Food Sci. Biotechnol. 19(6): 1627-1633 (2010) DOI 10.1007/s10068-010-0230-8
RESEARCH ARTICLE
High Cell Density Cultivation of Recombinant Escherichia coli for Production of Rat Procarboxypeptidase B Chang-Kyu Kim, Sang-Mahn Lee, and Sang Min Jeong
Received: 20 September 2010 / Revised: 10 October 2010 / Accepted: 11 October 2010 / Published Online: 31 December 2010 © KoSFoST and Springer 2010
Abstract The recombinant Escherichia coli harboring pPT/proCPB (procarboxypeptidase B) gene was constructed for the overexpression of rat proCPB gene. The proCPB expression was controlled by the rrnB P2 promoter fused with lac operator. In the fed batch fermentations, the expression of proCPB was accelerated by the temperature shift from 30 to 37oC without lac operon inducers such as isopropyl-1-thio-β-D-galactoside (IPTG) and lactose. Fermentation strategies including the 3-step increase was optimized to harvest high titers of cell growth and ProCPB. The ideal results of optical density 80 and 66.7% of ProCPB content were obtained through the optimized 3step shift fed-batch fermentation from 30 to 37oC for 6 hr. After refolding and activation of ProCPB to CPB by trypsin treatment, the CPB activity of 39,375 U/L with specific activity 135 U/mg was obtained in the culture broth. In the conversion reaction by ProCPB, preproinsulin was successfully transformed into insulin. Keywords: temperature shift fermentation, rat procarboxypeptidase B (proCPB, ProCPB), high cell density, lac repressor titration-out, preproinsulin bioconversion
Sang Min Jeong ( ) Department of Biochemistry and Molecular Cell Biology, College of Veterinary Medicine, Konkuk University, Seoul 143-701, Korea Tel & Fax: +82-2-450-3704 E-mail:
[email protected] Chang-Kyu Kim College of Animal Bioscience & Technology, Konkuk University, Seoul 143-701, Korea Sang-Mahn Lee Department of Life Science, Cheongju University, Cheongju, Chungbuk 360-764, Korea
Introduction Carboxypeptidase B [peptidyl-L-lysine (-L-arginine) hydrolase EC 3.4.17.2 ] is a zinc-containing pancreatic exopeptidase which specifically remove C-terminal Arg, Lys from peptides (1,2). The enzymes were isolated from porcine, bovine pancreas (3,4). The signal peptide of procarboxypeptidase B (ProCPB) is cleaved off during transport of pre-proCPB through the membrane into the cisterna of the endoplasmic reticulum. Finally, the active form of CPB is generated by cleavage of the pro-region peptide by trypsin (5). The cDNAs encoding human proCPB and porcine proCPB have been cloned and expressed in recombinant strains (6-9) and rat proCPB gene has also been cloned and expressed in Escherichia coli (10). In view of safety, the recombinant CPB is important for production of recombinant insulin. Because CPB of animal origin have some safety problem such as dangerous bovine spongeform encephalopathy (BSE), so the recombinant CPB is recommended. In processing of proinsulin, trypsin digest the carboxyl side of peptide bonds of lysine or arginine at the C-terminus of recombinant proinsulin. Also, the mature CPB cuts off a basic amino acid at the carboxyl terminus, which is newly formed by trypsin. The final products of the enzyme reaction are insulin and digested C-peptide fragment. On the other hand, high cell density culture is important for improving the product yield of the recombinant protein (11). In fed-batch fermentations, separation of the 2 phases can be achieved by delaying induction time until the cell density reaches a suitable value. Among several inducible system, lac-based promoters which can be induced by the addition of isopropyl-1-thio-β-D-galactoside (IPTG) are the most frequently used ones. However, it should be noted that high concentration of IPTG can inhibit cell growth and recombinant protein production (12). It should also be mentioned that the IPTG inducible system may not be
1628
desirable for the production of recombinant protein because of the high cost when it was used in commercial scale (13). In order to solve the problem, an efficient pPT system was developed and applied for the preproinsulin fusion protein production. The plasmid pPT has a hybrid region including growth rate-dependent P2 promoter (14) and lac operator for protein expression. The degree of repression depends on the ratio of LacI molecules to the DNA operator sites in a cell (15). In order to achieve high cell density of recombinant E. coli, it is important to reduce inhibitory metabolite such as acetate for cell growth. So, it is very critical problem how to supply the nitrogen and carbon source into the culture for decrease of the amount of acetate (16-18). It has focused on the effective improvement of enzyme production yield in this study compared to the previous reports (8-10). To maximize the recombinant ProCPB production, cell growth and time-dose of temperature shift were controlled in fermentation system of E. coli.
