7 for CD163 (Fig. 4a).


5665 Morphological analysis, performed on cytological specimens upon May-Gru¨nwald-Giemsa staining, confirmed the results of previous assays evidencing an enrichment of neutrophils and their immediate precursors in control cells and a clear increase of monocytes and macrophages among Hox-A10-transduced cells (Fig. 4c). Our phenotypic analysis consequently indicates that the induction of monocyte differentiation observed in Hox-A10-transduced CD34⫹ cells is accompanied by a parallel and remarkable inhibition of granulocyte differentiation. Gene expression profiling of Hox-A10-transduced CD34⫹ hemopoietic progenitors

FIGURE 4. Analysis of myeloid differentiation in Hox-A10-transduced CD34⫹ cells. Representative experiment showing the results of flow cytometry, cytochemical and morphological analysis performed at day 14 of liquid culture in CD34⫹ cells transduced with the empty vector (LXI⌬N, left) and with the Hox-A10 transcription factor (LHox-A10I⌬N, right). a, Flow cytometry analysis of CD14 (top) and CD163 (bottom) Ag expression. Entities of surface Ag expression are shown inside the histograms in terms of positivity percentage and mean fluorescence intensity (MFI). b, Cytochemical analysis of naphthol AS-D chloroacetate-specific esterase; c, morphological analysis, performed on May-Gru¨nwald-Giemsa staining, on cytocentrifuged specimens.

The effect that Hox-A10 overexpression was able to exert on granulocyte differentiation was assessed by cytochemical analysis of the chloroacetate-specific esterase. By using this assay, activity of the studied enzyme, indicated as mean ⫾ SEM, was detected in 52 ⫾ 5% of controls cells and only 8 ⫾ 2% of Hox-A10-transduced cells (Fig. 4b). Again, the decrease of positivity percentage was coupled with a reduced staining score on single-reacting cells (Fig. 4b).

To characterize the genetic program underlying the observed differentiation capacity, we analyzed transcriptome changes induced by retroviral transduction of Hox-A10 in CD34⫹ hemopoietic progenitors using the Affymetrix microarray methodology. The expression profile determined in this cell background by Hox-A10 overexpression was, again, desumed by comparison with control cells infected with the empty vector. All of the data have been deposited in the Gene Expression Omnibus MIAME-compliant public database at http://www.ncbi.nlm.nih.gov/geo and are accessible through GEO Series accession number GSE12396. Microarray analysis was conducted at the end of the transduction/NGFR purification procedure (day 5 of liquid culture), therefore under experimental conditions in which the stem/progenitor phenotype of analyzed cells was substantially maintained, as evidenced by the 70 – 80% positivity of CD34 Ag (data not shown). This experimental design allowed performance of mRNA expression profiling in the differentiation window in which, standing on our data, endogenous Hox-A10 is preferentially expressed. The results of this analysis disclosed the up-regulation of 167 genes and the down-regulation of 64 genes (SLR ⱖ⫹ 1 and ⱕ⫺1, respectively). Detailed analysis of the obtained expression profiles indicated that the majority of up-regulated genes could be classified into the following functional categories: CD Ags; degradation enzymes; secretory proteins; surface receptors; cell cycle/apoptosis regulators; and transcription factors. In agreement with flow cytometry data, Hox-A10 transduction leaded to an increased mRNA expression of the CD14 and CD11b monocyte-related markers. More in general, virtually all up-regulated CD Ags have been previously detected on the monocyte/ macrophage surface where they mediate a variety of biological functions related to innate and specific immunity and particularly: cell adhesion and migration (CD9, CD11b, CD24, CD39, CD44, CD54, CD87); recognition and scavenging of inflammatory molecules (CD14 and CD163); and Ag presentation and activation of T cell-mediated immune responses (CD1a– e, CD83, CD85D) (Fig. 5). For a detailed description regarding expression pattern and biological functions of the above-mentioned CD Ags, see www.ncbi.nlm.nih.gov/prow. Consistent with these findings, Hox-A10-transduced CD34⫹ cells also showed an increased expression of genes coding for proteins mediating degradation processes related to monocytemacrophage activation and inflammation response. Among them we detected: 1) granule proteins, such as cathepsins (CTSB, CTSG, CTSL; Refs. 31–33), CPVL (34), and RNase 1 (33) all involved in intracellular Ag degradation; 2) STX 12, a protein that, together with STX 7, is responsible for fusion of endosomes and lysosomes with the phagosome, i.e., the intracellular compartment where phagocytic cells kill and degrade internalized foreign particles (35); 3) MMP9 and MMP12, responsible for the remodeling of extracellular matrix that is necessary for cell migration (36); 4) other enzymes such as PTGS2, catalyzing the first rate-limiting step in the conversion of arachidonic acid to prostaglandins (37),

