Herpes simplex virus type-1 infection upregulates cellular ... - Nature

Gene Therapy (2003) 10, 1494–1502 & 2003 Nature Publishing Group All rights reserved 0969-7128/03 $25.00 www.nature.com/gt

RESEARCH ARTICLE

Herpes simplex virus type-1 infection upregulates cellular promoters and telomerase activity in both tumor and nontumor human cells C-T Yang1, J Song2, X Bu2, Y-S Cong3, S Bacchetti3, P Rennie4 and WW-G Jia2 1

Department of Internal Medicine, Chang Gung Memorial Hospital, Chiayi, Taiwan; 2Departments of Surgery, University of British Columbia, Vancouver, BC, Canada; 3Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON, Canada; and 4Prostate Research Centre, Vancouver General Hospital, Vancouver BC, Canada

Targeted gene expression through viral vectors has been a promising approach for gene therapy. However, the effects of viral gene products expressed from virus vectors on the expression of the host gene are not well known. In the present study, we examined the activities of cellular promoters, including the promoter for genes of human telomerase reverse transcriptase (hTERT), tyrosinase and probasin, in both tumor and normal cells after infection with herpes simplex virus type 1 (HSV-1) vectors. Our results showed that infection with replication-defective HSV-1 vectors significantly upregulated the activity of all three cellular promoters in a nonsequence specific fashion in all

cell types tested. Furthermore, viral infection upregulated activities of the hTERT promoter and endogenous telomerase in nontumoral cells. Additional experiments suggested that the viral immediate-early gene product, infected cell protein 0, might be responsible for the deregulation of cellular promoter activity and activation of telomerase. Our study alerts to the potential risk of oncogenesis through deregulation of host gene expression, such as the telomerase by viral vectors in normal cells. Gene Therapy (2003) 10, 1494–1502. doi:10.1038/ sj.gt.3302005

Keywords: promoter; herpes simplex virus; telomerase; carcinogenesis

Introduction Virus-mediated gene therapy has been proposed for many years and remains a promising approach supported by numerous experimental reports and a number of clinical trials. Among the currently used virus vectors, herpes simplex virus type-1 (HSV-1) possesses some unique characteristics that render it an attractive candidate. These include its high infectivity, the large capacity for accommodating multiple transgenes, the wide host range and the availability of antiherpetic agents that can abrogate an infection. Genetically engineered HSV-1 for cancer gene therapy includes replication-defective1,2 and replication-competent HSV-1 vectors.3–6 Both types of viral vectors need to target specific tissues to avoid deleterious effects in normal tissues. For this purpose, tissue- or tumor-specific promoters have been proposed to control the expression of transgene or essential viral gene(s).4,7,8 However, an influence of infected cell proteins (ICPs), encoded by the viral genes, on the expression of transgene was recently noticed.9 HSV viral proteins are divided into three major kinetic classes on the basis of requirements for their expression and the times of their maximum rates of synthesis: immediate early (IE), early and late.10 IE genes encode the major Correspondence: Dr W Jia, Department of Surgery, Brain Research Center, 2211 Wesbrook Mall, University of British Columbia, Vancouver, BC, Canada V6T 2B5 Received 20 November 2001; accepted 15 January 2003

HSV regulatory proteins, and are transcriptionally activated by VP16, one of the tegument proteins carried by virions.11,12 The IE genes encode ICPs 0, 4, 22, 27 and 47.10,13,14 All IE proteins except ICP47 are nuclear phosphoproteins15 and act to regulate their own synthesis as well as the synthesis of proteins of later kinetic classes.16–22 Since the genes of HSV are standard polymerase II transcription units,23 exogenous polymerase II promoters used to express transgenes may be affected by HSV IE gene products in the same way as viral promoters are. If the expression of a transgene could be augmented by viral IE proteins, the specificity of tissue- or tumor-targeted therapy might thus be jeopardized. In the present study, we examined the effects of HSV-1 infection on the activity of several cellular promoters using luciferase as a reporter gene, and evaluated the effects of virus-borne individual HSV IE proteins on the expression of transgenes. We also studied the influence of HSV-1 infection on endogenous telomerase expression to explore the potential impact of virus infection in nontumor cells.

Results Effect of superinfection with HSV-1 on tyrosinase promoter activity in B16 and H460 cells As a model promoter system, we used the tyrosinase promoter to elucidate the effect of superinfection with HSV-1 on promoter activity. Since tyrosinase is a

HSV-1 upregulates telomerase C-T Yang et al

1495

pigmented cell-specific gene that is highly expressed in melanoma cells,7 we first transfected B16 melanoma (pigmented) and H460 lung carcinoma (nonpigmented) cells with both Tyrosinase-2 and pLacZ plasmids. The former plasmid contains a tyrosinase promoter/luciferase reporter and the latter a cytomegalovirus (CMV) promoter/lacZ reporter. At 24 h after transfection, cells were superinfected with ICP27() mutant 5dl 1.2, a replication defective HSV-1 mutant, at multiplicity of infection (MOI) of B5 or mock infected. At 48 h after transfection, cells were collected for luciferase and bgalactosidase enzyme assays. The tyrosinase promoter activity was expressed as the ratio of luciferase to bgalactosidase activity (the relative luciferase activity) to normalize the variation in transfection efficiency. The relative luciferase activity in B16 cells was near 29-fold higher than that in H460 (3.5070.14 106 versus 1.2270.51 105, respectively; Po0.00002). Superinfection with 5dl 1.2 significantly increased luciferase activity in H460 cells by 15-fold (Po0.00003), but had no effect in B16 cells (P¼0.44). Consequently, the relative luciferase activity in B16 cells became only 1.5-fold of that in H460 cells (Figure 1A). Thus, superinfection with the HSV-1 virus completely abolished the cell-type specificity of the tyrosinase promoter.