Materials and Methods Materials and bacterial strain The main reagents and restriction enzymes were purchased from Takara (Takara Korea, Korea). Comassie brilliant blue (CBB) G-200 was ordered from Bio-Rad (USA). A rat pancreas QUICKClone cDNA was ordered from BD Bioscience (Clontech 7156-1; USA), and E. coli JM109 (endA1 recA1 gyrA96 hsdR17 relA1 supE44 thiD (lac-proAB) F' [traD36 proAB+ lacIq lacZ DM15]) was purchased from Stratagene (USA) as bacterial host strain. All other reagents were purchased from Sigma-Aldrich (USA). The employed main apparatus are shown as follows; polymerase chain reaction (PCR) machine (Gene Amp PCR system 2700; Applied Biosystems, USA), 5-L fermentor (KF-5L; Kobiotech, Korea), spectrophotometer (UV-265; Shimadzu, Japan), homogenizer (14.56VH; Rannie, Denmark), densitometry ImageMaster VDS system (Pharmacia Biotechnology, Sweden), glucose analyzer (2700 STAT; YSI Inc., USA), sodium dodesyl sulfate-poly acrylamide gel electrophoresis (SDS-PAGE) gel (NuPAGE 4-12% Bis-Tris Gel; Invitrogen, USA). Amplification of proCPB gene and expression plasmid construction Expression plasmid pPT was used for the entire experimental procedure. To express the recombinant proCPB gene in E. coli, pPT harboring rat proCPB gene construct was completed using plasmid pPT. First amplification of the rat proCPB gene was carried out with a rat pancreas QUICK-Clone cDNA (BD Bioscience) as a template, and 2 DNA primers such as rppcbBF: CAGGCAGGATCCATGTTGCTGCTAGCCCTGGTC
C. -K. Kim et al.
and RcbHR: GGTCCAAAGCTTTCACTAATATAGATGT TCTCGGCA. The italic sequences of the 2 primers indicate the restriction sites for BamHI and HindIII, respectively. Second PCR was performed to eliminate NdeI restriction site inside proCPB gene sequence, because that NdeI site prevents the completion of full-length of cDNA for proCPB gene. The proCPB gene without NdeI site was amplified with first PCR product as 1 template and 3 DNA oligomers for base substitutions (dark-shadow) of Nde I sequence (underlined) such as Rcpb1034F:AAG TAC ACC TAT GGC CCA, Rcpb1034R: TGG GCC ATA GGT GTA CTT and RcpbMproNF: GTG GCC CAT ATG CAT GCT TCC GAG GAG CAC. First 1017 bp PCR product was obtained by Rcpb1034R and RcpbMproNF primers. The second 237 bp DNA product was amplified by Rcpb1034F and rcbHR. The third PCR was carried out with these 2 PCR products (1,017 and 237 bp) as templates and 2 primers (RcpbMproNF and rcbHR). The condition of PCR was set as follows: 30 times of repeats consisted of 94oC for 20 sec, 55oC for 30 sec, and 72oC for 15-60 sec. Final PCR products and pPT plasmid were digested with NdeI and HindIII and then purified with Geneclean Spin kit (BIO 101). The purified DNA fragments were ligated with DNA ligase I. JM109 cells were transformed with the expression plasmid harboring the proCPB gene. Fed-batch culture condition The medium used for stock and seed culture of recombinant E. coli strain was composed of 10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, 100 mg/L ampicillin, and 0.1 g/L antifoaming agent (Silicon fluid SAG-471; Union Carbide, USA). The 500 mL seed culture was grown overnight at 30oC and 200 rpm in a rotary shaker. The nutrient sources were fed by adding different 3 types of solution including initial production medium, feeding solution I and II. The production medium for fed-batch fermentation contained/ L: 6 g glucose, 4 g yeast extract, 4 g KH2PO4, 8 g Na2HPO4·12H2O, 3 g MgSO4·7H2O, 0.2 g FeSO4·7H2O, 0.075 g MnSO4·5H2O, 0.013 g CoCl2·6H2O, 0.075 g ZnSO4·7H2O, 0.013 g CuCl2·2H2O, 100 mg ampicillin, 0.013 g Na2MoO4·2H2O, and 0.2 g antifoaming agent. The feed solution I contained/L: 600 g glucose and solution II contained/L: 150 g yeast extract, 20 g MgSO4, 0.2g FeSO4·7H2O, 0.075 g MnSO4·5H2O, 0.013 g CoCl2·6H2O, 0.075 g ZnSO4·7H2O, 0.013 g CuCl2·2H2O, 0.013 g Na2MoO4·2H2O, and 1 g antifoaming agent. Fed batch culture was performed in a 5-L fermentor with a working volume of 2.5 L. Air-saturation was maintained at 20% of dissolved oxygen concentration through high speed up to 700 rpm, aeration rate up to 2 vvm, and some manual change of internal pressure. The pH of culture broth was controlled at 6.8 using ammonia water. The substrate feeding strategy was glucose concentration control method