5666

MafB IS A TARGET GENE OF VD/Hox-A10 SIGNALING PATHWAY PLA2G7, encoding for platelet activating factor acetylhydrolase (38), and HMOX1, involved in the cytoprotection against inflammation induced oxidative stress (39) (Fig. 5). Analyzing the secretory proteins and surface receptors categories, we could detect a number of up-regulated genes that are known to play a role in other aspects of innate immunity. In particular, inside the former we observed inflammatory cytokines (Ref. 40; IL-1␤, IL-8, TGF␤1) and molecules exerting a chemoattractant activity on monocytes/macrophages (chemokines, described in Ref. 41; galectin-3, described in Ref. 42), whereas the latter disclosed the presence of receptors involved in chemokine/ cytokine signaling (CCR5, described in Refs. 43 and 44; IL-1R1 and IL-1R2, described in Ref. 45), recognition and scavenging of bacterial products (TLR2, described in Ref. 46; MRC1, described in Ref. 47), and activation of monocytes (IFNGR, TNFRSF21, TREM1, IL1RN, all described in Ref. 33) (Fig. 5). The majority of transcription factors exhibiting an up-regulated expression in Hox-A10-transduced CD34⫹ cells have been already implicated in monocyte-macrophage differentiation. In fact: 1) the Hox-A9 gene, localized upstream of the Hox-A10 gene on chromosome 7 (13), has been involved in the molecular pathogenesis of a subset of acute myeloid leukemias (48 –50); 2) endogenous expression of MafB and MafF is remarkably induced during monocyte-macrophage differentiation of CD34⫹ hemopoietic progenitors (23) and viral transduction of these cells with a MafB cDNA induces a massive commitment toward the macrophage lineage (8); 3) c-jun determines a partial monocyte differentiation when transfected into hemopoietic cell lines (51) and is a recognized dimerization partner of Maf family proteins (52, 53); 4) expression of KLF4 (54), STAT4 (55), and NR4A2 (56) is normally induced in macrophages in response to inflammation stimuli. Analysis of cell cycle regulators revealed an increased mRNA expression of the GADD45B (57), CFLAR (57), BTG1 (58), and DUSP2 (59) growth arrest/proapoptotic gene and a clear downregulation of universally recognized proliferation markers as the c-myc proto-oncogene (60) and cyclin A1 (CCNA1; Ref. 61) (Fig. 5). Down-regulated genes included a remarkable number of markers belonging to nonmonocytic differentiation lineages. Among them, we observed transcription factors (KLF1, GATA2, and NFE2), globin chains (␣, ␤, ␥), and surface Ags (glycophorin C), associated with erythroid differentiation (62, 63) and granule proteins related to neutrophil (ELA2B, RNase 2, CLC, PRG2, MPO; Ref. 64), eosinophil (EPX; Ref. 65) and basophil maturation (HDC; Refs. 66 and 67) (Fig. 5). These results are consistent with the biological effects observed in CD34⫹ cells upon retroviral transduction with Hox-A10 (see previous paragraph). More importantly, they confirm in a primary hemopoietic cell context our observation, previously obtained in U937 cells, indicating a capacity of the investigated transcription factor to up-regulate MafB expression. Similarly to the U937 cells, this finding was validated by QRT-PCR showing a 2.7 ⫾ 0.3 induction of MafB mRNA levels following Hox-A10 transduction of CD34⫹ cells. Altogether these data raise the possibility that MafB might be a direct target gene of Hox-A10.

FIGURE 5. Gene expression profile induced by Hox-A10 transduction in CD34⫹ hemopoietic stem/progenitor cells. Microarray analysis was performed at day 5 of liquid culture on CD34⫹ cells transduced with the LXI⌬N and with the LHoxA10I⌬N retroviral vectors and subsequently purified for NGFR expression. Changes in gene expression were assessed by comparison between cells transduced with the two analyzed vectors and reported on the x-axis of the shown histogram as SLR (fold change, 2SLR). Up- and down-regulated genes (SLR ⱖ ⫹ 1 and ⱕ-1, respectively) were

classified in the following functional categories: CD Ags (light blue bars)-; degradation enzyme (purple bars)-; secretory proteins (black bars)-; surface receptors (green bars)-; transcription factors (blue bars)-; cell cycle-related genes (gray bars)-; erythroid (red bars)-; and granulocyte (yellow bars)associated genes. A list of selected mRNA induced by Hox-A10 is presented and indicated by gene symbols (complete/extended designation and description of each gene is available in the OMIM website). See Materials and Methods for details.


5667

Clustering analysis on expression profiles of human primary hemopoietic cells under different experimental conditions As already underlined in Introduction, it is to date still controversial whether Hox-A10 is implicated in hemopoietic stem and progenitor expansion or in the differentiation of specific hemopoietic lineages. To clarify this issue and to better understand the relationship existing between genetic programs activated by HoxA10 and MafB upon transduction of CD34⫹ cells, we used GeneSpring software to perform a supervised hierarchical clustering analysis in which the expression profiles of such cell populations were compared with those of fresh CD34⫹ cells and CD34⫹-derived normal monoblasts, myeloblasts, erythroblasts, and megakaryocytes. These samples were analyzed using a probe list containing all genes exhibiting a differential expression in the comparison among the CD34⫹ cells and the already-mentioned hemopoietic precursor populations. Results of this analysis, reported in Fig. 6 as Eisen map, allowed to distinguish several classes of samples corresponding to the various analyzed cell types. Examination of the condition tree and gene tree indicated that, as expected, MafB- and Hox-A10-transduced CD34⫹ cells clusterized with the monoblast cell populations (Fig. 6). Unsupervised hierarchical clustering analysis, performed on all expressed genes, confirmed this observation (data not shown). These data provided additional evidence supporting the involvement of Hox-A10 in the molecular control of monocyte-macrophage differentiation. Identification of a Hox-A10-binding site in the promoter region of MafB gene Molecular analysis of U937 and CD34⫹ cells transduced with HoxA10 clearly indicated MafB as a possible direct target gene of the analyzed transcription factor. To verify this hypothesis, we assessed the extent of interspecies conservation in the 5⬘-flanking region of MafB gene using the UCSC Genome Browser (68). This preliminary analysis was based on the principle that sequence conservation frequently discloses the presence of relevant transcription regulatory elements. The results obtained revealed that the highest degree of conservation is observed in the region spanning from the ⫺1000 to the ⫹1 nt, whereas sequence similarity exhibits a gradual decrease up to the ⫺2000 nt and a substantial drop further upstream (Fig. 7a). For this reason, we focused our attention on the 1-kb region placed immediately upstream the transcription start site of the MafB gene. The presence of Hox-binding sites within this region was then investigated by a computational search of the TAAT and TTAT core motifs. This approach resulted in the identification of two putative binding sites for Hox-A10, conventionally named HRE1 and -2, placed, respectively, at position ⫺934 and ⫺886 nt inside highly conserved genomic regions (Fig. 7b). The capacity of Hox-A10 protein to bind these elements was assessed by means of EMSA experiments for which we used NEs of U937 cells under different treatment conditions and 14mer double-strand oligonucleotide probes encompassing the two putative sites. Results of this assay, presented in Fig. 8a, showed that incubation of NE obtained from VD-treated or Hox-A10-transduced U937 cells with HRE1 oligonucleotide probe generated an evident shift complex (Fig. 8, lanes 2 and 4) that was not observed using NE of untreated or empty vectortransduced U937 cells (Fig. 8, lanes 1 and 3). This complex was on the contrary undetectable when EMSA was performed with HRE2 oligonucleotide probe (not shown). To further characterize the specificity of the shift complex observed with HRE1 oligonucleotide probe, we optimized a supershift assay per-