Relative Luciferase Activity (Luciferase/LacZ)

a

Effects of superinfection with HSV-1 on prostatespecific probasin promoter in LNCaP and HeLa cells We next studied the prostate-specific probasin promoter activity in prostate cancer LNCaP and cervical cancer HeLa cell lines. Plasmids pABB, containing the probasin promoter linked to the luciferase reporter gene, and pLacZ were co transfected into LNCaP and HeLa cells. Cells were then superinfected with 5dl 1.2 or mock infected as above, and collected after 24 h for luciferase and b-galactosidase assays. Again, relative luciferase activity was calculated to measure the activity of the probasin promoter. Without superinfection, the relative luciferase activity in LNCaP cells was only marginally higher than that in HeLa cells (5.7270.34 103 versus 4.0670.04 103, respectively; P¼0.008). This was because the activity of the probasin promoter in LNCaP cells is greatly dependent on the presence of androgen analogues, such as R1881,24 which were not added in the present study to avoid possible interference. Superinfection with 5dl 1.2 significantly increased the relative luciferase activities for both cell lines, especially HeLa cells, where the relative luciferase activity was paradoxically 3.3-fold higher than that in LNCaP cells (4.5870.40 104 versus 1.4070.45 104, respectively; P¼0.006) (Figure 1B).

4000000

B16 H460

3000000

2000000

1000000

0 Without Superinfection

With Superinfection

Treatment

Relative Luciferase Activity (Luciferase/LacZ)

b

LNCap HeLa

60000 50000 40000 30000 20000 10000 0 Without Superinfection

With Superinfection

Treatment Figure 1 Effects of superinfection with HSV-1 vector on the promoter activities. (A) B16 melanoma and H460 nonsmall cell lung cancer cells were transfected with tyrosinase promoter-regulated luciferase expressing plasmid, Tyrosinase-2, and CMV promoter-regulated b-galactosidase expressing plasmid, pLacZ, either before and after superinfection with HSV-1 mutant defective in ICP27 gene, 5dl 1.2. (b) LNCaP prostate and HeLa cervical cancer cells were transfected with probasin promoter-regulated luciferase expressing plasmid, AAB and pLacZ before and after superinfection with 5dl 1.2. Relative luciferase activity was the ratio of luciferase relative to b-galactosidase activity. Data were expressed as mean7SE on triplicate samples. Gene Therapy


1496

Increase of luciferase activity (%)

Infection with HSV-1 mutant upregulated the endogenous telomerase activity in non-tumor cells We further examined if the HSV-1-infection-induced upregulation of hTERT promoter activity would alter the endogenous telomerase activity in nontumor cells. NHLF and HUVEC were infected with either 5dl 1.2 at an MOI of B2 or mock infected. The relatively lower titer we used here was because of overt cytopathic effect of 5dl 1.2 in HUVEC at an MOI of 5. After 24 h, cells were collected for quantitation of telomerase activity. By using Polymerase Chain Reaction-based Enzyme Immunoassay (PCR-EIA),29 the telomerase activity was expressed as the absorbance at 450 nm. In both NHLF and HUVEC, infection with 5dl 1.2 significantly increased the absorbance by four- and eight-fold, respectively (P¼0.005 and 0.004, respectively) (Figure 3). Interestingly, infection with the ICP0() HSV-1 mutant 7134 did not significantly alter telomerase activity in either NHLF or 450 400 350 300 250 200 150 100 50 0 H460

B16

NHLF

Figure 2 Changes in transcriptional activity of hTERT promoter after superinfection with HSV-1 vector. B16, H460 and adult normal human lung fibroblasts cells were transfected with hTERT promoter-regulated luciferase expressing plasmid, TLuc, before and after superinfection with 5dl 1.2. Data (mean7SE, triplicated) were expressed as the percentages of luciferase activity of control samples without superinfection. Gene Therapy

0.3 Absorbance (A450)

Effects of superinfection with HSV-1 on telomerase promoter activity in tumor and non-tumor cells We further tested if upregulation of promoter activity by HSV-1 infection also occurs in nontumor cells. Upregulation of human telomerase reverse transcriptase (hTERT) has been shown to play a critical role in carcinogenesis25,26 and both the hTERT gene and its promoter have higher levels of activity specifically in tumor cells.27,28 All of these features render the hTERT promoter an attractive target for cancer gene therapy. We thus examined if superinfection with HSV-1 vector would alter the activity of this promoter. We transfected plasmid pTLuc into lung carcinoma H460, mouse melanoma B16 and adult normal human lung fibroblast (NHLF) cells. Cells were then infected with 5dl 1.2 at MOI of B5 or mock-infected 24 h after transfection and assayed for luciferase after an additional 24 h. Although hTERT promoter activities varied among the three cell lines without viral infection (9.170.6 105, 5.370.4 105, and 3.170.5 103, for H460, B16 and NHLF, respectively), superinfection with 5dl 1.2 markedly increased the luciferase activity in H460, B16 cells and NHLF by 8377%, 31075% and 68724%, respectively (Figure 2) (Po0.01 for all the cases).

0.25

Mock ICP27(-) HSV-1 ICP0(-) HSV-1

0.2 0.15 0.1 0.05 0 HUVEC

NHLF Cell Line

Figure 3 Telomerase activity in the cell extract of NHLF and HUVEC before and after infection with either ICP27 or ICP0 gene defective HSV-1 mutant. Results from PCR–EIA for quantitation of telomerase activity were expressed as absorbance unit. Data were derived from the mean of two determinations 7SE.

HUVEC compared with that in mock-infected samples (P¼0.051 or 0.106, respectively), suggesting that ICP0 may be responsible for the observed promoter upregulation.