Temperature-controlled Production of Rat proCPB in E. coli
based on pH-stat and glucose concentration in the culture broth was maintained below 0.02%. The culture temperature was carried out initially at 30oC and changed to 37oC. The culture temperature-shift was performed as the almost same method with some modifications as previous report (19). For the 3-step process, culture temperature was raised from 30 to 37oC by 3 times shift with the different intervals of temperature. After temperature increment within 10 min, temperature maintenance was taken for 2 or 4 hr in each step. Optical density 30 was the most effective first shift-point for the production of recombinant enzymes considering the contents of recombinant protein (19). According to our result of preliminary experiment (data not shown) and the previous report, optical density 30 was selected as the start point of temperature shift. Analytical methods Apparatus for analyses were introduced as above. Cell density of the culture was determined by reading the absorbance at a wavelength of optical density 600 nm using a spectrophotometer. Glucose concentration in the culture medium was monitored by a glucose analyzer. Rat ProCPB was analyzed on electrophoresis on SDS-PAGE gel. The samples were reduced with 2mercaptoethanol, then run on NuPAGE Bis-Tris Gel. After CBB staining of the gel, the target bands were quantified by densitometry ImageMaster VDS system. Complete refolding of ProCPB ProCPB expressed in plasmid pPT/proCPB gene was formed in inclusion body which was isolated as follows: CaCl2 was added into fermentation broth to precipitate the cultivated cells. The cells were harvested by centrifugation at 4,000×g for 15 min. Cell pellets were suspended in lysis buffer (10% sucrose, 0.1 M Tris-Cl, 50 mM ethylenediamine tetraacetic acid (EDTA), 0.2 M NaCl, and 50 mg/mL lysozyme pH 7.9) and lysed by homogenizer at 14,000 psi. Crude inclusion body was precipitated by centrifugation (10,000×g, 30 min, 4oC) and washed twice with washing buffer (0.1 M Tris-Cl, 20 mM EDTA, 0.1 g/L lysozyme, 1% Triton X-100, and 1 M urea). Intracellular aggregate including ProCPB was dissolved at 2 mg/mL protein concentration in refolding buffer (50 mM glycine, pH 9.5 with NaOH, 8 M urea, 6 mL/L β-mercaptoethanol) and incubated for 4 hr at room temperature and diluted to 0.2 mg/mL in dilution buffer (50 mM glycine, 0.1 mM ZnCl2, pH 9.5). The refolding process was performed at 25oC for 15 hr. The pH of refolding solution was adjusted to 5 with HCl in order to precipitate impure E. coli protein and recovered the supernatant solution containing the refolded ProPCB. The solution containing the refolded ProPCB was adjusted to pH 8.2 and treated with trypsin (300 U/mg) to a final concentration of 10 µg/mL at 37oC for 50 min. To terminate the trypsin reaction, phenylmethylsulfonyl fluoride (PMSF)
1629
was added to a final concentration of 0.1 mM. CPB activity was measured by Folk’s method with Hippuryl-L-Lys as a substrate (20). Application of the bioconversion of proinsulin into insulin using recombinant ProCPB and trypsin The purified preproinsulin with 98% purity was obtained as same as the previous report (21). The refolded preproinsulin in the supernatant was collected and used as a substrate for trypsin and ProCPB. To improve the conversion yield of insulin, the refolded preproinsulin was citraconylated by incubation at pH 8.5 for 2 hr in the presence of citraconic anhydride. Enzymes of 0.45 unit trypsin and 0.2 unit ProCPB/1 mg of the refolded preproinsulin were added into the enzyme reaction mixture containing hydrogen peroxide. High performance liquid chromatography (HPLC) analysis was followed the previous report (22).