FIGURE 6. Hierarchical clustering analysis performed on expression profiles of human primary hemopoietic cells under different experimental conditions. Supervised clustering analysis was performed comparing the gene expression profile of Hox-A10- and MafB-transduced CD34⫹ cells with a probe list containing all genes that are differentially expressed in the differentiation transition of CD34⫹ cells to hemopoietic precursors (myeloblasts, monoblasts, erythroblasts, and megakaryoblasts). Results are presented as an Eisen map. Analyzed cell populations are reported on the bottom and are discriminated by a color bar. Top, Condition tree; left ordinate, gene tree.

formed using NE of HEK293T cells transiently transfected with the pCMVFlagHox-A10 plasmid expression vector, coding for a Flag-tagged version of Hox-A10 protein. Under these experimental conditions, we were able to reproduce the shift complex formed with HRE1 oligonucleotide probe (Fig. 8a, lane 3, bottom arrow). Incubation of the same sample with an anti-Flag Ab resulted in a mixed pattern of competition and supershift (Fig. 8a, lane 4, top arrow), indicating that the observed shift complex actually contains Hox-A10 protein. To verify the capacity of the identified Hox-A10-binding site to activate gene transcription, the HRE1 oligonucleotide probe was

5668


FIGURE 7. Computational analysis of the promoter region of human MafB gene. a, Alignment and conservation diagram reporting the interspecies comparison of the human MafB genomic sequence spanning from ⫺2000 bp upstream to ⫹3378 bp downstream to the transcriptional start site (chromosome 20: 38749500-38752500). The highest density of interspecies conservation is indicated by histograms and the alignment net. ⴱ, Position of the two putative Hox-A10 binding sites. b, Top, Schematic representation of the 1000 bp upstream of the transcription start site of MafB genomic region. By computational analysis, two different putative Hox-A10-binding sites (HRE1 and -2, f) were identified within the analyzed genomic region. Middle, Interspecies conservation of these sites. e, Hox-A10-binding site cores. Bottom, Nucleotide sequences of Hox-A10 putative recognition sites on the complementary strand are reported. X_ tropicalis, Xenopus tropicalis.

cloned in the pT81Luc plasmid, where it was placed upstream a minimal promoter and the luciferase reporter gene, obtaining the pT81LucHRE1 construct. This vector was then transiently transfected in HEK293T cells together with the pcDNA3Hox-A10 plasmid, coding for wild-type Hox-A10 protein, to perform a set of transactivation assays based on the luciferase reporter system. The results of these experiments clearly demonstrated that the analyzed element was able to determine a 3.6-fold activation of the reporter gene in the presence of the required Hox-A10 transcription factor (Fig. 8c). Based on our bioinformatic analysis, EMSA experiments and transactivation assays, it is therefore possible to state that the MafB gene is a direct target of Hox-A10 transcription activity. Activation of Hox-A10 and MafB expression in response to VD stimulation of CD34⫹ hemopoietic stem progenitor cells The observation that Hox-A10 is a VD target gene has been, to date, exclusively obtained in cell lines and never verified on primary normal cell populations, especially those belonging to the hemopoietic system. On the basis of this consideration and data presented thus far, we performed a set of time course experiments in which CD34⫹ hemopoietic progenitors was stimulated with VD for 72 h and then the mRNA levels of the Hox-A10 and MafB genes were estimated by QRT-PCR at various treatment times. As reported in Fig. 9a (top), exposure of CD34⫹ hemopoietic progenitors to the mentioned nuclear hormone gave rise to a rapid and tran-

FIGURE 8. EMSA and luciferase assays performed to validate the identified putative Hox-A10-binding sites. a, Left, results of EMSA analysis performed on nuclear extracts obtained from untreated, VD-treated, empty vector-transduced (LXI⌬N), and Hox-A10-transduced (LHox-A10I⌬N) and NGFR-purified U937 cells. Based on the experiment presented in Fig. 2, VD treatment was conducted for 24 h. The assay was performed by using [␥-32P]ATP-labeled HRE1 probe. Arrow, Hox-A10 gel shift complex. Right, results of EMSA analysis conducted on nuclear extracts of mock-transfected (Mock) and pCMVFlagHoxA10-transfected HEK293T cells. The specificity of the Hox-A10 complex was confirmed by incubation with an anti-Flag Ab, generating a supershift complex (upper arrow). b, Histogram reporting the results of luciferase assays performed in HEK293T cells transfected with the pT81LucHRE1 reporter plasmid and pcDNA3HoxA10 plasmid expression vector. x-axis, Combinations of transfected plasmids. y-axis, Luciferase activity reported as ␤-galactosidase normalized value. Bars represent the mean luciferase activity ⫾ SEM of three independent experiments.