Effects of superinfection with HSV-1 deletion mutants on promoter activity To further explore which HSV-1 gene(s) plays the major role in altering cellular promoter activity, the tyrosinase promoter–luciferase reporter construct was transfected into H460 cells followed by superinfection with various HSV-1 mutants or mock infection (Figure 4a). Infection with wild type strain KOS, ICP22() mutant d22LacZ, ICP27() mutant 5dl 1.2 and ICP34.5/ICP6 double deletion mutant G2076 significantly increased the luciferase activity by 505743% (Po0.002), 497714% (Po0.0003), 991769% (Po0.00001), and 525786% (Po0.0005), respectively, relative to mock-infected control cell cultures. Infection with ICP4 mutant CgalD3 or TOZ.1,30 a mutant with multiple deletions for ICP4, ICP22, ICP27, and UL41, slightly upregulated the tyrosinase promoter activity by 6973% (Po0.03) and 57717% (Po0.03), respectively. The increases in promoter activity were significantly less than that with the previous mutants (Po0.04). Interestingly, a VP16() mutant V422 and an ICP0() mutant 7134 did not significantly alter the promoter activity (P¼0.67 and 0.08, respectively). Figure 4b demonstrated the mRNA levels of ICP0 in cells infected with the above viruses using quantitative RT-PCR. While the transcription levels of all mutant HSV-1 strains were much lower than wild-type KOS strain, V422, 7134, CgalD3 and TOZ.1 expressed much less ICP0 than the others. Therefore, the ICP0 mRNA level was positively correlated with the upregulated tyrosinase promoter activity (Fig.4a). It appears that expression of other IE gene products such as ICP4, ICP22 and ICP27 increases the mRNA levels of ICP0 in the order of significance of ICP44 ICP22¼ICP27. ICP6 and ICP34.5 double deletion also significantly reduces ICP0 message level but not as remarkable as ICP4 deletion. Effects of VP16, ICP4 or ICP0 on activity of the tyrosinase promoter in H460 cells To verify whether VP16, ICP4 and/or ICP0 are capable of enhancing the activity of exogenous promoters in human


1497

a

8

14

7

10

Fold increase in expression

Fold Difference

12 8 6 4 2 TOZ

G207

5dl 1.2

d22LacZ

CgalD3

7134

V422

KOS (0.5)

KOS (5)

0

Virus strains

b

5 4 3 2 1

3000.00 EXPRESSION LEVEL

6

0 ICP0

2500.00

VP16

ICP4

Figure 5 Changes in transcriptional activity of tyrosinase promoter in H460 cells in the presence of HSV-1 viral ICP4, ICP0 or VP16 gene expression. Human lung carcinoma H460 cells were cotransfected with both the Tyrosinase-2 and one of the following plasmids: pLK, ICP4 expressing plasmid; pDS-16, ICP0 expressing plasmid; and pRG50, VP16 expressing plasmid, or the control plasmid, pLacZ carrying a LacZ gene driven by CMV promoter. Data are expressed as ratios of pLK/PlacZ, pDS16/pLacZ and pRG50/pLacZ.

2000.00 1500.00 1000.00 500.00 0.00 KOS ICP4/ACT 2736.6

V422

7134 CgalD3 d22LacZ 5dl 1.2 G207

0.12

0.00

0.78

629.51

453.46 38.54

TOZ.1 Control 0.05

0.00

HSV STRAINS Figure 4 (a) Changes in transcriptional activity of tyrosinase promoter in H460 cells after superinfection with various HSV-1 mutants. H460 cells were transfected with plasmid Tyrosinase-2 and then superinfected with wild-type HSV-1 (KOS), HSV-1 mutant defective in VP16 (V422), ICP0 (7134), ICP4 (CgalD3), ICP22 (d22LacZ) or ICP27 (5dl 1.2), or HSV-1 mutants with multiple gene deletions, ICP34.5/ICP6 (G207), or ICP4/ ICP22/ICP47/UL41 (TOZ). KOS was applied at both MOI of 0.5 and 5 as cytopathicity caused by the wild-type virus may reduce the level of reporter gene expression. The remaining mutants were at MOI of 5. Results shown are the ratios of the luciferase activity in each treatment with HSV-1 vector relative to that with mock infection. Data were derived from the mean of three determinations 7SE. (b) Expression levels of ICP0 measured by realtime RT-PCR in the above cells infected with the same viral strains of the same titers. Data are presented as ratios of amounts of ICP0 mRNA over actin mRNA. The ‘control’ was from the cells with mock infection. Each point is the average of two independent measurement.

cells, we cotransfected plasmid Tyrosinase-2 with pRG50 (expressing VP16), pDS-16 (expressing ICP0), pLK (expressing ICP4) or pLacZ (control plasmid) into H460 human carcinoma cells, and examined the effects of expression of the each viral gene on tyrosinase promoter activity. After 48 h, cells were lysed for luciferase activity assay. Luciferase activity driven by the tyrosinase promoter was 6.6-fold higher in cells cotransfected with pDS-16 than in those cotransfected with control plasmid pLacZ (P¼0.02). In contrast, cotransfection with pRG50 or pLK had no significant effect in luciferase activity compared to the control plasmid (P40.5 in either comparison, Figure 5).

Discussion Virus-mediated gene therapy takes advantage of the high efficiency with which viral vectors are able to introduce

foreign genes into mammalian cells. Deregulation of cellular promoters caused by infection with viral vectors undoubtedly leads to a safety concern for virus-mediated gene therapy. Our results suggest that transgene expression mediated by plasmid constructs, such as amplicons that are widely used in HSV-1-mediated gene transfer,31,32 will likely be inappropriately turned on by the coexisting helper virus. Recently, it has been reported that HSV-1 IE proteins abrogated the tetracycline regulated transgene expression in an amplicon system,33 demonstrating a similar interference of viral IE proteins on transgene expression. The disregulation of activity of cellular promoters by HSV-1-infection may not be restricted to transiently transfected genes, as expression of many endogenous genes can also be affected in HSV-1 infected cells.34 Our present study shows that HSV-1 infection deregulated the activity of hTERT promoter present in cells in both episomal and in the genome. In addition, we also showed that HSV-1 infection can also upregulate the expression of hTERT in nontumor cells, which may cause further safety concern since upregulation of telomerase has been shown to play a critical role in carcinogenesis.25,26 Alteration of telomerase activity has been reported in cells infected with HIV and Kaposi’s sarcoma-associated herpesvirus.35–37 While HSV-1/2 are not considered carcinogenic, clinical correlation between HSV-2 and human carcinoma of cervix remains to be a debatable issue.38–46 It is unclear whether the HSV-1-induced upregulation of telomerase activity showed in the present study could afford individual cell freedom from senescence, allow accumulations of the genetic changes and chromosome instability, and eventually lead to pathological state such as cancer. Our results also showed that the upregulation of the endogenous telomerase was independent of viral replication but rather dependent on certain viral IE gene expression. As most HSV-1 vectors currently used for tumor gene Gene Therapy