Results and Discussion Recombinant rat proCPB expression To avoid a problem about refolding in production of ProCPB, the cDNA of rat proCPB gene was used. It is not clear why mature form of CPB gene products are not refolded correctly after expression in E. coli. Considering this problem, proCPB cDNA was synthesized from a rat pancreas RNA in order to express recombinant proCPB. The whole region of proCPB gene was subcloned into the expression plasmid pPT containing rrnB P2 promoter (14,19). For batch fermentation of the rat proCPB, E. coli harboring pPT/proCPB gene construct was cultivated with a 40 mL scale of initial medium in baffled flask by shaking with 250 rpm at 37oC. The crude extract from recombinant E. coli could be detected on SDS-PAGE. The result of successful proCPB expression was represented by this system (Fig. 1). The estimated target protein migrated at the apparent size of 45 kDa which was consistent with the calculated molecular weight. Refolding and activation of ProCPB It was firstly cultivated at small scale to confirm whether the pPT expression system work or not. Intracellular aggregates in culture broth were recovered, refolded, and activated. As shown in SDS-PAGE analysis, the refolded ProCPB and activated CPB showed that ProCPB was expressed in the recombinant E. coli, and then the refolded ProCPB was clearly converted to active CPB (Fig. 2). The visible CPB band was detected somewhere about 35 kDa and that was consistent with the expected molecular weight. It was induced by the temperature shift during fermentation period for expression of the recombinant ProCPB. To confirm the bioconversion of a preproinsulin fusion protein into insulin,
1630
Fig. 1. Crude extract of recombinant protein on SDS-PAGE. M, size marker as protein standards; lane 1, crude protein extract of E. coli JM109/pPT-Mrpcb.
the inclusion body containing expressed ProCPB was successfully refolded. After refolding the ProCPB inclusion body, ProCPB was activated by trypsin treatment at 25oC to examine the enzyme activity. Before trypsin activation, impurity containing the misfolded ProCPB was removed by precipitation at pH 5. The calculated 39,375 U/L yield of CPB with specific activity 135 U/mg protein was obtained from the culture broth. Temperature shift strategy for ProCPB production in fed-batch fermentation The modulation of growth rate and expression of proCPB by changing culture temperature was carried out in fed-batch fermentations of E. coli harboring pPT/proCPB gene construct. The effects of a temperature shift strategy on cell growth and ProCPB production were investigated in fed-batch fermentation. In 29 hr of the fed-batch fermentation, final optical density and ProCPB expression ratio are shown in Fig. 3. The final optical density 80 and expression rate 66.7% was reached through the 3-step temperature shift fermentation. Temperature shift affected the efficiency of glucose and yeast extract utilization. The expression pattern of typical ProCPB was exhibited on SDS-PAGE analysis with the crude protein extract of recombinant E. coli harboring pPT/ proCPB gene (Fig. 4). In the temperature-shift experiments, however, the protein band of ProCPB was not observed before the temperature change at 18 hr of fed-batch culture at an initial temperature of 30oC (data not shown). As shown in Fig. 4, the temperature shift from 30 to 37oC switched the expression pattern of ProCPB and a significant increase in the band intensity of ProCPB made into its relative protein ratio of 66.7% compared to total protein content. The gradual temperature increase for the production of