sitory increase of Hox-A10 mRNA peaking at 24 h of treatment. The entity of the observed up-regulation, reported as mean ⫾ SEM value, was 3.7 ⫾ 0.5. Consistent with this result, MafB mRNA underwent a 2.6 ⫾ 0.4 (mean ⫾ SEM) increase that was detected at a later time (72 h; Fig. 9a, middle). CD14 mRNA levels, analyzed as control, exhibited the expected increase over time that reached a 21 ⫾ 2.4 (mean ⫾ SEM) value at 72 h of treatment (Fig. 9a, bottom). Data obtained by this quantitative analysis of endogenous Hox-A10 and MafB expression in response to VD treatment is therefore consistent with the existence of a transactivation cascade involving sequentially VDR, Hox-A10, and MafB transcription factors during the induction of monocyte-macrophage commitment.


5669

FIGURE 9. Comparative analysis of the monocyte differentiation effect determined in CD34⫹ hemopoietic stem/progenitor cells by VD stimulation and by retroviral transduction with the Hox-A10 and MafB transcription factors. a, Time course experiment performed to estimate, by QRT-PCR, Hox-A10 (top), MafB (middle) and CD14 (bottom) mRNA levels in CD34⫹ cells stimulated with VD. x-axis, Analyzed times; y-axis, mRNA levels shown as mean ⫾ SEM RQ values deriving from three independent experiments. b, Histogram reporting the results of flow cytometry analysis of CD14 and CD163 Ag expression in CD34⫹ cells stimulated with VD and retrovirally transduced with MafB (LMafBI⌬N) and with Hox-A10 (LHox-A10I⌬N). VD treatment was performed on cells transduced with the empty vector (LXI⌬N). x-axis, Analyzed samples. y-axis Results presented as mean ⫾ SEM values obtained from three independent experiments. c, Histogram summarizing cell counts obtained on CD34⫹ cells under the same treatment conditions described in b. Cells transduced with the empty vector, treated with VD, and transduced with Hox-A10 and MafB are described in the figure key. y-axis, Measured cellularities reported as mean ⫾ SEM values obtained from three independent experiments. Days of culture are indicated on x-axis. Day 0 of comparative cell counts corresponds to day 5 of liquid culture.

Direct comparison of the monocyte-macrophage differentiation effect determined by VD stimulation and Hox-A10 or MafB retroviral transduction of CD34⫹ hemopoietic progenitors Although the biological effects exerted on CD34⫹ hemopoietic progenitors by VD stimulation and Hox-A10 or MafB transduction have been already studied in previous reports, we decided to perform a number of similar experiments to obtain a direct comparison among all these monocyte differentiation inducers and to provide a more accurate estimation of their relative efficiency. As control for these experiments we used empty vector-transduced/ VD-untreated cells. Flow cytometry analysis, performed on the various samples at day 14 of liquid culture, evidenced an ⬃4-fold increase of CD14 positivity in Hox-A10- and MafB-transduced CD34⫹ cells and a ⬃3-fold induction of the same Ag in VD-stimulated CD34⫹ cells (Fig. 9b). The CD163 Ag exhibited a similar trend even if with less pronounced variations of expression (Fig. 9b). These data substantially indicate that treatment of CD34⫹ cells with the analyzed inducers results in comparable differentiation effects. In this regard, the weaker effect promoted by VD is not surprising in light of the different nature of the compared stimuli, i.e., hormone stimulation in one case and retroviral transduction in the other two.

Cell counts showed that, although all samples underwent a certain degree of proliferative expansions, the three analyzed stimuli determined an about double reduction of cellularity in comparison with control cells at day 14 of liquid culture (day 9 post-transduction-NGFR purification; Fig. 9c). This result confirms the proliferation inhibitory activity of Hox-A10 already observed in U937 cells.

Discussion A significant number of reports have demonstrated the role played by Hox genes in the molecular control of self-renewal and differentiation of hemopoietic stem/progenitor cells. These observations are substantially based on endogenous expression studies and viral vector mediated overexpression experiments (14). Since the middle of the 1990s, the former approach has led to the evidence that, among Hox genes, Hox-A10 exhibited the highest specificity of expression pattern. In fact, in normal cell populations, its transcript was detected in CD34⫹ progenitors but not in terminally differentiated neutrophils and monocytes; and in neoplastic tissues (fresh leukemic populations and cell lines) Hox-A10 expression appeared to be restricted to the myeloblast-monoblast cell contexts (15). Although these last findings had not been verified on normal