1498

therapy including the oncolytic vectors that are currently on clinical trials 47,48 express ICP0 and ICP4 genes, the potential risk of deregulation of gene expression in infected normal cells should be considered. In the case of oncolytic HSV-1 vectors, the risk of adverse deregulation in host cells may not pose a significant problem since the duration of the viral IE gene expression is short. In tissues where HSV-1 virus infection is persistent or frequently recurrent, the impact of the virus-induced deregulation of cellular gene expression must be seriously investigated. Our results further suggest that the deregulation of cellular promoter and upregulation of host telomerase activity may be attributed to the HSV-1 IE genes products, especially ICP0, in agreement with previous studies on the effects of this viral protein on cellular gene expression.49–52 Although the exact mechanism by which ICP0 causes this enhancement is not yet clear, it has recently been reported that ICP0 may interact with the cellular transcription factor BMAL1, a member of the basic helix–loop–helix PER-ARNT-SIM superfamily of transcriptional regulators.53 Despite not being essential for viral replication, lacking ICP0 gene significantly hampers the viral replication in cultured cells, especially infected with low MOIs.54,55 ICP0 is a potent transactivator of all three kinetic classes of HSV promoters,56,57 and its transactivating activity has been shown to increase synergistically in the presence of ICP4, 19–22,58,59 which may explain the fact that the ICP0+/ICP4 mutant (such as CgalD3 and TOZ.1) had a markedly lower magnitude of enhancement in tyrosinase promoter activity than the wild-type or other ICP0+/ICP4+ mutants (Fig.4a). Similarly, since VP16 can activate the transcription of all IE genes60,61 deletion of the VP16 gene could significantly abolish HSVinduced increase in the activity of cellular promoters as shown by infection with the VP16() mutant V422. In addition, the above mutants also showed significantly lower levels of ICP0 comparing to ICP0+/ICP4+ mutants (Fig.4b), which further emphasizes the role of ICP0 in regulating cellular promoter activity. On the other hand, ICP0 may enhance certain cellular gene expression but inhibits the others as shown by recent studies using cDNA arrays on infected cells34,62,63 It is interesting to note that ICP27- mutant 5d1.2 showed significantly higher level of tyrosinase promoter activity than the wild-type KOS, which suggest that ICP27 may repress the ICP0 caused effect. HSV-1 vectors are powerful tools for gene transfer and have been widely used in gene therapy in experimental animal models6 and some oncolytic herpes mutants have been in clinical trials for cancer therapy.48,64,65 While the safety concern for viral vectors has been concentrated to virus-induced lytic toxicity.48,66–68 our present study alerts to the potential risk of oncogenesis through deregulation of host gene expression in normal cells. It is not unreasonable to predict that nonherpes viral vectors may have similar effects on host cells. For HSV-1, it seems safer to use vectors with multiple deletions of all IE genes 69,70 or virus-free amplicons 71–74 for gene transfer to nontumoral tissues. For oncolytic viral vectors, it might be plausible to put the IE genes, particularly the ICP0 and 4, under strict cell-type specific control to reduce their expression in normal cells.75

Gene Therapy

Materials and methods Cell lines 7B cell line (ICP4- and ICP27-transformed African green monkey kidney cells) was kindly provided by Dr William Goins (University of Pittsburgh School of Medicine). U2OS osteosarcoma (HTB-96) and H460 nonsmall cell lung cancer (HTB-177) cell lines were purchased from American Type Culture Collection (ATCC). LNCaP prostate cancer, HeLa cervical cancer, B16 melanoma cell lines were obtained from British Columbia Cancer Research Centre and Vancouver Prostate Cancer Research Centre (Vancouver, BC, Canada). All the above but LNCaP cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS). LNCaP cells were maintained in DMEM with 2% stripped FCS and 10 nM R1881, a synthetic androgen76 Adult normal human lung fibroblasts (NHLF) and the specific growth medium (Fibroblast Growth Medium-2 BulletKit) were purchased from Clonetics (BioWhittaker, Inc., Walkersville, MD, USA). Normal endothelial cells (HUVEC) were isolated from human umbilical cord veins as described previously.77 Cells were cultured in medium MCDB 107 (JRH Biosciences, Lenexa, KS, USA) supplemented with 2% FCS and a fibroblast growth factor-enriched fraction of porcine brain extract (1 mg/ml). Plasmids Plasmid pLacZ contains the cytomegalovirus (CMV) promoter-regulated LacZ gene78 Plasmid pTLuc was generated by subcloning a 342 bp fragment of the hTERT promoter (344 to 2 relative to the hTERT ATG) from plasmid P-34479 upstream of the luciferase reporter gene in the pGL2-Basic vector (pGL2, Promega, Madison, WI, USA). Plasmid Tyrosinase-2, containing the tyrosinase promoter-regulated luciferase gene,7 was kindly provided by Dr. David L. Bartlett (National Cancer Institute, Frederick, MD, USA). Plasmid pAAB was derived from pGL2, containing a probasin promoter (426/+28) upstream of the luciferase gene.80 Plasmid pDS-16 contains a full-length cDNA of ICP0 gene13 controlled by its own promoter, and was kindly provided by Dr S Silverstein (Columbia University); pRG50 expresses VP16 under the cytomegalovirus (CMV) promoter and was a gift from Dr P O’Hare (Marie Curie Research Institute, UK). Viruses The wild-type KOS strain HSV-1 (KOS) was purchased from ATCC. The VP16-defective HSV-1 mutant V42281 was kindly given by Dr J Smiley (University of Alberta, Alberta, Canada). The HSV-1 mutant d22LacZ, defective in ICP2282 was a gift from Dr Stephen A Rice (University of Minnesota Medical School). Mutants 7134 and 5dl 1.2, defective in ICP083 and ICP2784 respectively, were provided by Dr Priscilla A Schaffer (University of Pennsylvania School of Medicine). The ICP4 deletion mutant, CgalD385 was a gift from Dr Paul Johnson (Neurovir Inc., Vancouver, BC, Canada). G207, a derivative of wild-type HSV-1 strain F in which both copies of ICP 34.5 gene are deleted and a lacZ disruption disables the ICP6 gene, was provided by Neurovir Inc. The HSV-1 mutant TOZ.1, which is deleted of the genes ICP4, ICP22,