C. -K. Kim et al.
Fig. 2. Electrophoretic analysis of the crude extract protein, refolded ProCPB and activated ProCPB by SDS-PAGE. M, size marker as protein standards; lane 1, crude extracts of E. coli JM109/pPT-Mrpcb; lane 2, washed inclusion body containing ProCPB; lane 3, refolded ProCPB; lane 4, activated ProCPB with trypsin treatment. ProCPB and CPB represent the immature form of CPB and processed mature CPB, respectively.
recombinant protein was represented by Son et al. (19). In the regulation of expression, it seems that the chromosomal lac repressor blocks lac operator in the pPT plasmid at 30oC. When temperature was raised from 30 to 37oC, the plasmid copy number may be increased gradually. Therefore the amount of chromosomal lac repressor is not enough to block lac operator in pPT plasmid and lac operator is opened. Finally, the gene expression can be induced as lac repressor is titrated out. This system is similar to a T7 promoter and lac operator fusion system in terms of hybrid system (23,24) but it is different from a lac promoter-lac operator hybrid system in terms of temperature sensitive (ts) mutant repressor usage (15). Consequently, processes for the production of ProCPB were developed in 5-L scale fed-batch fermentations using the recombinant E. coli harboring pPT/proCPB gene transformant with temperature shift strategies. The appropriate temperature control of proCPB expression was performed without the industrially non-effective inducers such as IPTG. In this study, The P2 promoter-inducible expression of proCPB was successfully carried out with 3-step culture temperature shift processes from 30 to 37oC. As described in introduction, temperature shift in fermentation is an effective skill to induce the expression of the target protein (25). It was reported that the transcriptional activity of the growth rate-dependent P2 promoter was responded to growth rate, lack of amino acid, and rRNA gene dose (14,26). In view of the unclear P2 promoter transcriptional activity, our experimental results showed that time-shift control has the suitability for the plentiful production of
Temperature-controlled Production of Rat proCPB in E. coli
Fig. 3. High cell density cultivation of recombinant E. coli harboring rat ProCPB by temperature shift fermentation systems. △ Glucose; ○ O.D.; ■ expression rate of ProCPB
recombinant. Concerning the time interval in temperature shift, we have obtained the most effective production yield of 66.7% contents and optical density 80 as shown in above. Compared with the production yield of recombinant proteins reported in other research data (8-10), our achievement showed the dramatic improvement against Li et al. (10) report which rat recombinant ProCPB was expressed in E. coli as same method of our procedure.
1631
Fig. 4. Time-dependent crude extracts of recombinant ProCPB on SDS-PAGE. E. coli JM109 harboring proCPB gene was grown with the 3-step temperature shift from 30 to 37oC for 6 hr. Lane 111 indicate the samples collected at 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 hr, and the end time-point of fermentation, respectively. Each sample has the same amounts of proteins.
Although porcine and human recombinant ProCPB were expressed, both of studies are researched in Pichia pastoris not E. coli (8,9). Moreover, production yields of recombinant ProCPB of those reports were less or almost same level. Finally, these results showed the more effective expression system for the commercial and industrial production compared to the previous studies.