5670


hemopoietic precursors, data reported thus far globally indicated a myeloid-restricted and differentiation stage-related expression of Hox-A10, suggesting a role in the regulation of myeloid commitment. Overexpression experiments, performed in subsequent years, gave rise to contradictory results since they evidenced, in some cases, a role in stem cell maintenance (20) and myeloid progenitor expansion (19) whereas, in others, a remarkable differentiation activity (16, 18). In addition, the precise maturation lineage affected by the latter effect varied significantly among the different studies, allowing one to conclude that the exact function of Hox-A10 inside the hemopoietic system is still unclear. The considered species (murine or human) also appeared as a crucial factor, able to deeply influence the nature and entity of observed effects. The aim of the experimental work performed in our laboratory was to clarify the controversy focusing the attention on human models of hemopoiesis. For this purpose, we analyzed endogenous Hox-A10 mRNA expression in a number of hemopoietic cells of human origin and transduced the U937 monoblastic cell line and cord blood CD34⫹ hemopoietic stem/progenitor cells with a retroviral vector expressing full-length Hox-A10 cDNA and the ⌬LNGFR marker gene. Semiquantitative RT-PCR analysis showed that, as expected, Hox-A10 mRNA expression is restricted to cell lines having a myeloblastic or monoblastic phenotype. Consistently, microarray analysis performed on eight normal primary hemopoietic cell populations at different maturation levels (progenitors, precursors, terminally differentiated cells) evidenced that Hox-A10 is expressed in CD34⫹ cells, in myeloblasts and in monoblasts, whereas it is low or not expressed in other precursor contexts or in more mature cells. These data, for the first time including a complete analysis on normal hemopoietic precursors, substantially confirmed previous studies, defining the existence of a precise differentiation window for endogenous Hox-A10 expression, spanning from CD34⫹ progenitors to myeloid precursors (myeloblasts and monoblasts). Under the experimental conditions used in our laboratory, retroviral vector-mediated expression of Hox-A10 led to a massive induction of monocyte-macrophage differentiation, observed in both the analyzed cell types (U937 and CD34⫹ cells) and accompanied by an evident inhibition of proliferation activity. Although these results represent a confirmation of the data published by the Freedman (16) and Leclercq (18) groups, respectively, the differentiation effect was corroborated, in our study, by the up-regulation of a broader panel of monocytemacrophage-related genes assessed, in U937 cells, by RT-PCR analysis and, in CD34⫹ cells, by microarray analysis conducted using Affymetrix methodology. Among them, we were able to identify the MafB transcription factor, previously described as the master regulator of monocyte-macrophage commitment (8); this observation was also confirmed by means of the QRT-PCR reaction. Computational analysis, subsequently validated by gel shift experiments and by transactivation assays, demonstrated that MafB is a direct target of the Hox-A10 transcription factor. This finding suggests a plausible molecular mechanism explaining the biological effects promoted by Hox-A10 transduction of human hemopoietic cells. Microarray analysis of Hox-A10-transduced CD34⫹ cells provided a substantial contribute for a better comprehension of the biological effects driven by this transcription factor in human primary hemopoietic stem/progenitor cells. Results of this analysis confirmed the stimulatory effect exerted by Hox-A10 on monocytopoiesis, disclosing an up-regulated expression of transcription factors and differentiation markers (CD Ags, granule proteins, cytokines/chemokines) that are typically associ-

ated with this maturation lineage. They also evidenced a decreased expression of genes related to erythroid and granulocyte differentiation programs. This last effect was also confirmed by cytochemical and morphological evaluation of Hox-A10-transduced CD34⫹ cells. Modulation of cell cycle-related genes was consistent with the inhibitory effect exerted by Hox-A10 on proliferation activity. The microarray data reported in this paper are significantly divergent in comparison with those recently published by the H. J. Lawrence (20) group using a similar approach in terms of target cells, culture conditions, and viral transduction, but different microarray platform, probe preparation, and analysis procedure. A number of comparative studies have clearly shown that these are crucial parameters resulting in remarkable differences in the final output of microarray experiments and, in this regard, oligonucleotide platforms based on the Affymetrix technology are the most reliable for accuracy and precision (69 –71). An additional aspect contributing to these controversial results might be represented by the different transgene levels obtained in the two reports. Regardless of the possible factors accounting for data discrepancy, the main claims of the cited paper (induction of HSC self-renewal and inhibition of myeloid differentiation) are based on limited gene subsets and are not supported by the proper functional demonstration. Nevertheless, the compared studies are in complete agreement with regard to the down-regulation of erythroid-related genes. Clustering analysis of expression profiles, performed on a considerable number of hemopoietic cell contexts under rigorous statistical conditions, paired Hox-A10- and MafB transduced CD34⫹ cells with monoblasts rather than with cell populations representative of stem/progenitor or non-monocyte lineage phenotypes (fresh CD34⫹ cells and non-monocyte precursors, respectively). This observation indicates that, at least in our experimental conditions, the Hox-A10 genetic program is univocally associated with monocyte-macrophage differentiation. Taken together, our data demonstrate the existence of a precise transactivation cascade in which stimulation of the VDRdependent pathway leads to the induction of Hox-A10 gene in turn up-regulating MafB expression, allowing us to conclude that the vitamin D3/Hox-A10 pathway cooperates MafB function in the regulation of monocyte commitment. This conclusion is also supported by the observation that all these inducers (VD, Hox-A10, MafB) comparably stimulated the monocytemacrophage differentiation of CD34⫹ cells and that treatment of the same cells with VD resulted in the sequential induction of Hox-A10 and MafB expression.

Acknowledgments This paper is dedicated to the memory of Stefano Ferrari, Professor of Biochemistry at the University of Modena and Reggio Emilia (Italy).

Disclosures The authors have no financial conflict of interest.

References 1. Bellantuono, I. 2004. Haemopoietic stem cells. Int. J. Biochem. Cell Biol. 36: 607– 620. 2. Kondo, M., A. J. Wagers, M. G. Manz, S. S. Prohaska, D. C. Scherer, G. F. Beilhack, J. A. Shizuru, and I. L. Weissman. 2003. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu. Rev. Immunol. 21: 759 – 806. 3. Metcalf, D. 1989. The molecular control of cell division, differentiation commitment and maturation in haemopoietic cells. Nature 339: 27–30. 4. Payne, K. J., and G. M. Crooks. 2002. Human hematopoietic lineage commitment. Immunol. Rev. 187: 48 – 64. 5. Tenen, D. G., R. Hromas, J. D. Licht, and D. E. Zhang. 1997. Transcription factors, normal myeloid development, and leukemia. Blood 90: 489 –519.