ICP27 and UL41, was a kind gift from Dr William Goins (University of Pittsburgh). All viruses were propagated and titered on cultured 7B cell except 7134 and V422, which were titered on the U2OS cell.

Transfection and Superinfection Cells were seeded in six-well plates 12 h before transfection. Monolayers at 40–60% confluency were washed once with PBS followed by addition of 0.8 ml of serumfree medium for each well and put back into the CO2 incubator for 30 min before transfection. In all, 2 mg of total plasmid(s) for each well were used for transfection using Lipofectamine PLUS (Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instruction. At 24 h after transfection, cells were either infected (superinfection) with various HSV-1 mutants at an MOI of 5 or mock infected with virus-free medium. After incubation at 371C for 24 h, cell lysates were collected for luciferase and/or b-galactosidase enzyme assays. Luciferase enzyme assay After removal of growth medium, 250 ml of 1 Reporter Lysis Buffer (RLB, Luciferase Assay System, Promega, Madison, WI, USA) was applied to the cultured cells in each well of 6-well plates followed by a 15-min incubation at room temperature. Cell lysates were prepared by scraping cells in the presence of 1 RLB, and then transferring them into 1.5 ml microfuge tubes. Cell debris was removed by centrifuge at 12 000 g for 2 min at room temperature. A volume of 20 ml of lysates from NHLF samples or 10 mL of lysates from other cell samples was mixed with 100 ml of Luciferase Assay Reagent (Luciferase Assay System; Promega) and the light intensity was measured for 30 s in a luminometer (OPTOCOMP I, MGM Instruments, Inc., Hamden, CT, USA). b-Galactosidase enzyme assay A measure of 50 ml of cell lysate in 1 RLB was mixed with equal volume of Assay 2 Buffer (b-Galactosidase Enzyme Assay System, Promega) in each well of a 96-well plate and was incubated at 371C for 30 min before the reaction was stopped by adding 150 ml of 1 M sodium carbonate in each well. The absorbance of samples at 420 nm was read in a plate spectrophotometer (mQuant, BIO-TEK Instruments, Inc., Winooski, VT, USA). Single-step growth assay NHLF cells were seeded in six-well plates at a density of 6 105 cells/well and infected 12 h later with either a209 amplicon CgalD3/mixture or CgalD3 only at an MOI of 1. The infected cells were then harvested at 48 h by cell scraping and collection of the media. Samples were then frozen/thawed and titered by plaque assay on 7B cell monolayers. (PCR-EIA) for quantitation of telomerase activity For the preparation of cell extracts, cells tested were suspended at lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM MgCl2, 1 mM ethyleneglycol bis(2-aminoethyl-ether) tetraacetic acid (EGTA), 0.5% 3-[3-cholamidopropyl] dimethylammonio)-1-propane sulfonate (CHAPS), 10% glycerol, 5 mM mercaptoethanol and 0.1 mM phenyl-

methanesulfonyl fluoride) and incubated on ice for 30 min. The sequence and source of TS and CX primers were previously described.29 Biotinylated TS (TS-B) and digoxigeninated CX (CX-D) oligonucleotides were purchased from Genasia Scientifics Inc., Taipei, Taiwan. The PCR-EIA method was performed as follows. First, the TS-B and CX-D primers were heated at 951C for 5 min before being added to the reaction mixtures. Then, aliquots of cell extracts containing 3 mg protein were added to 30 ml reaction mixtures containing 0.5 mM TS-B primer, 0.5 mM CX-D primer, 2 U of Taq DNA polymerase (HT Biotech. Ltd, Taipei, Taiwan), 20 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 63 mM KCl, 0.005% Tween-20, 1 mM EGTA, 50 mM dNTP and 0.1 mg/ml bovine serum albumin. RNase digestion was performed as a control to confirm that the activity was that of telomerase. For these reactions, cell extracts were preincubated with 200 mg/mL of RNase A (Boehringer Mannheim, Mannheim, Germany) at room temperature for 20 min before being added to the reaction mixtures. The TRAP (Telomeric Repeat Amplification Protocol)86 reaction mixtures were incubated at 251C for 15 min, and then amplified by 30 cycles of PCR at 941C for 30 s, 551C for 30 s, and 721C for 1 min in a DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA). After PCR, 5 ml of the PCR products was dispensed into streptavidincoated wells (Boehringer Mannheim), and incubated with 100 ml of anti-digoxigenin antibody conjugated with horseradish peroxidase (15 mU/mL, Boehringer Mannheim) at 301C for 60 min in EIA reaction buffer, which contained 100 mM Tris, pH 7.4, 150 mM NaCl, 0.1% bovine serum albumin, 5% fetal bovine serum, 0.1% Tween-20, 0.1% Nonidet P-40 and antibiotics (100 U/ml penicillin, 100 U/ml streptomycin, 0.25 mg/ml amphotericin B). The plates were washed four times with 200 ml of washing solution (100 mM Tris , pH 7.4, 150 mM NaCl, 0.1% Tween-20, 0.1% Nonidet P-40), and enzyme reactions were stopped by the addition of 100 ml of 2 N HCl to each well. Colorimetric signals were determined by measuring the absorbance at 450 nm using an automatic microwell reader (ThermoMax, Molecular Devices Co., Sunnyvale, CA, USA).