Fig. 5. Reverse-phase HPLC diagrams for the analysis of the enzymatic conversion of human proinsulin into insulin. The mature insulin and immature intermediates are separated at 10 and 12 min, respectively. (A) Worthington trypsin 0.45 U/mg, porcine CPB 0.2 U/ mg, (B) Worthington trypsin 0.45 U/mg, recombinant rat ProCPB 0.2 U/mg
1632
Conversion of proinsulin into insulin using recombinant ProCPB and trypsin The refolded recombinant ProCPB and trypsin were used in the conversion of H27R proinsulin into insulin. The H27R (28 amino acids) and the proinsulin C-peptide were digested from fusion protein. The resultant products were analyzed by RP-HPLC. H27R proinsulin was citraconylated as described previously (22). HPLC analysis of the reaction solution showed the insulin and the intermediate peaks appeared at a retention time (RT) of approximately 10.0 and 12.1 min, respectively. The same result was obtained in the enzymatic conversion experiment using the commercial porcine CPB (Worthington) and recombinant refolded ProCPB (Fig. 5). The pPT-H27Rpi plasmid encoding for H27R-proinsulin was constructed for the production of proinsulin. This plasmid was employed for the transformation of E. coli JM109. H27R-proinsulin was expressed in its insoluble form, refolded into its native conformation, and purified via chromatography. The H27R is composed of 28 amino acids and the C-terminal residue of the H27R is arginine. The proinsulin C-peptide also harbors arginine residues at its Nterminal and C-terminal ends. The one-step conversion of a proinsulin fusion protein into insulin can be achieved via the simultaneous removal of a H27R and the C-peptide by trypsin and CPB (27). The recombinant ProCPB was substituted for CPB in the same kind of reaction, and these results demonstrate the possibility that the recombinant ProCPB might prove its effectiveness in the production of insulin from the proinsulin fusion protein. In the future, these experimental results in this report could give the more clear data for the commercial utilization of recombinant ProCPB production using E. coli fermentation systems. Acknowledgments This study was supported by Grant to S. M. Jeong from the Brain Korea 21 project. This research was supported by Technology Development Program for Agriculture and Forestry (2010-A008-0034) from Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea. The company grant was kindly supported by Takara Korea.
References 1. Gladner JA, Folk JE. Carboxypeptidase B. II. Mode of action on protein substrates and its application to carboxyl terminal group analysis. J. Biol. Chem. 231: 393-401 (1958) 2. Clauser ES, Gardell J, Craik CS, MacDonard RJ, Rutter WJ. Structural characterization of the rat carboxypeptidase A1 and B genes. Comparative analysis of the rat carboxypeptidase gene family. J. Biol. Chem. 25: 17837-17845 (1988) 3. Uren JR, Neurath H. Mechanism of activation of bovine procarboxypeptidase A S5. Alteration in primary and quaternary structure. Biochemistry 11: 4483-4492 (1972)
C. -K. Kim et al. 4. Kobayashi Y, Kobayashi R, Hirs CH. Identification of zymogen E in complex with bovine procarboxypeptidase A. J. Biol. Chem. 256: 2466-247 (1981) 5. Aviles FX, Vendrell J, Burgos FJ, Sariano F, Mendez E. Sequential homologies between procarboxypeptidase A and B from porcine pancreas. Biochem. Bioph. Res. Co. 130: 98-103 (1985) 6. Eaton DL, Malloy BE, Tsai SP, Henzel W, Drayna D. Isolation, molecular cloning, and partial characterization of a novel carboxypeptidsae B from human plasma. J. Biol. Chem. 266: 21833-21838 (1991) 7. Kim MJ, Lee JH, Lee JH, Seo JH, Nam SW. Overexpression of human procarboxypeptidase B by fed batch cultivation of recombinant. J. Biotechnol. 