The Journal of Immunology 6. Orkin, S. H. 2000. Diversification of haematopoietic stem cells to specific lineages. Nat. Rev. Genet. 1: 57– 64. 7. Loose, M., and R. Patient. 2006. Global genetic regulatory networks controlling hematopoietic cell fates. Curr. Opin. Hematol. 13: 229 –236. 8. Gemelli, C., M. Montanari, E. Tenedini, M. T. Zanocco, T. Vignudelli, M. Siena, R. Zini, S. Salati, E. Tagliafico, R. Manfredini, et al. 2006. Virally mediated MafB transduction induces the monocyte commitment of human CD34⫹ hematopoietic stem/progenitor cells. Cell Death Differ. 13: 1686 –1696. 9. Hegde, S. P., J. Zhao, R. A. Ashmun, and L. H. Shapiro. 1999. c-Maf induces monocytic differentiation and apoptosis in bipotent myeloid progenitors. Blood 94: 1578 –1589. 10. Grande, A., M. Montanari, E. Tagliafico, R. Manfredini, T. Z. Marani, M. Siena, E. Tenedini, A. Gallinelli, and S. Ferrari. 2002. Physiological levels of 1␣,25dihydroxyvitamin D3 induce the monocytic commitment of CD34⫹ hematopoietic progenitors. J. Leukocyte Biol. 71: 641– 651. 11. Tagliafico, E., E. Tenedini, A. Bergamaschi, R. Manfredini, R. Percudani, M. Siena, T. Zanocco-Marani, A. Grande, M. Montanari, C. Gemelli, et al. 2002. Gene expression profile of vitamin D3 treated HL60 cells shows an incomplete molecular phenotypic conversion to monocytes. Cell Death Differ. 9: 1185–1195. 12. Manfredini, R., F. Trevisan, A. Grande, E. Tagliafico, M. Montanari, R. Lemoli, G. Visani, S. Tura, S. Ferrari, and S. Ferrari. 1999. Induction of a functional vitamin D receptor in all-trans-retinoic acid-induced monocytic differentiation of M2-type leukemic blast cells. Cancer Res. 59: 3803–3811. 13. Daftary, G. S., and H. S. Taylor. 2006. Endocrine regulation of HOX genes. Endocr. Rev. 27: 331–355. 14. Magli, M. C., C. Largman, and H. J. Lawrence. 1997. Effects of HOX homeobox genes in blood cell differentiation. J. Cell. Physiol. 173: 168 –177. 15. Lawrence, H. J., G. Sauvageau, N. Ahmadi, A. R. Lopez, M. M. LeBeau, M. Link, K. Humphries, and C. Largman. 1995. Stage- and lineage-specific expression of the HOXA10 homeobox gene in normal and leukemic hematopoietic cells. Exp. Hematol. 23: 1160 –1166. 16. Rots, N. Y., M. Liu, E. C. Anderson, and L. P. Freedman. 1998. A differential screen for ligand-regulated genes: identification of HoxA10 as a target of vitamin D3 induction in myeloid leukemic cells. Mol. Cell. Biol. 18: 1911–1918. 17. Du, H., G. S. Daftary, S. I. Lalwani, and H. S. Taylor. 2005. Direct regulation of HOXA10 by 1,25-(OH)2D3 in human myelomonocytic cells and human endometrial stromal cells. Mol. Endocrinol. 19: 2222–2233. 18. Taghon, T., F. Stolz, M. De Smedt, M. Cnockaert, B. Verhasselt, J. Plum, and G. Leclercq. 2002. HOX-A10 regulates hematopoietic lineage commitment: evidence for a monocyte-specific transcription factor. Blood 99: 1197–1204. 19. Buske, C., M. Feuring-Buske, J. Antonchuk, P. Rosten, D. E. Hogge, C. J. Eaves, and R. K. Humphries. 2001. Overexpression of HOXA10 perturbs human lymphomyelopoiesis in vitro and in vivo. Blood 97: 2286 –2292. 20. Ferrell, C. M., S. T. Dorsam, H. Ohta, R. K. Humphries, M. K. Derynck, C. Haqq, C. Largman, and H. J. Lawrence. 2005. Activation of stem-cell specific genes by HOXA9 and HOXA10 homeodomain proteins in CD34⫹ human cord blood cells. Stem Cells 23: 644 – 655. 21. Thorsteinsdottir, U., G. Sauvageau, M. R. Hough, W. Dragowska, P. M. Lansdorp, H. J. Lawrence, C. Largman, and R. K. Humphries. 1997. Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol. Cell. Biol. 17: 495–505. 22. Magnusson, M., A. C. Brun, N. Miyake, J. Larsson, M. Ehinger, J. M. Bjornsson, A. Wutz, M. Sigvardsson, and S. Karlsson. 2007. HOXA10 is a critical regulator for hematopoietic stem cells and erythroid/megakaryocyte development. Blood 109: 3687–3696. 23. Montanari, M., C. Gemelli, E. Tenedini, M. T. Zanocco, T. Vignudelli, M. Siena, R. Zini, S. Salati, G. Chiossi, E. Tagliafico, et al. 2005. Correlation between differentiation plasticity and mRNA expression profiling of CD34⫹-derived CD14⫺ and CD14⫹ human normal myeloid precursors. Cell Death Differ. 12: 1588 –1600. 24. Piacibello, W., F. Sanavio, L. Garetto, A. Severino, A. Dane, L. Gammaitoni, and M. Aglietta. 1998. Differential growth factor requirement of primitive cord blood hematopoietic stem cell for self-renewal and amplification vs proliferation and differentiation. Leukemia 12: 718 –727. 25. Grande, A., B. Piovani, A. Aiuti, S. Ottolenghi, F. Mavilio, and G. Ferrari. 1999. Transcriptional targeting of retroviral vectors to the erythroblastic progeny of transduced hematopoietic stem cells. Blood 93: 3276 –3285. 26. Tenedini, E., M. E. Fagioli, N. Vianelli, P. L. Tazzari, F. Ricci, E. Tagliafico, P. Ricci, L. Gugliotta, G. Martinelli, S. Tura, et al. 2004. Gene expression profiling of normal and malignant CD34-derived megakaryocytic cells. Blood 104: 3126 –3135. 27. Urbinati, F., F. Lotti, G. Facchini, M. Montanari, G. Ferrari, F. Mavilio, and A. Grande. 2005. Competitive engraftment of hematopoietic stem cells genetically modified with a truncated erythropoietin receptor. Hum. Gene Ther. 16: 594 – 608. 28. Grande, A., R. Manfredini, E. Tagliafico, R. Balestri, M. Pizzanelli, S. Papa, P. Zucchini, L. Bonsi, G. Bagnara, U. Torelli, et al. 1995. All-trans-retinoic acid induces simultaneously granulocytic differentiation and expression of inflammatory cytokines in HL-60 cells. Exp. Hematol. 23: 117–125. 29. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(⫺⌬⌬CT method. Methods 25: 402– 408.