1499

Quantitative RT-PCR Total RNA was extracted from infected cells with TRIzol Reagents (Invitrogen). Random hexamers were used for cDNA synthesis with TaqMan Reverse Trascription Reagents (Applied Biosystems). For quantitative PCR (QPCR), primers ACT-F (ACGAGGCCCAGAGCAA GAG) and ACT-R (TCTCCATGTCGTCCCAGTTG) were used to detect b-actin cDNA as internal control. Primers ICP0-F (TTACGTGAACAAGACTATCACGGG) and ICP0-R (TCCATGTCCAGGATGGGC) were used to detect ICP0 cDNA (the amplicon size was 51 bp). The QPCR was achieved by using SYBR Green Master Mix (Applied Biosystems) with ABI PRISM 7000 (Applied Biosystems). Statistical method All experiments were conducted in triplicate unless specified. Results are expressed as means 7SE. Statistical comparisons were made by two-tailed t-test. A value of P less than 0.05 was accepted as significant. Gene Therapy


1500

Acknowledgements We thank Drs J Smiley of University of Alberta, Stephen A Rice of University of Minnesota Medical School, Priscilla A Schaffer of University of Pennsylvania School of Medicine, William Goins of University of Pittsburgh and Paul Johnson of Neurovir Inc. for the HSV-1 mutants used in the present study. We also thank Drs David L Bartlett of National Cancer Institute, Peter O’Hare of Marie Curie Research Institute and Saul Silverstein of Columbia University for providing us the plasmid constructs. This study was supported by the grants from National Science Council, ROC to C-T Yang, Canadian Institute of Health Research to W Jia and the Terry Fox Foundation for W Jia and P Rennie.

References 1 Glorioso JC et al. HSV as a gene transfer vector for the nervous system. Mol Biotechnol 1995; 4: 87–99. 2 Glorioso JC, DeLuca NA, Fink DJ. Development and application of herpes simplex virus vectors for human gene therapy. Annu Rev Microbiol 1995; 49: 675–710. 3 Jia WW et al. Selective destruction of gliomas in immunocompetent rats by thymidine kinase-defective herpes simplex virus type 1 [see comments]. J Natl Cancer Inst 1994; 86: 1209–1215. 4 Miyatake S, Iyer A, Martuza RL, Rabkin SD. Transcriptional targeting of herpes simplex virus for cell-specific replication. J Virol 1997; 71: 5124–5132. 5 Advani SJ et al. Replication-competent, nonneuroinvasive genetically engineered herpes virus is highly effective in the treatment of therapy-resistant experimental human tumors. Cancer Res 1999; 59: 2055–2058. 6 Martuza RL. Conditionally replicating herpes vectors for cancer therapy. J Clin Invest 2000; 105: 841–846. 7 Park BJ et al. Augmentation of melanoma-specific gene expression using a tandem melanocyte-specific enhancer results in increased cytotoxicity of the purine nucleoside phosphorylase gene in melanoma. Hum Gene Ther 1999; 10: 889–898. 8 Brookes DE et al. Relative activity and specificity of promoters from prostate-expressed genes. Prostate 1998; 35: 18–26. 9 Samaniego LA, Neiderhiser L, DeLuca NA. Persistence and expression of the herpes simplex virus genome in the absence of immediate-early proteins. J Virol 1998; 72: 3307–3320. 10 Honess RW, Roizman B. Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides. Proc Natl Acad Sci USA 1975; 72: 1276–1280. 11 Batterson W, Roizman B. Characterization of the herpes simplex virion-associated factor responsible for the induction of alpha genes. J Virol 1983; 46: 371–377. 12 Campbell ME, Palfreyman JW, Preston CM. Identification of herpes simplex virus DNA sequences which encode a transacting polypeptide responsible for stimulation of immediate early transcription. J Mol Biol 1984; 180: 1–19. 13 Clements JB, Watson RJ, Wilkie NM. Temporal regulation of herpes simplex virus type 1 transcription: location of transcripts on the viral genome. Cell 1977; 12: 275–285. 14 Pereira L, Wolff MH, Fenwick M, Roizman B. Regulation of herpesvirus macromolecular synthesis. V. Properties of alpha polypeptides made in HSV-1 and HSV-2 infected cells. Virology 1977; 77: 733–749. 15 Wilcox KW, Kohn A, Sklyanskaya E, Roizman B. Herpes simplex virus phosphoproteins. I. Phosphate cycles on and off some viral polypeptides and can alter their affinity for DNA. J Virol 1980; 33: 167–182. Gene Therapy