131(S): S174-S175 (2007) 8. Mansur M, Martínez L, Pérez M, Alonso-del-Rivero M, Márquez I, Proenza Y, Varas L, Aviles FX. Expression, purification, and characterization of porcine pancreatic carboxypeptidase B from Pichia pastoris for the conversion of recombinant human insulin. Enzyme Microb. Tech. 40: 476-480 (2007) 9. Kim MJ, Kim SH, Lee JH, Seo JH, Lee JH, Kim JH, Kim YH, Nam SW. High-level secretory expression of human procarboxypeptidase B by fed-batch cultivation of Pichia pastoris and its partial characterization. J. Microbiol. Biotechn. 18: 1938-1944 (2008) 10. Li SX, Zhang XY, Yuan QS, Gong Y. Cloning and expression of a new rat procarboxypeptidase B gene in Escherichia coli and purification of recombinant carboxypeptidase B. Protein Pept. Lett. 10: 581-590 (2003) 11. Park YC, Kim SJ, Choi JH, Lee WH, Park K, Kawamukai M, Ryu YW, Seo JH. Batch and fed-batch production of coenzyme Q10 in recombinant Escherichia coli containing the decaprenyl diphosphate synthase gene from Gluconobacter suboxydans. Appl. Microbiol. Biot. 67: 192-196 (2005) 12. Choi JH, Jeong KJ, Kim SC, Lee SY. Efficient secretory production of alkaline phosphatase by high cell density culture of recombinant Escherichia coli using the Bacillus sp. endoxylanase signal sequence. Appl. Microbiol. Biot. 53: 640-645 (2000) 13. Choi JH, Keum KC, Lee SY. Production of recombinant proteins by high cell density culture of Escherichia coli. Chem. Eng. Sci. 61: 876-885 (2006) 14. Murray HD, Appleman JA, Gourse RL. Regulation of the Escherichia coli rrnB P2 promoter. J. Bacteriol. 185: 28-34 (2003) 15. Glascock CB, Weickert MJ. Using chromosomal lacIQ1 to control expression of genes on high-copy-number plasmids in Escherichia coli. Gene 223: 221-231 (1998) 16. Jensen EB, Carlsen S. Production of recombinant human growth hormone in Escherichia coli: Expression of different precursors and physiological effects of glucose, acetate, and salts. Biotechnol. Bioeng. 36: 1-11 (1990) 17. Lan JC, Ling TC, Hamilton G, Lyddiatt A. A fermentation strategy for anti-MUC1 C595 diabody expression in recombinant Escherichia coli. Biotechnol. Bioproc. E. 11: 425-431 (2006) 18. Luli GW, Strohl WR. Comparison of growth, acetate production, and acetate inhibition of Escherichia coli strains in batch and fedbatch fermentations. Appl. Environ. Microb. 56: 1004-1011 (1990) 19. Son YJ, Park KH, Lee SY, Oh SJ, Kim CK, Choi BT, Park YC, Seo JH. Effects of temperature shift strategies on human preproinsulin production in the fed-batch fermentation of recombinant Escherichia coli. Biotechnol. Bioproc. E. 12: 556-561 (2007) 20. Wolff EC, Schirmer EW, Folk JE. The kinetics of carboxypeptidase B activity. J. Biol. Chem. 237: 3094-3099 (1962) 21. Son YJ, Kim CK, Choi BT, Park YC, Seo JH. Effects of βmercaptoethanol and hydrogen peroxide on enzymatic conversion of human proinsulin to insulin. J. Microbiol. Biotechn. 18: 983-989 (2008) 22. Son YJ, Kim CK, Kim YB, Kweon DH, Park YC, Seo JH. Effects of citraconylation on enzymatic modification of human proinsulin using trypsin and carboxypeptidase B. Biotechnol. Progr. 25: 10641070 (2009) 23. Dubendorff JW, Studier FW. Controlling basal expression in an inducible T7 expression system by blocking the T7 promoter with
Temperature-controlled Production of Rat proCPB in E. coli lac repressor. J. Mol. Biol. 219: 45-59 (1991) 24. Lebedeva MI, Rogozhkina EV, Tsyba NA, Mashko SV. A new T7 RNA polymerase-driven expression system induced via thermoamplification of a recombinant plasmid carrying a T7 promoterEscherichia coli lac operator. Gene 142: 61-66 (1994) 25. Strandberg L, Enfors SO. Batch and fed batch cultivations for the temperature induced production of a recombinant protein in
1633 Escherichia coli. Biotechnol. Lett. 13: 609-614 (1991) 26. Rasmussen LJ, Lobnerolesen A, Marinus MG. Growth-ratedependent transcription initiation from the dam P2 promoter. Gene 157: 213-215 (1995) 27. Nilsson J, Jonasson P, Samuelsson E, Ståhl S, Uhlén M. Integrated production of human insulin and its C-peptide. J. Biotechnol. 48: 241-250 (1996)