5671 30. Ferrari, F., S. Bortoluzzi, A. Coppe, D. Basso, S. Bicciato, R. Zini, C. Gemelli, G. A. Danieli, and S. Ferrari. 2007. Genomic expression during human myelopoiesis. BMC Genomics 8: 264. 31. Turk, B., D. Turk, and V. Turk. 2000. Lysosomal cysteine proteases: more than scavengers. Biochim. Biophys. Acta 1477: 98 –111. 32. Turk, V., B. Turk, and D. Turk. 2001. Lysosomal cysteine proteases: facts and opportunities. EMBO J. 20: 4629 – 4633. 33. Weinberg, J. B. 2004. Mononuclear phagocytes. In The Normal Hematologic System. Lippincott Williams & Wilkins, Philadelphia, pp. 377– 414. 34. Mahoney, J. A., B. Ntolosi, R. P. DaSilva, S. Gordon, and A. J. McKnight. 2001. Cloning and characterization of CPVL, a novel serine carboxypeptidase, from human macrophages. Genomics 72: 243–251. 35. Collins, R. F., A. D. Schreiber, S. Grinstein, and W. S. Trimble. 2002. Syntaxins 13 and 7 function at distinct steps during phagocytosis. J. Immunol. 169: 3250 –3256. 36. Parks, W. C., C. L. Wilson, and Y. S. Lopez-Boado. 2004. Matrix metalloproteinases as modulators of inflammation and innate immunity. Nat. Rev. Immunol. 4: 617– 629. 37. Jiang, Y. J., B. Lu, P. C. Choy, and G. M. Hatch. 2003. Regulation of cytosolic phospholipase A2, cyclooxygenase-1 and -2 expression by PMA, TNF␣, LPS, and M-CSF in human monocytes and macrophages. Mol. Cell. Biochem. 246: 31–38. 38. Tjoelker, L. W., C. Wilder, C. Eberhardt, D. M. Stafforini, G. Dietsch, B. Schimpf, S. Hooper, H. Le Trong, L. S. Cousens, G. A. Zimmerman, et al. 1995. Anti-inflammatory properties of a platelet-activating factor acetylhydrolase. Nature 374: 549 –553. 39. Turcanu, V., M. Dhouib, and P. Poindron. 1998. Nitric oxide synthase inhibition by haem oxygenase decreases macrophage nitric-oxide-dependent cytotoxicity: a negative feedback mechanism for the regulation of nitric oxide production. Res. Immunol. 149: 741–744. 40. Smithgall, T. E. 1998. Signal transduction pathways regulating hematopoietic differentiation. Pharmacol. Rev. 50: 1–19. 41. Moser, B., M. Wolf, A. Walz, and P. Loetscher. 2004. Chemokines: multiple levels of leukocyte migration control. Trends Immunol. 25: 75– 84. 42. Sano, H., D. K. Hsu, J. R. Apgar, L. Yu, B. B. Sharma, I. Kuwabara, S. Izui, and F. T. Liu. 2003. Critical role of galectin-3 in phagocytosis by macrophages. J. Clin. Invest. 112: 389 –397. 43. Luster, A. D. 1998. Chemokines: chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338: 436 – 445. 44. Mantovani, A. 1999. The chemokine system: redundancy for robust outputs. Immunol. Today 20: 254 –257. 45. O’Neill, L. 2000. The Toll/interleukin-1 receptor domain: a molecular switch for inflammation and host defence. Biochem. Soc. Trans. 28: 557–563. 46. Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1: 135–145. 47. Apostolopoulos, V., and I. F. McKenzie. 2001. Role of the mannose receptor in the immune response. Curr. Mol. Med. 1: 469 – 474. 48. Tedeschi, F. A., and F. E. Zalazar. 2006. HOXA9 gene expression in the chronic myeloid leukemia progression. Leukemia Res. 30: 1453–1456. 49. Sindt, A., B. Deau, W. Brahim, A. Staal, S. Visanica, P. Villarese, J. P. Rault, E. Macintyre, and E. Delabesse. 2006. Acute monocytic leukemia with coexpression of minor BCR-ABL1 and PICALM-MLLT10 fusion genes along with overexpression of HOXA9. Genes Chromosomes Cancer 45: 575–582. 50. Lahortiga, I., E. Belloni, I. Vazquez, X. Agirre, M. J. Larrayoz, J. L. Vizmanos, M. Valganon, I. Zudaire, B. Saez, M. C. Mateos, et al. 2005. NUP98 is fused to HOXA9 in a variant complex t(7;11:13;17) in a patient with AML-M2. Cancer Genet. Cytogenet. 157: 151–156. 51. Lord, K. A., A. Abdollahi, B. Hoffman-Liebermann, and D. A. Liebermann. 1993. Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation. Mol. Cell. Biol. 13: 841– 851. 52. Kerppola, T. K., and T. Curran. 1994. Maf and Nrl can bind to AP-1 sites and form heterodimers with Fos and Jun. Oncogene 9: 675– 684. 53. Blank, V., and N. C. Andrews. 1997. The Maf transcription factors: regulators of differentiation. Trends Biochem. Sci. 22: 437– 441. 54. Feinberg, M. W., Z. Cao, A. K. Wara, M. A. Lebedeva, S. Senbanerjee, and M. K. Jain. 2005. Kruppel-like factor 4 is a mediator of proinflammatory signaling in macrophages. J. Biol. Chem. 280: 38247–38258. 55. Frucht, D. M., M. Aringer, J. Galon, C. Danning, M. Brown, S. Fan, M. Centola, C. Y. Wu, N. Yamada, H. El Gabalawy, and J. J. O’Shea. 2000. Stat4 is expressed in activated peripheral blood monocytes, dendritic cells, and macrophages at sites of Th1-mediated inflammation. J. Immunol. 164: 4659 – 4664. 56. Pei, L., A. Castrillo, M. Chen, A. Hoffmann, and P. Tontonoz. 2005. Induction of NR4A orphan nuclear receptor expression in macrophages in response to inflammatory stimuli. J. Biol. Chem. 280: 29256 –29262. 57. Han, D. K., P. M. Chaudhary, M. E. Wright, C. Friedman, B. J. Trask, R. T. Riedel, D. G. Baskin, S. M. Schwartz, and L. Hood. 1997. MRIT, a novel death-effector domain-containing protein, interacts with caspases and BclXL and initiates cell death. Proc. Natl. Acad. Sci. USA 94: 11333–11338. 58. Cortes, U., C. Moyret-Lalle, N. Falette, C. Duriez, F. E. Ghissassi, C. Barnas, A. P. Morel, P. Hainaut, J. P. Magaud, and A. Puisieux. 2000. BTG gene expression in the p53-dependent and -independent cellular response to DNA damage. Mol. Carcinog. 27: 57– 64. 59. Yin, Y., Y. X. Liu, Y. J. Jin, E. J. Hall, and J. C. Barrett. 2003. PAC1 phosphatase is a transcription target of p53 in signalling apoptosis and growth suppression. Nature 422: 527–531.