16 Whitley RJ, Kimberlin DW, Roizman B. Herpes simplex viruses. Clin Infect Dis 1998; 26: 541–553; quiz 554-545. 17 DeLuca NA, Schaffer PA. Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol Cell Biol 1985; 5: 1997–1208. 18 Dixon RA Schaffer PA. Fine-structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate early protein VP175. J Virol 1980; 36: 189–203. 19 Gelman IH, Silverstein S. Identification of immediate early genes from herpes simplex virus that transactivate the virus thymidine kinase gene. Proc Natl Acad Sci USA 1985; 82: 5265– 5269. 20 Mavromara-Nazos P et al. Regulation of herpes simplex virus 1 genes: alpha gene sequence requirements for transient induction of indicator genes regulated by beta or late (gamma 2) promoters. Virology 1986; 149: 152–164. 21 O’Hare P, Hayward GS. Evidence for a direct role for both the 175,000- and 110,000-molecular- weight immediate-early proteins of herpes simplex virus in the transactivation of delayedearly promoters. J Virol 1985; 53: 751–760. 22 Quinlan MP, Knipe DM. Stimulation of expression of a herpes simplex virus DNA-binding protein by two viral functions. Mol Cell Biol 1985; 5: 957–963. 23 Costanzo F, Campadelli-Fiume G, Foa-Tomasi L, Cassai E. Evidence that herpes simplex virus DNA is transcribed by cellular RNA polymerase B. J Virol 1977; 21: 996–1001. 24 Dai JL, Burnstein KL. Two androgen response elements in the androgen receptor coding region are required for cell-specific up-regulation of receptor messenger RNA. Mol Endocrinol 1996; 10: 1582–1594. 25 Jong HS et al. Up-regulation of human telomerase catalytic subunit during gastric carcinogenesis. Cancer 1999; 86: 559–565. 26 Tahara H et al. Immuno-histochemical detection of human telomerase catalytic component, hTERT, in human colorectal tumor and non-tumor tissue sections. Oncogene 1999; 18: 1561–1567. 27 Hisatomi H et al. Levels of telomerase catalytic subunit mRNA as a predictor of potential malignancy. Int J Oncol 1999; 14: 727–732. 28 Nakamura Y et al. Quantitative reevaluation of telomerase activity in cancerous and noncancerous gastrointestinal tissues. Mol Carcinog 1999; 26: 312–320. 29 Cheng AJ et al. Polymerase chain reaction-based enzyme immunoassay for quantitation of telomerase activity: application to colorectal cancers. Jpn J Cancer Res 1999; 90: 280–285. 30 Wang M et al. High-efficacy thymidine kinase gene transfer to ovarian cancer cell lines mediated by herpes simplex virus type 1 vector. Gynecol Oncol 1998; 71: 278–287. 31 Frenkel N, Singer O, Kwong AD. Minireview: the herpes simplex virus amplicon–a versatile defective virus vector. Gene Therapy 1994; 1: S40–S46. 32 Fraefel C, Jacoby DR, Breakefield XO. Herpes simplex virus type 1-based amplicon vector systems. Adv Virus Res 2000; 55: 425–451. 33 Herrlinger U et al. HSV-1 infected cell proteins influence tetracycline-regulated transgene expression. J Gene Med 2000; 2: 379–389. 34 Hobbs WE, 2nd DeLuca NA. Perturbation of cell cycle progression and cellular gene expression as a function of herpes simplex virus ICP0. J Virol 1999; 73: 8245–8255. 35 Cerimele F et al. Kaposi’s sarcoma-associated herpesvirus can productively infect primary human keratinocytes and alter their growth properties. J Virol 2001; 75: 2435–2443. 36 Wolthers KC et al. Normal T-cell telomerase activity and upregulation in human immunodeficiency virus-1 infection. Blood 1999; 93: 1011–1019.


1501 37 Jason S, Knight MA, Cotter IR, The latency-associated nuclear antigen of kaposi’s sarcoma-associated herpesvirus transactivates the telomerase reverse transcriptase promoter. J Biol Chem 2001; 276: 22971–22978. 38 Smith JS et al. Herpes simplex virus-2 as a human papillomavirus cofactor in the etiology of invasive cervical cancer. J Natl Cancer Inst 2002; 94: 1604–1613. 39 Lehtinen M et al. Herpes simplex virus and risk of cervical cancer: a longitudinal, nested case–control study in the nordic countries. Am J Epidemiol 2002; 156: 687–692. 40 Scurry J, Wells M. Viruses in anogenital cancer. Epithelial Cell Biol 1992; 1: 138–145. 41 Maitland NJ. The aetiological relationship between herpes simplex virus type 2 and carcinoma of the cervix: an unanswered or unanswerable question? Cancer Surv 1988; 7: 457–467. 42 Madeleine MM et al. Cofactors with human papillomavirus in a population-based study of vulvar cancer. J Natl Cancer Inst 1997; 89: 1516–1523. 43 Murthy NS, Mathew A. Risk factors for pre-cancerous lesions of the cervix. Eur J Cancer Prev 2000; 9: 5–14. 44 DiPaolo JA et al. Relationship of stable integration of herpes simplex virus-2 Bg/II N subfragment Xho2 to malignant transformation of human papillomavirus-immortalized cervical keratinocytes. Int J Cancer 1998; 76: 865–871. 45 Olsen AO et al. Herpes simplex virus and human papillomavirus in a population-based case–control study of cervical intraepithelial neoplasia grade II–III. Apmis 1998; 106: 417–424. 46 Haverkos H, Rohrer M, Pickworth W. The cause of invasive cervical cancer could be multifactorial. Biomed Pharmacother 2000; 54: 54–59. 47 Mineta T et al. Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1995; 1: 938–943. 48 Rampling R et al. Toxicity evaluation of replication-competent herpes simplex virus (ICP 34.5 null mutant 1716) in patients with recurrent malignant glioma. Gene Therapy 2000; 7: 859–866. 49 Kanangat S, Babu JS, Knipe DM, Rouse BT. HSV-1-mediated modulation of cytokine gene expression in a permissive cell line: selective upregulation of IL-6 gene expression. Virology 1996; 219: 295–300. 50 Margolis DM, Rabson AB, Straus SE, Ostrove JM. Transactivation of the HIV-1 LTR by HSV-1 immediate-early genes. Virology 1992; 186: 788–791. 51 Jang KL, Pulverer B, Woodgett JR, Latchman DS. Activation of the cellular transcription factor AP-1 in herpes simplex virus infected cells is dependent on the viral immediate-early protein ICPO. Nucleic Acids Res 1991; 19: 4879–4883. 52 Cheung P, Panning B, Smiley JR. Herpes simplex virus immediate-early proteins ICP0 and ICP4 activate the endogenous human alpha-globin gene in nonerythroid cells. J Virol 1997; 71: 1784–1793. 53 Kawaguchi Y et al. Herpes simplex virus 1 alpha regulatory protein ICP0 functionally interacts with cellular transcription factor BMAL1. Proc Natl Acad Sci USA 2001; 98: 1877–1882. 54 Sacks WR Schaffer PA. Deletion mutants in the gene encoding the herpes simplex virus type 1 immediate-early protein ICP0 exhibit impaired growth in cell culture. J Virol 1987; 61: 829–839. 55 Stow ND, Stow EC. Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw110. J Gen Virol 1986; 67: 2571–2585. 56 Cai W, Schaffer PA. Herpes simplex virus type 1 ICP0 regulates expression of immediate–early, early, and late genes in productively infected cells. J Virol 1992; 66: 2904–2915. 57 Everett RD. ICP0, a regulator of herpes simplex virus during lytic and latent infection. Bioessays 2000; 22: 761–770. 58 Sekulovich RE, Leary K, Sandri-Goldin RM. The herpes simplex virus type 1 alpha protein ICP27 can act as a trans-repressor or a