5672


60. Bouchard, C., K. Thieke, A. Maier, R. Saffrich, J. Hanley-Hyde, W. Ansorge, S. Reed, P. Sicinski, J. Bartek, and M. Eilers. 1999. Direct induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27. EMBO J. 18: 5321–5333. 61. Yang, R., R. Morosetti, and H. P. Koeffler. 1997. Characterization of a second human cyclin A that is highly expressed in testis and in several leukemic cell lines. Cancer Res. 57: 913–920. 62. Koury, M. J., S. T. Sawyer, and S. J. Brandt. 2002. New insights into erythropoiesis. Curr. Opin. Hematol. 9: 93–100. 63. Ingley, E., P. A. Tilbrook, and S. P. Klinken. 2004. New insights into the regulation of erythroid cells. IUBMB Life 56: 177–184. 64. Borregaard, N., and J. B. Cowland. 1997. Granules of the human neutrophilic polymorphonuclear leukocyte. Blood 89: 3503–3521. 65. Venge, P. 1990. The human eosinophil in inflammation. Agents Actions 29: 122–126. 66. Dy, M., M. Pacilio, A. Arnould, F. Machavoine, P. Mayeux, O. Hermine, M. Bodger, and E. Schneider. 1999. Modulation of histidine decarboxylase activity and cytokine synthesis in human leukemic cell lines: relationship with

67.

68.

69. 70.

71.

basophilic and/or megakaryocytic differentiation. Exp. Hematol. 27: 1295–1305. Mamune-Sato, R., K. Yamauchi, Y. Tanno, Y. Ohkawara, H. Ohtsu, D. Katayose, K. Maeyama, T. Watanabe, S. Shibahara, and T. Takishima. 1992. Functional analysis of alternatively spliced transcripts of the human histidine decarboxylase gene and its expression in human tissues and basophilic leukemia cells. Eur. J. Biochem. 209: 533–539. Kent, W. J., C. W. Sugnet, T. S. Furey, K. M. Roskin, T. H. Pringle, A. M. Zahler, and D. Haussler. 2002. The human genome browser at UCSC. Genome Res. 12: 996 –1006. Hoheisel, J. D. 2006. Microarray technology: beyond transcript profiling and genotype analysis. Nat. Rev. Genet. 7: 200 –210. Park, P. J., Y. A. Cao, S. Y. Lee, J. W. Kim, M. S. Chang, R. Hart, and S. Choi. 2004. Current issues for DNA microarrays: platform comparison, double linear amplification, and universal RNA reference. J. Biotechnol. 112: 225–245. Jarvinen, A. K., S. Hautaniemi, H. Edgren, P. Auvinen, J. Saarela, O. P. Kallioniemi, and O. Monni. 2004. Are data from different gene expression microarray platforms comparable? Genomics 83: 1164 –1168.