59

60

61

62

63 64 65

66

67

68

69

70

71

72

73

74

75

76

77

trans-activator in combination with ICP4 and ICP0. J Virol 1988; 62: 4510–4522. Shapira M, Homa FL, Glorioso JC, Levine M. Regulation of the herpes simplex virus type 1 late (gamma 2) glycoprotein C gene: sequences between base pairs 34 to +29 control transient expression and responsiveness to transactivation by the products of the immediate early (alpha) 4 and 0 genes. Nucleic Acids Res 1987; 15: 3097–3111. Campbell ME, Palfreyman JW, Preston CM. Identification of herpes simplex virus DNA sequences which encode a transacting polypeptide responsible for stimulation of immediate early transcription. J Mol Biol 1984; 180: 1–19. Dalrymple MA, McGeoch DJ, Davison AJ, Preston CM. DNA sequence of the herpes simplex virus type 1 gene whose product is responsible for transcriptional activation of immediate early promoters. Nucleic Acids Res 1985; 13: 7865–7879. Eidson KM et al. Expression of herpes simplex virus ICP0 inhibits the induction of interferon-stimulated genes by viral infection. J Virol 2002; 76: 2180–2191. Mossman KL et al. Herpes simplex virus triggers and then disarms a host antiviral response. J Virol 2001; 75: 750–758. Kirn DH. A tale of two trials: selectively replicating herpesviruses for brain tumors. Gene Therapy 2000; 7: 815–816. Markert JM et al. . Conditionally replicating herpes simplex virus mutant. G207 for the treatment of malignant glioma: results of a phase I trial. Gene Therapy 2000; 7: 867–874. Varghese S et al. Preclinical safety evaluation of G207, a replication-competent herpes simplex virus type 1, inoculated intraprostatically in mice and nonhuman primates. Hum Gene Ther 2001; 12: 999–1010. Jia WW, Tan J, Redekop GJ, Goldie JH. Toxicity studies in thymidine kinase-deficient herpes simplex virus therapy for malignant astrocytoma. J Neurosurg 1996; 85: 662–666. Sundaresan P, Hunter WD, Martuza RL, Rabkin SD. Attenuated, replication-competent herpes simplex virus type 1 mutant G207: safety evaluation in mice. J Virol 2000; 74: 3832–3841. Krisky DM et al. Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits long-term gene expression in neurons. Gene Therapy 1998; 5: 1593–1603. Marconi P et al. Replication-defective herpes simplex virus vectors for neurotrophic factor gene transfer in vitro and in vivo. Gene Therapy 1999; 6: 904–912. Fraefel C et al. Gene transfer into hepatocytes mediated by helper virus-free HSV/AAV hybrid vectors. Mol Med 1997; 3: 813–825. Saeki Y et al. Improved helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome. Mol Ther 2001; 3: 591–601. Logvinoff C Epstein AL. A novel approach for herpes simplex virus type 1 amplicon vector production, using the Cre-loxP recombination system to remove helper virus. Hum Gene Ther 2001; 12: 161–167. Aboody-Guterman KS et al. Green fluorescent protein as a reporter for retrovirus and helper virus- free HSV-1 amplicon vector-mediated gene transfer into neural cells in culture and in vivo. Neuroreport 1997; 8: 3801–3808. Miyatake S, Iyer A, Martuza RL, Rabkin SD. Transcriptional targeting of herpes simplex virus for cell-specific replication. J Virol 1997; 71: 5124–5132. Ripple MO et al. Effect of antioxidants on androgen-induced AP1 and NF-kappaB DNA-binding activity in prostate carcinoma cells. J Natl Cancer Inst 1999; 91: 1227–1232. Chen JK, Hoshi H, McClure DB, McKeehan WL. Role of lipoproteins in growth of human adult arterial endothelial and smooth muscle cells in low lipoprotein-deficient serum. J Cell Physiol 1986; 129: 207–214. Gene Therapy


1502 78 Wang Q, Guo J, Jia W. Intracerebral recombinant HSV-1 vector does not reactivate latent HSV-1. Gene Therapy 1997; 4: 1300– 1304. 79 Cong YS, Wen J, Bacchetti S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum Mol Genet 1999; 8: 137–142. 80 Rennie PS et al. Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 1993; 7: 23–36. 81 Smiley JR, Duncan J. Truncation of the C-terminal acidic transcriptional activation domain of herpes simplex virus VP16 produces a phenotype similar to that of the in1814 linker insertion mutation. J Virol 1997; 71: 6191–6193. 82 Long MC et al. ICP22 and the UL13 protein kinase are both required for herpes simplex virus-induced modification of the large subunit of RNA polymerase II. J Virol 1999; 73: 5593–5604.

Gene Therapy

83 Mossman KL, Saffran HA, Smiley JR. Herpes simplex virus ICP0 mutants are hypersensitive to interferon. J Virol 2000; 74: 2052–2056. 84 McMahan L, Schaffer PA. The repressing and enhancing functions of the herpes simplex virus regulatory protein ICP27 map to C-terminal regions and are required to modulate viral gene expression very early in infection. J Virol 1990; 64: 3471– 3485. 85 Johnson PA, Yoshida K, Gage FH, Friedmann T. Effects of gene transfer into cultured CNS neurons with a replication-defective herpes simplex virus type 1 vector. Brain Res Mol Brain Res 1992; 12: 95–102. 86 Kim NW et al. Specific association of human telomerase activity with immortal cells and cancer [see comments]. Science 1994; 266: 2011–2015.